|
||
-Helical Signal in the Cytosolic Domain of the Interleukin 2 Receptor
Chain Mediates Sorting Towards Degradation after Endocytosis
Unité de Biologie des Interactions Cellulaires, URA CNRS 1960, and * Laboratoire de Résonance Magnétique Nucléaire, URA CNRS 1129, Institut Pasteur, 75724 Paris Cedex 15, France
High-affinity IL2 receptors consist of three
components, the
,
, and
chains that are associated
in a noncovalent manner. Both the
and
chains belong to the cytokine receptor superfamily. Interleukin 2 (IL2) binds to high-affinity receptors on the cell surface
and IL2-receptor complexes are internalized. After endocytosis, the components of this multimolecular receptor have different intracellular fates: one of the
chains,
, recycles to the plasma membrane, while the
others,
and
, are routed towards late endocytic compartments and are degraded. We show here that the cytosolic domain of the
chain contains a 10-amino acid
sequence which codes for a sorting signal. When transferred to a normally recycling receptor, this sequence
diverts it from recycling. The structure of a 17-amino
acid segment of the
chain including this sequence has
been studied by nuclear magnetic resonance and circular dichroism spectroscopy, which revealed that the 10 amino acids corresponding to the sorting signal form an
amphipathic
helix. This work thus describes a novel,
highly structured signal, which is sufficient for sorting
towards degradation compartments after endocytosis.
During receptor-mediated endocytosis, receptors
are transported from one membrane compartment to another. From each compartment, they
can be routed to different destinations, and intracellular transport therefore requires sorting (reviewed in references 18, 54). The best documented sorting is the one which
functions at the plasma membrane to concentrate receptors in clathrin-coated pits. It involves internalization signals, short peptides in the cytosolic part of receptors which
have been classified in two groups, a tyrosine based motif
and a di-leucine based motif (reviewed in reference 49).
After internalization from the plasma membrane, receptors rapidly reach early/recycling endosomes. From there,
some receptors recycle back to the cell surface while others are sorted to different destinations (46). Recycling to
the plasma membrane is generally considered as the default pathway (34, 54). For receptors to exit from the recycling pathway and move to other intracellular destinations
(e.g., in most cases towards late endosomes and lysosomes, or to the trans-Golgi network or major histocompatibility
complex class II compartments) or to new domains on the
cell surface (as in transcytosis) requires selective routing
and depends upon the possession of additional, specific
sorting signals.
Although many internalization signals have now been
described, much less is known about sorting steps from
intracellular endocytic organelles. Receptors which transport nutrients to the cells, such as transferrin or low density lipoprotein receptors, recycle to the plasma membrane, while receptors for hormones and growth factors
are often degraded after internalization. Degradation causes
receptor down modulation and is important for arresting the cell response to growth factors and hormones. The
mechanism by which these receptors are directed towards
degradation is unknown.
Sequences which are necessary for diverting lysosomal
membrane glycoproteins to lysosomes have been described by mutation analysis (reviewed in reference 49).
They belong to the tyrosine or di-leucine families of signals described for clathrin-coated pit endocytosis (20, 24,
33, 43, 59). After synthesis, lysosomal proteins are sorted
from the trans-Golgi network to endosomes and lysosomes (20, 24). Alternatively, some lysosomal proteins are
exocytosed and then internalized by receptor-mediated endocytosis (33, 43, 59); they are then sorted from endosomes to lysosomes. In these cases, the same mutations
usually affect both endocytosis and lysosomal targeting,
and the distance between the signal and the plasma membrane may also be important for sorting (47). By mutational analysis, sequences necessary for internalization and
degradation of nonlysosomal membrane proteins have been
reported (2, 29, 32, 41, 55). However, in all of these cases, it has not been shown that a short sequence is sufficient to
serve as a degradation signal by transferring it to a normally recycling receptor, which would then become degraded as a result. Only one case of a membrane molecule
with a short sequence sufficient for lysosomal degradation
after endocytosis has been reported, that of P-selectin.
The cytosolic tail of this cell adhesion molecule contains a
degradation signal which does not match any of the signals
described so far (15).
The cytokine interleukin 2 (IL2)1 is produced by activated helper T lymphocytes and stimulates proliferation
and effector functions of a variety of cells of the immune
system (36). High-affinity IL2 receptors (kD One of the early events following IL2 binding to high-affinity receptors on the cell surface is the internalization of
IL2 receptor complexes (12, 51). After endocytosis, the components of this multimolecular receptor have different
intracellular fates: one of the chains, This multimeric receptor represents a particularly interesting model for studying sorting signals during receptormediated endocytosis. We have previously shown that the
Cells, Monoclonal Antibodies, and Reagents
K562, a human erythroleukemia cell line, was grown in suspension in RPMI
1640, 10% decomplemented FCS, supplemented with 2 mM l-glutamine.
Stably transfected K562 cells were grown in the same medium supplemented with 1.5 mg/ml G418. HeLa cells were grown in DMEM, 10% decomplemented FCS, supplemented with 2 mM l-glutamine.
Monoclonal antibodies 7G7B6 (IgG2a) and OKT9 (IgG1), directed
against the Saponin and cycloheximide were obtained from Sigma Chem. Co. (St.
Louis, MO). 2,2,2-Trifluoroethyl alcohol-d2,OH (99 atom %D) and deuterium oxide (99.9 atom %) were purchased from Solvants Documentation Synthèse (S.D.S., France).
Plasmids
All constructs were prepared in the NT vector, a kind gift of Dr. C. Bonnerot (Institut Curie, Paris, France). The plasmid pdKCR The plasmid T-XO, a kind gift of Dr. P. Cosson (Basel, Switzerland), is
a modified version of IL2R This plasmid was further modified by inserting a sequence coding
for the transferrin receptor YTRF internalization signal, in the cytosolic
part of All T-XO Cell Transfection
All kinetics and half-life analyses described here have been performed in
stably transfected K562 cells. To generate stable transfectants, 7 × 106
K562 cells were washed once in DMEM, 4.5 g/l glucose and resuspended in 800 µl of the same medium, with 20 µg of the plasmid of interest. Electroporation was performed using the Easyject electroporator (Eurogentec, Seraing, Belgium) with simple pulse, 240 V, 1,500 µF. Selection with
1.5 mg/ml G418 (Geneticin, Gibco/BRL, Gaithersburg, MD) was initiated
2 d after transfection, and the cells were cloned in 96-well dishes.
G418-resistant clones were assayed for expression by flow cytometry using anti- HeLa cells were used for transient expression of the constructs. Transfections were performed using the calcium phosphate method as described in reference 1 using 5 µg of DNA per transfection.
Endocytosis of Radiolabeled Antibodies
7G7B6 and 561 antibodies were radiolabeled with 125I by the chloramine T
method to a specific activity of 2-10 µCi/µg. For endocytosis experiments,
2 × 106 cells were incubated in 100 µl RPMI-Hepes, pH 7.2, 1 mg/ml BSA, at 37°C, and 1-5 nM 125I-labeled antibody was added. After incubation at
37°C for the indicated times, the cells were rapidly cooled to 4°C and
washed twice. Cell surface-associated radioactive ligand was then removed by two successive acid pH treatments (2 min at pH 2.0) at 4°C as
previously described (11). Nonspecific binding, measured for each ligand
by adding a 100-fold excess of the same unlabeled ligand, was <5% and
was substracted. The efficiency of removal of cell surface-associated
ligands by acid pH washes was measured for each ligand and was >95%.
In all figures, the ratio of intracellular to total associated 125I-labeled
antibody is represented. All experiments were done with different clones
expressing the same construct. One representative experiment is shown.
Cell Surface Half-life Measurement
To measure the half-life at the cell surface of the different Immunofluorescence and Confocal Microscopy
Either stably transfected K562 cells, or HeLa cells grown on coverslips
and transfected 2 d before with the plasmid of interest, were used. The
cells were incubated for the indicated times at 37°C with 7G7B6 mAb, before being washed in PBS at 4°C and fixed in 3.7% paraformaldehyde and
0.03 M sucrose for 30 min at 4°C. Subsequent steps were performed at
room temperature. The cells were washed once in PBS, and after quenching for 10 min in 50 mM NH4Cl in PBS, the cells were washed once in PBS
supplemented with 1 mg/ml BSA. Cells were then incubated, when indicated, with OKT9 mAb in permeabilization buffer (PBS with 1 mg/ml
BSA and 0.05% saponin) for 20 min at 37°C. After two washes in the permeabilization buffer, the presence of antibodies was revealed by incubating the cells for 20 min at 37°C in permeabilization buffer containing labeled second antibodies. For 7G7B6 and OKT9, the second antibodies were Texas red-labeled anti-IgG2a (1/250) and FITC-labeled anti-IgG1 (1/
100), respectively. Washes, sample mounting, and confocal microscopy
were performed as described in reference 23.
No immunofluorescence staining was ever observed when second antibodies were used without the first antibody or with an irrelevant first antibody.
Metabolic Labeling
For pulse metabolic labeling with 35S-amino acids, 35 × 106 cells were
washed with PBS, then incubated for 1 h in DMEM lacking methionine
and cysteine and containing 2% dialyzed FCS. Cells were labeled for 2 h
in the same medium containing 200 µCi/ml 35S-amino acid mixture (Promix, Amersham, England), then washed in PBS. After 75 min incubation
at 37°C in complete medium, cells were harvested at 30-min intervals,
washed in PBS, pelleted by centrifugation, and kept frozen at Cell Iodination
YT cells (2 × 107) washed in PBS and resuspended in PBS, pH 7.3, 1 mM
Ca2+, 1 mM Mg2+, were surface labeled using the lactoperoxidase method
with 1 mCi Na125I (21). After iodination, the cells were washed two times
in culture medium and then kept in a 37°C incubator. After 30 min incubation, cells were harvested at 30-min intervals, washed in PBS, pelleted by
centrifugation and kept frozen at Immunoprecipitation and Gel Analysis
Cells were lysed for 30 min at 4°C in lysis buffer (1% NP-40, 150 mM NaCl,
10 mM Tris HCl, pH 8.0) complemented with 1 mM EDTA, 50 mM NaF,
1 mM NaVO4, 10 µg/ml leupeptin, 20 µg/ml aprotinin, and 2 mM PMSF.
Insoluble material was pelleted at 15,000 g for 30 min, and the supernatant
was then precleared for 60 min at 4°C with protein A Sepharose CL-4B
(Pharmacia, Sweden) before being immunoprecipitated overnight at 4°C
with relevant first antibodies, and protein A-Sepharose coupled with
anti-mouse antibody (Biosys, France). First antibodies were anti-IL2R Peptide Synthesis
The peptides were synthesized by the Merrifield solid-phase method (35)
using a 430 A synthesizer and a Pam (Boc, t-butoxycarbonyl; Pam, acetamidomethyl) resin (Applied Biosystems, Foster City, CA). The final purity (99.5%) of the peptides was checked by analytical reverse-phase
HPLC.
Circular Dichroism Experiments
Circular dichroism (CD) spectra of the wild-type peptide were recorded at
25°C on a Jobin Yvon CD6 dichrograph with a 0.2-mm path-length cell. The
peptide was first dissolved in water at pH 5.3. The solution was then diluted in trifluoroethanol (TFE)/water mixtures varying from 0 to 95% TFE
(V/V). Peptide concentration was 0.32 mg/ml (0.2 mM) as determined from
amino acid analysis.
Proton Nuclear Magnetic Resonance Experiments
The samples were prepared as 6 mM peptide solutions in water at pH 3.4 and 5.3 for BETApep and 5.3 for P20Lpep, respectively. The solutions
were then lyophilized and the samples solubilized in either 90%H2O/
10%D2O or in 25% and 40%TFE-d2/H2O.
All nuclear magnetic resonance (NMR) measurements were obtained
on a Varian Unity 500 spectrometer operating at a proton frequency of
500 MHz and interfaced to a Sun Sparc 1+ station. The sweep width was
5,000 Hz. Spectra in water were recorded at 0°C and 25°C, while spectra in
TFE:water mixtures were recorded at 25°C. Spectra in water are referenced to external trimethylsilyl-3-propionic acid-d4 2,2,3,3 sodium salt
(TMSP) and in TFE to the internal methylene resonance of the solvent at
3.88 ppm relative to tetramethylsilane (TMS). The OH resonance of water
or of TFE-d2 were suppressed by selective irradiation during the relaxation delay and, in the case of NOESY and ROESY spectra, during the
mixing time as well. All 2D-data were collected in the phase-sensitive
mode using the States-Haberkorn method (50). A total of 512 FIDs of 2K
complex data points were collected in t2 with 32 scans per increment and zero-filling was applied in both dimensions before Fourier transformation to form a matrix of 4K × 2K. These data were then processed with shifted
sine-bell window functions in both dimensions.
The phase-sensitive two-dimensional double-quantum-filtered correlated spectroscopy (DQF-COSY) (44) and total correlated spectroscopy
(clean-TOCSY) (16) with 80-ms mixing time were used for spin systems
assignment. Nuclear Overhauser two-dimensional experiments (NOESY)
(30) and rotating frame nuclear Overhauser two-dimensional experiments
(ROESY) (6) were recorded for sequential assignment and structure determination using several mixing times (100, 200, 300 ms) for the NOESY
and 400 ms for the ROESY.
3JNH-H The IL2R We have previously shown that the We studied the turnover of IL2R
The First 27 Cytosolic Amino Acids of the IL2R The IL2R
First, we measured the rate of endocytosis of
We also measured the half-life of The 27th Amino Acid of To further characterize the sequence responsible for
The Sorting Signal of A peptide encompassing amino acids 16 to 32 of
The presence of molecules in an ordered conformation
is confirmed by other NMR parameters, such as chemical
shift and temperature coefficients. Alpha protons displayed
slight upfield shifts throughout the sequence Pro18 to Ser25
with the exception of the Phe24 H To better define the structure, spectra were obtained in
a TFE/water mixture, a mixed solvent known to increase
the population of existing folded conformations (39). Indeed, the CD spectrum of BETApep in water displayed
weak negative ellipticities at 220 nm and 199 nm, together
with a stronger positive ellipticity at 193 nm, suggesting
that a small population of BETApep molecules are in a
helical conformation, in agreement with the NMR measurements. As the percentage of TFE increased, these spectra
exhibited characteristic features of an NMR spectra were obtained in 20% and 40% TFE/water solutions. Addition of TFE induced substantial shifts of
the proton resonances. In fragment 20 to 28, the peptide
H The various connectivities observed in the NOESY
spectra for the peptide in water and in the TFE/water mixture are presented in Fig. 5. The NHi-NHi+1 interactions
and the large number of medium range NOEs seen in segment Pro20 to Ser29 show that these residues are part of a
stable Disruption in the Turn at the Beginning of the Sorting
Signal Does Not Affect Receptor Trafficking
In aqueous solution at pH 5.4 two structural elements, a
type I A mutation replacing Pro20 by Leu was introduced in
the Amino Acids 18-27 of If this nascent helix is responsible for the sorting of We prepared chimeric receptors using the
The Transferrin and its receptor recycle very efficiently to the
plasma membrane after endocytosis and are widely used
as markers of early/recycling endosomes. If We had previously shown that 7G7B6 mAb was a suitable marker for following the endocytosis of
The Sorting Signal of the In most of the cases previously described, sequences necessary to orient proteins towards lysosomes are very similar to internalization signals and function as such. We
therefore determined if this is also the case for the 18-27
We measured the half-lives of To show that this half-life of
The high-affinity IL2 receptor is continuously internalized,
and after receptor endocytosis, the A peptide, named BETApep, including the sorting signal and corresponding to amino acids 16-32 of the To assess the potential role of the helix distortion at the
NH2-terminal extremity due to Pro20, we also studied the
structure of a synthetic peptide identical to the previous
one, except that Pro20 had been replaced by a leucine, a
helix favoring residue (42). In aqueous solution at pH 5.4, this peptide, P20Lpep, exhibited NOE characteristics of a
nascent helix from Leu20 to Ser28, stabilized in the presence of TFE. A schematic view of this amphipathic
Most of the signals which sort membrane glycoproteins
at different steps of their traffic along the endocytic pathway
fall into two categories, the tyrosine-containing and dileucine-containing signals. The targeting sequences found
in lysosomal glycoproteins belong to these two categories
(20, 24, 33, 43, 59). It is also the case for proteins which are
targeted to late endocytic compartments such as the CD3 Tyrosine and di-leucine based motifs have first been described as internalization signals. Since then, they have
been found to function at other sorting steps, in addition
to their capacity to promote endocytosis (2, 26, 29, 41).
The signal we describe here specifically functions as a signal of sorting towards degradation compartments: although it induced the degradation of the In this study, we have found that the half-life of the wildtype Under physiological conditions, Over the years, the term "receptor-mediated endocytosis" has become synonymous with internalization via
clathrin-coated pits. However, other receptor-mediated
endocytosis pathways have also been reported (reviewed
in reference 28). When clathrin-coated pit endocytosis is
inhibited, IL2 receptors are still internalized (51). When
this classical pathway functions, the proportion of IL2 receptors entering via either pathway is not known. Even if a
significant proportion of IL2 receptors entered cells by a
clathrin-independent mechanism, since both pathways
seem to rejoin in early endosomes (19), where sorting
probably occurs (34), one would expect the signal to function regardless of the entry pathway used. The sorting signal of the The way sorting towards degradation compartments occurs is not known. In some cases, aggregation of recycling
receptors has been shown to drive them out of the recycling pathway and towards lysosomes. We do not know
if the sorting signal we describe in this paper can cause
aggregation. However this seems unlikely, since point mutations in the signal disrupt its function and the resulting
receptors have an increased half-life (manuscript in preparation). Alternatively, the degradation signal might be recognized by a component of a cytoplasmic coat, such as
COP proteins, which seem to be involved in endosome
function (3, 57).
It is striking that sorting motifs which function at different sites in cells and which target membrane glycoproteins
to various organelles share common features in their sequence or in their structure. Although the nature of the
specific molecules that are able to recognize these motifs is
not known, the similarity of the signals suggest that the
machineries that decipher them at different cell sites may
also be related. Further studies will be needed to understand how these various signals function to specifically target receptors to different organelles.
10
100 pM) consist of three distinct components, the
,
, and
chains, that are associated in a noncovalent manner (36).
Both the
and
chains, but not the
chain, belong to the
cytokine receptor superfamily (5). This hematopoietic
cytokine receptor family includes receptors such as the
IL3, IL4, IL5, IL6, IL7, IL9, and IL15 receptors, the erythropoietin receptor, the granulocyte colony-stimulating factor receptor, the granulocyte-macrophage colony-stimulating factor receptor, and the leukemia inhibitory factor
receptor. This family also includes receptor proteins for factors that are believed to function normally outside the
immune and hematopoietic system, i.e., growth hormone,
prolactin, and ciliary neurotrophic factor. Many receptor
subfamily members share at least one component: thus,
the receptors for IL2, 4, 7, 9, and 15 have a common
chain, and the receptors for IL2 and IL15 share the
chain
(reviewed in reference 52). Patients suffering from
X-linked severe combined immunodeficiency have mutations in the gene encoding the IL2 receptor
chain (9, 10,
40).
, recycles to the
plasma membrane, while the others,
and
, are routed to
late endocytic compartments (23).
chain is internalized and not recycled when expressed
without the
or
chain (22). In this paper, we show that
the 27 amino acids adjacent to the membrane in the cytosolic tail of the
chain are sufficient for its endocytosis
and degradation. In this sequence, a 10-amino acid peptide encodes a signal for sorting towards degradation compartments.
Materials and Methods
chain of the IL2 receptor and the transferrin receptor, respectively, were obtained from the Amer. Tissue Culture Collection
(Rockville, MD) (48, 53). Monoclonal antibodies 341 and 561 were kind
gifts from Dr. R. Robb (Dupont Merck Pharmaceutical Co., Wilmington,
DE) (56). FITC-conjugated anti-murine IgG1 antibodies and Texas red-
conjugated anti-murine IgG2a antibodies were obtained from Southern
Biotechnology (Birmingham, AL).
, coding for the
IL2R
chain was kindly provided by Dr. T. Kono (Osaka University, Japan) (37). The truncated forms of
n were generated by PCR by insertion
of a stop codon after the nth amino acid of the cytosolic part of the protein
(assuming that Asparagine is the first cytosolic amino acid), and were
cloned into the Not1/Sac1 sites of NT by standard techniques.
cDNA in the pCDM8 vector. In this plasmid,
the 3
side of the sequence is modified to create a HindIII/XbaI cloning
cassette (ACAATCTAG to ACAATCCAAGCTTCCTCCTGAGTAGCGTCTAGA). This modification adds four amino acids (QASS) to the
wild-type IL2R
chain, but its cellular behavior is not modified, and therefore we will refer to this protein as "
."
. In this T-XOY construct, the 3
side of the sequence AAGAGTAGAAGAACAATCCAAGCTTCCTCCTGA was modified to
AAGAGTGAACCATTGTCATATACCCGGTTCCAAGCTTCC T CC - TGA by PCR. The COOH terminus of the T-XOY protein is KSEPLSYTRFQASS, instead of KSRRTIQASS for T-XO.
nm and T-XOY
nm constructs were subcloned in the Not1/
Sac1 cloning sites of NT. The corresponding constructs were named 
nm
and
Y
nm, and were used for stable transfections in K562 cells.
(7G7B6) or anti-
(341) antibodies. The expression levels of recombinant proteins in all clones tested were the same or less than their
normal level in activated lymphocytes.
n, 
nm or
Y
nm constructs, cells were incubated with cycloheximide to prevent the
synthesis of new receptors. After different times of incubation at 37°C in
culture medium with 50 µM cycloheximide, the cells were cooled to 4°C,
and cell surface expression of the constructs was assayed by flow cytometry as described (21). Time zero on the graph corresponds to a 30-min incubation in cycloheximide, which is the time required for a newly synthesized IL2 receptor to reach the cell surface (11). All experiments were
done in triplicate with different clones expressing the same construct. One
representative experiment is shown.
20°C before analysis by immunoprecipitation.
20°C before analysis by immunoprecipitation.
mAb 341 and 561 for the measurement of
half-life after metabolic labeling, and anti-IL2R
mAb 7G7B6 and anti-transferrin receptor mAb
OKT9 for the measurement of 
18-27 half-life after iodination. The
Sepharose beads were then washed three times in 1% NP-40, 0.5 M NaCl,
10 mM Tris HCl, pH 8.0, and once in 10 mM Tris HCl, pH 8.0. Bound proteins were eluted into electrophoresis sample buffer (60 mM Tris HCl, pH
6.8, 2% SDS, 10% glycerol, 5%
-mercaptoethanol) before analysis by
SDS-PAGE. Gels were dried and radioactivity in the gel bands was quantitated using a phosphorimager and ImageQuaNT software (Molecular
Dynamics, Inc., Sunnyvale, CA). Gels were subsequently exposed to Hyperfilm-MP (Amersham, England) at
80°C.
coupling constants were measured from one dimensional
spectra recorded with a digital resolution of 0.15 Hz/point at 0°C and 25°C.
Results
Chain Is Degraded after Endocytosis
chain of IL2 receptor
is internalized and has a half-life at the cell surface of ~110 min, in the absence of IL2, in three different lymphocytic
cell lines (YT, IARC 301.5, CIAC) (22). At steady state,
the total number of cell surface receptors results from the
balance between receptor biosynthesis and endocytosis.
After endocytosis, most membrane molecules are recycled
back to the cell surface or degraded. The level of expression at the cell surface of a protein that is entirely recycled
after internalization remains the same, even when protein
synthesis is inhibited. On the other hand, the level of expression at the cell surface of a protein that is not recycled after internalization decreases with time when protein synthesis is inhibited. Therefore, the short half-life of IL2R
shows that it is not recycled after endocytosis. Its localization in late endocytic compartments suggests that it is degraded (23).
in the YT cell line,
which has been extensively used to study IL2 receptors.
The rate of turnover of IL2R
was measured in these cells
by pulse-chase metabolic labeling and immunoprecipitation. Cells were labeled with 35S-amino acids and incubated in chase medium at 37°C for different times as described in the Materials and Methods section. After a 75-min
incubation to allow export to the plasma membrane, cells were harvested at 30-min intervals. Proteins were quantitatively immunoprecipitated from cell lysates, the precipitates resolved on SDS-polyacrylamide gels, and the
radioactivity in the IL2R
band quantitated by phosphorimager analysis. An autoradiograph of a typical experiment is shown in Fig. 1. Analysis of the turnover of IL2R
showed that it was degraded with a half-life of 2 h. Immunoprecipitation of the transferrin receptor in these experiments showed that it was stable, as expected for this recycling receptor (not shown). The half-life of IL2R
measured here is the same as its half-life on the cell surface previously measured by flow cytometry (22). Therefore the loss of
chain from the cell surface can be
equated with degradation. Since measuring the loss of receptors from the cell surface is a very sensitive, simple, and
quantitative method, it was used to probe for receptor
turnover in subsequent studies.
Fig. 1.
Turnover of IL2R
in YT cells. YT cells were pulse labeled with 35S-amino acids for 2 h, and then washed and incubated in chase medium. Cells were harvested beginning 75 min
after the end of the pulse (t = 0), then at the indicated intervals.
IL2R
was immunoprecipitated from detergent lysates of the
cells and separated by SDS-PAGE (inset). Radioactivity in the
bands was quantitated by phosphorimager analysis. The values in
the graph represent the percentage of IL2R
detected in the gel
at different chase times relative to that at time zero.
[View Larger Version of this Image (21K GIF file)]
Chain Are Sufficient for Its Endocytosis and for Its
Short Half-Life on the Cell Surface
chain is a type I transmembrane protein, with
286 amino acids in its cytosolic part. We had previously
shown that the
chain by itself, in the absence of the
and
chains of the high-affinity IL2 receptor, is internalized and has a short half-life on the cell surface (22). To
understand the molecular basis for the degradation of this
protein, we constructed a truncated form of
, with only
the 27 amino acids adjacent to the membrane of the cytosolic region (Fig. 2). This
27 construct was transfected in
K562 cells, and its behavior was analyzed in several stably transfected clones.
Fig. 2.
Schematic representation of the constructs used in this
work. In all constructs, n and m designate amino acids at position n and m, respectively, after the transmembrane domain of
,
assuming that Asp is the first cytosolic amino acid. The first 27 cytosolic amino acids of
starting from the membrane are the following: NCRNTGPWLKKVLKCNTPDPSKFFSQL. Amino acids 18-27 are underlined. TM, transmembrane domain; TfR,
transferrin receptor.
[View Larger Version of this Image (29K GIF file)]
27 and
wt
using radiolabeled anti-
mAb 561 (Fig. 3 a). We had previously shown that this antibody does not modify the kinetics of entry and degradation of the IL2 receptor (51).
Both forms of the protein were internalized efficiently and
27 was even internalized faster than
wt. This difference
may be due to the presence of negative signals for endocytosis in the
wt chain, as has already been described in
other receptors (25). It is also possible that an internalization signal is better presented in the 27-amino acid tail
than in the wild-type form of
. We concluded that the first 27 amino acids of
are sufficient to promote endocytosis.
Fig. 3.
Endocytosis and
cell surface half-life of
27
and
wt in K562 cells. (a) Kinetics of 125I-labeled mAb
561 internalization in cells
stably transfected with
wt
(
) or
27 (
). The antibody
was added to the cells at 37°C. After further incubation for the indicated times,
cells were cooled to 4°C and
washed, and the amount of
internalized antibody was
measured. (b) Half-life of
wt
(
) and
27 (
). Cell surface
expression of
on cells
treated for different times
with 50 µM of cycloheximide was assessed by flow cytometry using mAb 341. Times indicated are after a 30-min preincubation in cycloheximide. In each case,
one representative experiment out of three is shown. Error bars indicate standard deviations for averages of three or more experiments.
[View Larger Version of this Image (14K GIF file)]
27 at the cell surface.
Stably transfected
27 or
wt cells were incubated with the
protein synthesis inhibitor cycloheximide for various times.
The surface expression of the chain was then probed with
anti-IL2R
mAb by flow cytometry, as described (23).
The half-lives of both forms of
were the same, ~150 min
(Fig. 3 b). This represents a short half-life for a membrane
receptor, and suggests that these proteins are degraded after endocytosis.
Is Necessary for its
Short Half-Life on the Cell Surface, but Not for
Its Endocytosis
27
degradation, we constructed other truncated forms of
,
with 18, 24, or 26 cytosolic amino acids (
18,
24, or
26, respectively). When protein synthesis was inhibited in stably
transfected K562 cells, all these mutants were still expressed very stably at the cell surface (Fig. 4 b). This was
not due to a defect in internalization, as all forms were internalized (Fig. 4 a). Internalization of
26 for example, is
slower than that of
27, but is still very efficient, about as
fast as that of
wt. Such a long half-life, associated with
rapid constitutive internalization, indicates that the proteins are very efficiently recycled to the plasma membrane
after internalization. Thus, all forms of
with a cytosolic tail shorter than 27 amino acids are recycled to the plasma
membrane. The deletion of Leu27 had a dramatic effect on
the half-life, while it had only a small effect on endocytosis
of the protein. Larger truncations, to Pro18, also led to a
progressive loss of endocytosis (Fig. 4 a). This region of
therefore seems to be important for its endocytosis and intracellular sorting, and we decided to analyze its potential
structure.
Fig. 4.
Endocytosis and cell surface
half-life of truncated forms of
in
K562 cells. (a) Kinetics of 125I-labeled
mAb 561 internalization in cells stably
transfected with different truncated
forms of
, as indicated. (b) Half-life of
these proteins. Experiments were performed as described in Fig 3. In each
case, one representative experiment
out of three is shown. Error bars indicate standard deviations for averages of three or more experiments.
[View Larger Version of this Image (17K GIF file)]
27 Adopts a Turn-Helix Structure
was
synthesized and will be called BETApep. NMR analysis of
this peptide in solution in water at pH 5.3 and 3.4 was
performed. At the two pH values, the presence of NHiNHi+1,
CHi-NHi+2, and
CHi-NHi+3 dipolar connectivities indicates turn-like structures in the 20-27 fragment
(Fig. 5). The Pro20H
-Lys22NH and the Pro20H
-Ser21NH NOE connectivities as well as the fact that the trans conformation was the major one for both prolines, suggest
that the Asp19-Lys22 fragment forms a type I or type I
turn (13). The small value observed for the Ser21 3JNH-H
would be in favor of a type I
turn rather than a type I
turn
(Fig. 5 b). The possibility that a secondary structure might
arise through aggregation was ruled out by running a 10fold diluted sample: identical chemical shifts were observed.
Fig. 5.
NMR analysis of BETApep and P20Lpep. (Top) Sections of a two-dimensional NOESY spectrum at 25°C of BETApep in
40% TFE (a) and of P20Lpep in 25% TFE (d). Sequential amide NH-NH NOE are indicated by residue number (left part of a and d).
Cross-peaks arising from medium range NOE NH-H
(i, i + 2) and (i, i + 3) are indicated by an arrow and residue numbers (right part
of a and d). (Middle) Summary of 1H-1H NOE connectivities for BETApep (b) and P20Lpep (e) in 40% and 25% TFE, respectively.
The intensity of NOE cross-peaks is indicated by the thickness of the lines, and correlations close to the diagonal and ambiguous crosspeaks resulting from overlapping are indicated by an asterisk or a dashed line (c). Coupling constants are labeled as follows:
3JNH-H
> 6Hz,
3JNH-H
6Hz. (Bottom) Changes in the chemical shifts (
) of the CH
protons of BETApep (c) or P20Lpep (f) in water or
upon addition of TFE. H
induced chemical shifts are given in water as compared to random coil values, and in TFE as compared to values observed in water.
[View Larger Version of this Image (38K GIF file)]
proton, probably due
to a Phe23 ring current effect (Fig. 5 c). The chemical shifts of
all amide protons varied linearly with the temperature between 0°C and 40°C, implying no conformational changes.
The temperature coefficients (
/
T) obtained in aqueous solution vary between 4 and 8 × 10
3 ppm/°C. The lowest
value was observed for Glu30 (4 × 10
3 ppm/°C), while intermediate values (4.8 to 6 × 10
3 ppm/°C) were obtained
for the amide protons of fragment Ser21 to Gln26, indicative of a partial shielding of these protons from the solvent, probably through the formation of a hydrogen bond. Finally, these NMR studies in water strongly suggest that,
at 25°C, BETApep adopts a turn between residues Asp19
and Lys22 and a nascent helix from Phe23 to Leu27.
-helical structure.
resonances shifted upfield as compared to their position in water (Fig. 5 c). The induced shifts of H
protons
show that, in TFE/water solution, residues 20 to 28 form
an
helix (60).
-helical structure. In conclusion, in the presence of
TFE, residues 19 to 29 of BETApep form an
helix.
turn for fragment Asp19 to Lys22 and a nascent
helix for fragment Phe23 to Leu27 were observed for the
peptide. To elucidate the relative importance of these two
structural elements in the biological function, a peptide
called P20Lpep was synthetized, in which Pro20 was replaced by a leucine to remove the turn. The structural
analysis was done in the same conditions with P20Lpep as
with BETApep, and similar results were obtained, except
that the turn characterized in BETApep was absent from
P20Lpep. In water, a nascent helix was observed throughout fragment Leu20 to Ser28. This helix was stabilized in the
presence of TFE (Fig. 5, d, e, and f).
27 construct and the behavior of this mutant was analyzed after transfection in K562 cells. The kinetics of endocytosis and the half-life on the cell surface of this mutant were the same as those of
27 (not shown). Therefore,
disruption of the
turn does not modify the sorting of
27.
Divert from Recycling a
Receptor Internalized Via Clathrin-coated Pits
27,
and if it can act more or less independently of its location in the protein, then it might act as a sorting signal that
could be transferred into another internalized membrane
protein and remain active. The best characterized mechanism for gaining entry into the cell is the clathrin-coated
vesicle one (reviewed in reference 45). Membrane receptors which carry an internalization signal in their cytosolic
domain are concentrated in the clathrin-coated regions of
the membrane. Eventually, clathrin-coated pits invaginate until a closed clathrin-coated vesicle is formed. This mechanism of internalization is very efficient and is used by
many membrane proteins, such as the transferrin receptor.
The internalization signal of the transferrin receptor has
been well characterized. It consists of four amino acids,
YTRF, which promote the internalization of the receptor
independently of their location in the cytosolic tail, provided that at least 7 residues separate the tetrapeptide from the transmembrane region (8, 27).
chain of the
IL2 receptor. This
chain recycles to the plasma membrane when internalized as part of high-affinity IL2 receptors (23). It has been used previously to prepare other
chimeric membrane proteins, because good antibodies
against its extracellular domain are available (29). When
the
chain is expressed alone, without
and
, it is internalized inefficiently. We therefore designed a construct,
Y, in which the transferrin receptor coated-pit internalization signal was inserted in the cytosolic part of
. In
Y,
the EPLSYTRF sequence from the transferrin receptor
was inserted at the COOH terminus of
(Fig. 2). HeLa
cells were transfected with
or
Y constructs, and 2 d after
transfection, the cells were processed for immunofluorescence using anti-
mAb. Staining of
-transfected cells
showed mostly a strong surface labeling, while in
Y-transfected cells,
Y was found in intracellular compartments
(Fig. 6 a). We measured the internalization of
Y using radiolabeled anti-
mAb 7G7B6. We had previously shown
that 7G7B6 mAb does not modify the kinetics of entry and
degradation of the IL2 receptor (51). The endocytosis of
Y in stably transfected K562 cells was very efficient (Fig.
6 b). We next inserted in this construct the putative sorting
signal by adding amino acids 17 to 27 or 18 to 27 of
to the
COOH-terminal extremity of
Y. The chimeras were named
Y
17-27 and
Y
18-27, respectively (Fig. 2). These chimeras
were also rapidly internalized with the same kinetics as
Y
(Fig. 7 a). When protein synthesis was inhibited,
Y expression was stable, indicating that after internalization,
Y is efficiently recycled to the plasma membrane, as is the
case for the transferrin receptor. Conversely, the chimeras
containing the putative sorting signal,
Y
17-27 and
Y
18-27,
had a half-life of ~200 min (Fig. 7 b). This indicates that
these chimeras were degraded after internalization via the
clathrin-coated pits.
Fig. 6.
Internalization of
7G7B6 antibody in cells
transfected with
or
Y. (a)
HeLa cells transiently transfected with
(A) or
Y (B)
were incubated for 30 min
with 7G7B6 mAb. After fixation and permeabilization,
the antibody was revealed
using Texas red-labeled antimurine IgG2a antibody.
Magnification: 630. (b) Kinetics of 125I-labeled 7G7B6
mAb internalization in K562
cells stably transfected with
(
) or
Y (
). The antibody
was added to the cells at
37°C. After further incubation for the indicated times,
cells were cooled to 4°C, and
the amount of internalized
antibody was measured. One
representative experiment
out of three is shown. Error
bars indicate standard deviations for averages of three or
more experiments.
[View Larger Versions of these Images (22 + 43K GIF file)]
Fig. 7.
Endocytosis and cell surface
half-life of
,
Y
17-27 and
Y
18-27 in
K562 cells. (a) Kinetics of 125I-labeled
7G7B6 mAb internalization in cells
stably transfected with
Y,
Y
17-27 or
Y
18-27. Experiments were performed as described in Fig. 6 b. (b) Half-life of
these chimeras. Cell surface expression
of
on cells treated for different times
with 50 µM of cycloheximide was assessed by flow cytometry using 7G7B6 mAb. Times indicated are after a 30min preincubation in cycloheximide. In each case, one representative experiment out of three is shown. Error
bars indicate standard deviations for
averages of three or more experiments.
[View Larger Version of this Image (14K GIF file)]
Y
18-27 Chimera Is Found in Transferrin
Negative Compartments
Y is in fact internalized and recycles as the transferrin receptor, both receptors should be localized in the same intracellular compartments; whereas if the
Y
nm chimeras are sorted to a
degradation pathway, they should not colocalize entirely
with the transferrin receptor.
, as it accompanies
along its recycling pathway (23). To study the
intracellular distribution of
Y or
Y
18-27 after endocytosis, cells stably transfected with these chimeras were incubated for 120 min at 37°C with 7G7B6 mAb before fixation and permeabilization. Early/recycling endosomal compartments were then labeled using anti-transferrin receptor mAb OKT9. Subclass-specific antibodies were chosen to reveal each marker. In
Y and
Y
18-27 transfected
cells, there was strong intracellular labeling with both antibodies. Most of the compartments were double-labeled, as
expected because the transferrin receptor and the
Y or
Y
18-27 constructs have a clathrin-coated pit internalization signal and are found in the same endosomal compartments. In
Y-transfected cells, almost every compartment labeled with 7G7B6 was also labeled with anti-transferrin
receptor mAb (Fig. 8 c). On the other hand, in
Y
18-27
transfected cells, we could detect a significant number of
7G7B6 positive compartments that were negative for
transferrin receptor labeling (Fig. 8 f). Therefore, when
the 18-27 sequence is added to the cytosolic tail of a recycling receptor, the resulting chimera can exit from early/
recycling endosomes.
Fig. 8.
Localization after endocytosis of
Y or
Y
18-27 relative to transferrin receptor.
K562 cells stably transfected
with
Y (top) or
Y
18-27 (bottom) were incubated at 37°C for 2 h with anti-
mAb 7G7B6.
The cells were then washed at
4°C to stop endocytosis, fixed,
permeabilized and incubated
with anti-transferrin receptor
mAb OKT9. Anti-
and antitransferrin receptor mAb were then revealed with Texas red-
labeled anti-mouse IgG2a and
FITC labeled anti-mouse IgG1,
respectively. One representative medial optical section is represented. (a and d)
staining; (b
and e) transferrin receptor staining; and (c and f) combinations
of the two stainings.
[View Larger Version of this Image (11K GIF file)]
Chain Does Not Function as
a Transferable Internalization Signal
chain sequence. The
chain of the IL2 receptor, without
and
, is internalized very inefficiently when transfected in
K562 cells. However, this internalization is measurable
(Fig. 9 a). We constructed a chimera between the IL2R
chain and amino acids 18-27 from the cytosolic part of the
chain, named 
18-27 (Fig. 2). We measured the internalization of the chimera using radiolabeled anti-
mAb
7G7B6. Internalization of the chimera 
18-27 was slow
and inefficient, identical to that of
, with only 10% of the
molecules being internalized at steady state (Fig. 9 a). This
result was surprising because amino acids 18-27 contain
part of the information for the endocytosis of
27, as
27 is
internalized faster than
18 (Fig. 3 a). One could therefore
expect that amino acids 18-27 of
may contribute a positive signal for the internalization of
in the 
18-27 chimera. As this does not appear to be the case, it seems that the internalization of
27 requires other parts of the protein.
Fig. 9.
Endocytosis and
cell surface half-life of
and

18-27 in K562 cells. (a) Kinetics of 125I-labeled 7G7B6
mAb internalization in cells
stably transfected with
(
)
or 
18-27 (
). (b) Half-life
of these chimeras. Experiments were performed as described in Fig 7. In each case, one representative experiment out of three is shown.
Error bars indicate standard
deviations for averages of
three or more experiments.
[View Larger Version of this Image (13K GIF file)]
and 
18-27 at the cell
surface, as described above, in stably transfected K562
cells. Their surface expression was probed with anti-
mAb 7G7B6. As seen in Fig. 9 b, the
chain has a very
long half-life, while the half-life of 
18-27 was ~300 min.

18-27 was due to degradation, the rate of turn over of 
18-27 was measured in these
cells by a pulse-chase experiment. Cells were iodinated and incubated in chase medium at 37°C for different times
as described in the Materials and Methods section. Proteins were quantitatively immunoprecipitated from cell lysates using antibodies against the IL2R
chain and the
transferrin receptor, the precipitates resolved on SDSpolyacrylamide gels, and the radioactivity in the band corresponding to the 
18-27 chimera or to the transferrin receptor was quantitated by phosphorimager analysis (Fig.
10). The transferrin receptor was stable over the 2 h of
chase, while the intensity of the band corresponding to the

18-27 chimera decreased with a half-life of ~300 min.
This value is the same as that measured for the half-life of

18-27 on the cell surface (Fig. 9) and represents a 3-5fold increase in the rate of turnover of 
18-27 compared to
. In conclusion, the transfer of amino acids 18-27 from
to the
chain induces degradation of this membrane protein but does not promote its endocytosis.
Fig. 10.
Turnover of 
18-27 in K562 cells. The cells were iodinated, washed, and incubated in chase medium. At the indicated times, cells were harvested and lysed. 
18-27 chimera (mol wt
~55 kD) and transferrin receptor (mol wt ~90 kD) were immunoprecipitated from the lysates with 7G7B6 anti-IL2R
and
OKT9 anti-transferrin receptor mAb, and separated by SDSPAGE (inset). Radioactivity in the bands was quantitated by
phosphorimager analysis. The ratio of 
18-27 chimera to transferrin receptor was calculated at each time point. The values in the
graph represent the percentage of this ratio at different times relative to that at time zero.
[View Larger Version of this Image (26K GIF file)]
Discussion
chain is found in late endocytic compartments (23). Here we show by a pulse
chase experiment that it is degraded. Most growth factor
and cytokine receptors are degraded after internalization,
which is important for the regulation of their expression
and function, but the mechanism for their sorting towards
degradation is not understood. Based on the hypothesis
that short sequences act as tags for intracellular routing of
receptors, we looked for a signal in the cytosolic tail of the
chain that would direct it towards degradation compartments. We observed that the 27 amino acids adjacent to
the membrane of the cytosolic tail were sufficient for this
function. We prepared a modified IL2 receptor
chain by
adding to its cytosolic tail an efficient coated-pit internalization signal, the transferrin receptor signal YTRF. This
construct
Y was rapidly internalized and recycled. By
confocal microscopy, it was colocalized with the transferrin receptor which labels early/recycling endocytic compartments. Conversly,
Y
18-27, a chimera containing, in
addition to YTRF, amino acids 18-27 of the
chain, was
internalized with the same kinetics as
Y, but its half-life
was shortened to ~3 h. This represents a 4-6-fold increase
in the rate of turnover of
Y
18-27 compared to
Y. By confocal microscopy,
Y
18-27 was not always colocalized with
the transferrin receptor, indicating that it was sorted from
the recycling pathway. Therefore the P18DPSKFFSQL27 sequence of the cytosolic tail of
is sufficient to provide a determinant to divert a normally rapidly internalized recycling receptor from recycling compartments. Since we
have shown that the
chain as well as the 
18-27 construct
are degraded, it is most likely that this signal targets proteins towards late endocytic compartments where they are
degraded.
chain,
was synthesized and its structure was studied by CD and
NMR. This peptide formed a nascent helix involving Phe23
to Leu27, preceded by a type I
turn formed by amino acids Asp19 to Lys22. It is noteworthy that this
helix is amphipathic with hydrophobic residues Phe23, Phe24, and
Leu27 on one side, and hydrophilic residues Lys22, Ser25,
and Gln26 on the other side. Strikingly, the fragment that is
highly structured in the peptide containing amino acids
16-32 of
corresponds to the sorting signal defined in this
work by its biological properties, i.e., amino acids 18-27.
However, it cannot be ruled out that NMR data might not
reflect the structural requirements in vivo. Additional experiments are needed to illustrate the structure-function
relationship in this signal.
helix
is presented in Fig. 11. In parallel with this NMR analysis,
we have studied the routing after endocytosis of a mutated
27 receptor in which Pro20 had been replaced by a leucine.
This receptor was internalized with the same kinetics as
27 and its half-life was identical to that of
27. Therefore when Pro20 is replaced by a leucine, receptor routing is not
affected. The corresponding structure is
-helical, having
lost the NH2-terminal kink due to the proline in the wildtype sequence. These results indicate that the kink is not
important for the signal. It is interesting to compare this
signal with the internalization signal of the invariant chain:
both have the same kind of structure, but in the latter case,
the kink of the invariant chain seems to be required for internalization (38). Other regular structures have already
been reported for signals involved in the endocytic pathway, for coated pit localization of a few receptors (4, 14,
38, 58), targeting to synaptic vesicles of VAMP (17), and
ER retention of CD3-
(31). The known structures fall
into two categories, those which form a tight
-turn (4, 14)
and those which form an
helix (17, 38, 58). This
helix is often preceded or followed by a turn (17, 31, 38, 58). Here
we show that the turn at the beginning of the
helix can be removed without altering the signal function.
Fig. 11.
Helical wheel representation of amino acids 20 to 27 of P20Lpep. Hydrophobic amino acids are boxed.
[View Larger Version of this Image (16K GIF file)]
and CD3
chains of the T cell surface antigen receptor
complex (29), the invariant chain (41), CD4 in Nef expressing cells (2), a CD8/gp75 chimera in fibroblasts (55),
and the
chain of HLA-DM (32). The sorting signal that we found in the IL2R
chain is not related to the tyrosine
or di-leucine based motives. It also shares no clear sequence homology with other receptors that are degraded
after endocytosis.
chain when
added to its cytosolic tail, it did not enhance its low internalization rate.
chain at the cell surface of K562 cells is 150 min.
This value is similar to that of P-selectin, between 75 and
150 min, and faster than that of lysosomal acid phosphatase, ~3-4 h, or of the
chain of HLA-DM in HeLa
cells, ~3 h (7, 15, 32). The half-life of
27 is the same as
that of the whole
chain, while its internalization is about
three times faster. This observation is in agreement with a
recent study showing that there was no simple correlation
between the internalization and degradation rates (61).
Also, there may be another sequence, further downstream in the
chain, that is also involved in degradation.
is not expressed by itself: in lymphocytes or natural killer cells, the
chain is
also present. When the ligand is present, these two chains
associate to bind the ligand and the trimolecular complex
thus formed is internalized. The half-life of
, in the absence of IL2, is about twice as long as when the ligand is
present (22 and our unpublished results). This cannot be
attributed simply to differences in internalization rates,
since these rates are similar (Subtil, A., unpublished results). Thus, in the absence of ligand, the
chain is sorted to degradation compartments less efficiently than when
the ligand is present. In the latter case,
and
associate
and the receptors become phosphorylated. The sorting signal described here, or other potential signals in the rest of
the chain, might function more efficiently in the presence
of ligand when
and
are associated and phosphorylated.
Alternatively, the
chain may also have a degradation signal which might account for the more efficient sorting. The
and
chains, in combination with other chains of the
cytokine receptor family, can constitute different cytokine receptors which can be expressed simultaneously on the
same cells. The expression of each of the chains on the cell
surface may be rapidly modulated by the efficiency of its
degradation after endocytosis, which allows for subtle control of receptor expression and function.
chain was functional in a chimera having the
transferrin receptor coated-pit localization signal,
Y
18-27.
Therefore this signal directs receptors towards degradation
compartments when they are internalized via coated-pits.
Received for publication 29 April 1996 and in revised form 25 November 1996.
We greatly appreciate the help of Dr. Agnès Hémar at the beginning of this work. We are grateful to Dr. H. Gahery for helping with initial
constructs, to E. Gilard for helping with NMR analyses, to Drs. C. Bonnerot,
P. Cosson, and T. Kono for providing plasmids NT, T-XO and pdKCR
,
respectively, and to Dr. R. Robb for the gift of antibodies 341 and 561. We
are grateful to Drs. Anne Lecroisey, Sebastian Amigorena, Emmanuel
Morelon, and David Ojcius for critical reading of the manuscript.
This work was supported by the Ligue nationale contre le Cancer, comité de Paris, and by a grant BIO2-CT92-0164 from the European Commission.
CD, circular dichroism; IL2, interleukin 2; NOE, nuclear Overhauser effect; NOESY, two-dimensional NOE spectroscopy; NMR, nuclear magnetic resonance; ROESY, rotating frame NOE; TFE, trifluoroethanol; TOCSY, total correlation spectroscopy.
COP is involved in the pH-dependent formation of transport vesicles
destined for late endosomes.
J. Cell Biol.
133:
29-41
chain mutations in SCIDX1 result in the loss of
high-affinity IL-2 receptor binding.
Eur. J. Immunol.
24:
475-479
[Medline].
chain in an
atypical X chromosome-linked severe combined immunodeficiency with
peripheral T cells.
Proc. Natl. Acad. Sci. USA.
91:
9466-9470