|
||
Centre National de la Recherche Scientifique (CNRS) UMR144, Institut Curie, 75231 Paris Cedex 05, France
To follow the dynamics of nuclear pore distribution in living yeast cells, we have generated fusion
proteins between the green fluorescent protein (GFP)
and the yeast nucleoporins Nup49p and Nup133p. In
nup133
dividing cells that display a constitutive nuclear pore clustering, in vivo analysis of GFP-Nup49p
localization revealed changes in the distribution of nuclear pore complex (NPC) clusters. Furthermore, upon
induction of Nup133p expression in a GAL-nup133
strain, a progressive fragmentation of the NPC aggregates was observed that in turn led to a wild-type nuclear pore distribution. To try to uncouple Nup133p-
induced NPC redistribution from successive nuclear divisions and nuclear pore biogenesis, we devised an assay based on the formation of heterokaryons between
nup133
mutants and cells either expressing or overexpressing Nup133p. Under these conditions, the use of
GFP-Nup133p and GFP-Nup49p fusion proteins revealed that Nup133p can be rapidly targeted to the
clustered nuclear pores, where its amino-terminal domain is required to promote the redistribution of preexisting NPCs.
Bidirectional exchange of molecules between the
cytoplasm and the nucleus in eukaryotic cells is accomplished through nuclear pore complexes
(NPCs)1 (Forbes, 1992 Several approaches, including immunological screens,
genetic screens, and improved purification procedures of
NPCs, have led to the identification of ~20 nuclear pore
proteins (called nucleoporins) from amongst the 50-100
nucleoporins that are believed to exist in Saccharomyces
cerevisiae (for reviews see Rout and Wente, 1994 Spatial heterogeneity in NPC distribution, including extreme situations consisting of large NPC-devoid regions of
the nuclear envelope together with densely packed NPC
clusters, have been described since the late 60s (for review
see Franke and Scheer, 1974 So far, two mechanisms that may induce changes in nuclear pore distribution have been proposed. Firstly, nuclear pores and/or nuclear membranes could be preferentially synthesized and degraded in specific areas of the
nuclear envelope. Alternatively, changes in nuclear pore
arrangements may result from the lateral mobility of preexisting nuclear pore complexes in the nuclear envelope (discussed in Markovics et al., 1974 In this report, we used nucleoporins fused with GFP to
monitor NPC distribution in vivo. The NUP133-disrupted
(nup133 Plasmid and Strain Construction
DNA manipulations, including restriction analysis, fill-in reactions with
Klenow fragment, and ligations, were performed essentially as described
by Maniatis et al. (1982) Table I.
Yeast Strains
; Fabre and Hurt, 1994
). Anchored
in the nuclear envelope, the NPCs of higher eukaryotes
are macromolecular structures with an estimated molecular mass of 125 megadaltons (MD) (Reichelt et al., 1990
).
Their basic architecture, including a characteristic eightfold symmetry, is shared by the smaller 66 MD yeast NPC
(Allen and Douglas, 1989
; Rout and Blobel, 1993
).
; Doye
and Hurt, 1995
). Their implication in various NPC functions has been suggested by phenotypic analysis of conditional lethal mutants. In particular, several yeast nucleoporin mutants display an intranuclear accumulation of
poly(A)+ RNA at 37°C (Wente and Blobel, 1993
; Bogerd
et al., 1994
; Doye et al., 1994
; Fabre et al., 1994
; Aitchison
et al., 1995a
; Gorsch et al., 1995
; Grandi et al., 1995
; Heath
et al., 1995
; Hurwitz and Blobel, 1995
; Li et al., 1995
; Goldstein et al., 1996
; Siniossoglou et al., 1996
). Similarly, overexpression of the human nucleoporin Nup153 was recently
shown to inhibit mRNA trafficking (Bastos et al., 1996
).
Among the yeast nucleoporin mutants defective for mRNA export, nup84, nup85, nup120, nup133, nup145,
and nup159 mutants all display a constitutive NPC clustering that is sometimes associated with alterations in the
structure of the nuclear envelope (Doye et al., 1994
;
Wente and Blobel, 1994
; Aitchison et al., 1995a
; Gorsch et
al., 1995
; Heath et al., 1995
; Li et al., 1995
; Pemberton et
al., 1995
; Goldstein et al., 1996
; Siniossoglou et al., 1996
).
However, in contrast to the phenotype observed in the
nup116 null mutant in which a nuclear envelope seal over
the NPC was suggested to directly inhibit nucleocytoplasmic traffic (Wente and Blobel, 1993
), NPC clustering and
mRNA export defects can be dissociated; in these nucleoporin mutants, the clustered pores are competent for
poly(A)+ RNA export at the permissive temperature.
Moreover, rat7-1/nup159-1 mutant cells recover a nearly
normal NPC distribution within 1 h at 37°C, although cessation of mRNA export occurs at this restrictive temperature (Gorsch et al., 1995
). Finally, a truncation of the amino-terminal domain of Nup133p that restores normal
RNA export at 37°C does not correct the nuclear pore distribution defect (Doye et al., 1994
).
). In particular, changes in
pore distribution within a given cell type have been reported both in yeast and higher eukaryotes. For example,
pore clusters were observed in stationary yeast cultures, but not in exponentially growing cells (Moor and Mühlethaler, 1963
). Similarly, the definite pore clustering observed in early G1 HeLa cells or G0 human lymphocytes
disappears when cells enter S phase (Markovics et al.,
1974
). Besides, Severs et al. (1976)
reported that the progressive fragmentation of a large vacuole during G0 and
the beginning of S phase is associated with changes in the
size and position of pore-free areas within the yeast nuclear envelope. Dramatic changes in NPC distribution have
also been associated with the nuclear shaping and chromatin condensation processes during spermiogenesis (Rattner and Brinkley, 1971
) and during the active phase of apoptosis (Falcieri et al., 1994
).
; Severs et al., 1976
).
Until recently, it was not possible to distinguish between
these two hypotheses because the dynamic distribution of
pores could not be directly observed. However, the recent
advent of green fluorescent protein (GFP) technology
now enables in vivo analysis of protein distribution. GFP
and brighter GFP variants engineered by mutational analysis have been successfully used as reporters of gene expression, tracers of cell lineage, and as fusion tags to monitor protein localization in various organisms (for reviews
see Cubitt et al., 1995
; Prasher, 1995
). In addition, GFPchimeras have been used to monitor subcellular events in
living cells such as separation of the spindle pole bodies or
movements of actin patches in yeast (Kahana et al., 1995
;
Doyle and Botstein, 1996
; Waddle et al., 1996
).
) strain that displays a constitutive NPC clustering (Doye et al., 1994
; Li et al., 1995
) enabled us to follow
two aspects of NPC dynamics: the movements of NPC
clusters in dividing nup133
cells and the redistribution of
the clustered NPCs upon induction of Nup133p expression
in a GAL-nup133 strain. To further characterize Nup133pinduced NPC redistribution, we developed an assay based on the formation of heterokaryons between nup133
mutants and cells expressing or overexpressing Nup133p. Our
results show that Nup133p can be targeted to the clustered
NPC and thereby promotes their rapid redistribution.
Materials and Methods
. Strains used in this study are listed in Table I.
Yeast strains were grown in rich media (1% yeast extract, 2% bactopeptone, 30 mg/ml adenine) with either 2% dextrose (YPDA) or 2% galactose (YPGalA), or in synthetic complete media (SDC and SGalC) lacking
specific amino acids (CSM medium; Bio 101, La Jolla, CA). Plasmid transformation, gene disruption, sporulation of diploid cells, and tetrad analysis were performed as described by Wimmer et al. (1992)
. To minimize autofluorescence, all ade2
ADE3 strains were transformed with plasmid
pASZ11 containing ADE2 marker (Stotz and Linder, 1990
).
To localize nucleoporins in vivo, a GFP S65T/V163A variant (Kahana
and Silver, 1996
) was used to tag Nup49p and Nup133p. Since the wildtype allele of GFP has not been used in this study, this GFP variant will be
referred to as GFP in the manuscript.
The GFP-NUP49 fusion gene was constructed as previously described
for ProtA-NUP49 (Wimmer et al., 1992
). Briefly, an NheI/XbaI fragment
encoding GFP was obtained by PCR and fused in frame to the coding sequence of NUP49 at the unique NheI site, thereby keeping the authentic
NUP49 promotor. The fusion gene was inserted into a pUN100-LEU2
plasmid (Elledge and Davis, 1988
).
To construct the GFP-NUP133 fusion gene, a BglII blunt-ended/EcoRI
fragment encoding GFP and including a modified ATG start codon was
generated by PCR. This fragment was inserted downstream of the bluntended NdeI site located at the ATG of NUP133, thereby keeping the authentic NUP133 promotor, and fused in frame to the coding sequence of
NUP133 at an EcoRI site previously generated at the ATG of NUP133
(Doye et al., 1994
). The GFP-nup133
N fusion gene was generated by removing a 600-bp NcoI fragment encoding residues 44-236 of Nup133p as
previously described (Doye et al., 1994
). The resulting fusion genes were
inserted either in the single copy plasmid pUN100-LEU2, or in the high
copy number plasmid pRS424-TRP1 (Christianson et al., 1992
).
To construct the GAL-nup133 strain, a 1.7-kb fragment encoding TRP1pGAL10-HA from plasmid pTIF (generous gift from C. Cullin, CGM, CNRS,
Gif-sur-Yvette, France) was amplified by PCR using the following primers:
NUP133F: 5
CACCATTTAGGAATAAGGTTTAGAGGAGCTCGAGCATACTGTTACATCCAGGCCAAGAGGGAGGGC3
and NUP133R:
5
ATGGGTACGCTAAGTTCCTTCCGCAAACGAAGATGTACT T T - TTTTTCACTAGCGTAGTCTGGGACGTC 3
. Underlined sequences
are homologous to NUP133. The PCR product was used to transform the
diploid strain BMA411 by selection on SDC-trp plates as described (BaudinBaillieu et al., 1997). TRP+ transformants were characterized for correct
integration of TRP1-pGAL10-HA at the NUP133 gene locus by Southern
analysis (Sherman, 1990
). BMA411 diploids heterozygous for NUP133
were sporulated and tetrad analysis was performed.
For disruption of the NUP133 gene in the kar1-1 strain EY93, the
URA3 gene isolated as a blunt-ended BamHI fragment from plasmid yDpU (Berben et al., 1991
) was used to replace a 1.9-kb NcoI fragment of
NUP133 open reading frame from plasmid pUN100-NUP133, as previously described (Doye et al., 1994
). A linear nup133::URA3 fragment was
excised from the recombinant plasmid and used to transform the haploid
strain EY93 by selection on SDC-ura. URA+ transformants were tested
for thermosensitivity, clustering of the NPCs, and lack of Nup133p on
Western blots.
Microbiological Techniques
To synchronize cells, the haploid strains RS453a and nup133
a containing
the pUN100-GFP-NUP49 and pASZ11 plasmids were grown at 25°C in
SDC-leu -ade medium to early-log phase (0.5 OD600). 20 ng/ml of
-factor
(Sigma Chemical Co., St. Louis, MO) was added to the medium, and cells
were further incubated for 2 h at 25°C. G1-arrested cells were collected by
centrifugation and washed twice with SDC-leu -ade medium. Cells were
further grown for 30 min in SDC-leu -ade medium at 25°C before being
observed by confocal microscopy.
For mating and cytoduction experiments, ~3 × 106 exponentially growing cells of each parent were mixed together and concentrated onto 25-mm nitrocellulose filters (type HA, 0.45 µm; Millipore Corp., Bedford, MA) using a syringe and a swinnex filter unit (Millipore Corp.). Filters were incubated on YPDA plates for 30 min to 1 h at 30°C. Cells were then resuspended by vortexing the filter in a sterile tube containing 1.5 ml of media and analyzed by fluorescence microscopy.
Fluorescence Microscopy
Indirect immunofluorescence microscopy on formaldehyde-fixed cells was
performed according to Schimmang et al. (1989)
with the following modifications: Yeast cells were fixed for 30 min in 3.7% formaldehyde and converted into spheroplasts using 0.2 mg/ml Zymolyase 100 T (Seikagaku
Corp., Tokyo, Japan). The spheroplasts were spotted on polylysine-coated
slides and left to air dry for 5 min. Slides were immersed in methanol at
20°C for 6 min and then in acetone at
20°C for 30 s. After rinsing with
PBS, the slides were incubated in mAb414 antibody (Aris and Blobel,
1989
) (BAbCO, Richmond, CA) diluted 1:20 in PBS containing 1% BSA,
followed by Rhodamine-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) at a dilution of 1:100.
For DNA staining, 1 µg/ml 4
,6
-diamindino-2-phenylindole (DAPI) was used. Fixed cells were visualized on a microscope (model DMR; Leica,
Inc., Deerfield, IL) equipped with an HBO100 mercury lamp (Osram,
Germany) and ×100/1.4 objective lens.
For confocal analysis, growing yeast cells were put in a Sykes Moore Chamber (Bellco, Vineland, NJ) filled with 1.2 ml SDC medium and centrifuged for 3 min at 1,500 g. Living cells were imaged at room temperature, 24-27°C, on an inverted microscope (Leica, Inc.) equipped with a ×100/1.4 objective lens, and scanning was performed with a True Confocal Scanner LEICA TCS 4D, GFP fluorescence signal being detected with the fluorescein channel. To compensate photobleaching during long-term experiments, laser power was progressively increased to yield images with similar intensities. Acquisition of eight focal planes, 0.3 to 0.8 µm apart, was routinely made. As indicated in figure legends, either individual sections or two-dimensional projection of images collected at all relevant z-axes is presented. Cells left in the chamber after an experiment proceeded to divide many times, which indicates that they were not damaged by the illumination. For kinetic analysis of heterokaryons, ~10 independent heterokaryons were followed at various (10-25 min) intervals.
For random analysis of heterokaryons, 0.05% agarose was added to the medium, and 10 ml of cells was placed on a microscope slide and covered with a coverslip (24 × 60 µm). The cells were observed by fluorescence with a chilled CCD camera (Hamamatsu Phototonics, Hamamatsu City, Japan) on a microscope (Leica, Inc.) equipped with the following filter set: excitation, 450-490, dichroic, 510; emission, 515-560 (Filter L4; Leica, Inc.), a 100-W mercury arc lamp, and a ×100/1.4 objective lens. For these experiments, images of ~100 individual heterokaryons were recorded.
Polyclonal Antisera, Affinity Purification of Antibodies, and Immunoblotting
Rabbit polyclonal antibodies were generated against the MS2pol-C-Nup49p and His6-N-Nup133p fusion proteins expressed in Escherichia coli.
The MS2pol-C-Nup49p fusion protein contained 99 amino acids from the
phage MS2 polymerase (Klinkert et al., 1988
) plus the 225 COOH-terminal amino acids from the Nup49p protein. This recombinant protein was
recovered from the inclusion bodies and purified by electroelution from
polyacrylamide gels. The histidine-tagged amino-terminal domain of
Nup133p (amino acids 14-164) expressed from the pET-HIS6 vector in
E. coli BL21 strain was purified by passing the bacterial lysate over a
nickel column (QIAGEN Inc., Chatsworth, CA). The MS2pol-C-Nup49p
and His6-N-Nup133p fusion proteins were used for rabbit immunization
as described (Hurt et al., 1988
). From the obtained sera, antibodies were
affinity purified against the recombinant proteins immobilized on nitrocellulose (Hurt et al., 1988
).
Whole cell extracts from yeast strains were prepared by resuspending freshly harvested cells from a 40-ml culture (0.5 OD600) in 0.4 ml of 2× Laemmli buffer. 0.4 g of glass beads were added, and the samples were incubated at 100°C for 6 min with vigourous vortexing in between. The extracts were centrifuged, aliquots corresponding to 1 OD (OD600) were applied on 8 or 10% SDS-polyacrylamide gels, and separated proteins were blotted onto nitrocellulose (Schleicher and Schuell, Keene, NH). Membranes were blocked in 5% milk powder in PBS + 0.1% Tween 20, and immune sera were used at dilutions 1:500 for affinity-purified antiNup49p, 1:250 for affinity-purified anti-Nup133p, 1:2,000 for polyclonal anti-GFP (Clontech, Palo Alto, CA), and 1:5,000 for polyclonal antiNop1p. Immune detection was carried out with anti-rabbit IgGs coupled to horseradish peroxidase followed by enhanced chemiluminescence detection (Amersham International Inc., Buckinghamshire, England) according to the company's instructions.
GFP-Nup49p Is Functional and Localizes to the Nuclear Pore Complexes
To examine in vivo the distribution of NPCs in wild-type
and nucleoporin mutant cells, the yeast nuclear pore protein
Nup49p was tagged with GFP. The single copy number
plasmid, pUN100-GFP-NUP49, in which the GFP-NUP49
fusion gene is expressed under the authentic NUP49
promotor, was transformed into the VDIR shuffling strain disrupted for the essential NUP49 gene and complemented with a wild-type NUP49 allele carried by plasmid
pCH1122-NUP49. After selection on SDC-leu plates, transformants displayed a typical red-white sectoring phenotype
because of the loss of the ADE3-carrying pCH1122-NUP49
plasmid (data not shown), indicating that GFP-Nup49p rescues the disruption of NUP49. The expression of GFPNup49p was also analyzed by SDS-PAGE and Western
blotting using anti-Nup49p and anti-GFP antibodies. As
shown in Fig. 1 A, an anti-Nup49p antibody recognized a
single band corresponding to wild-type Nup49p in the VD1R
strain (lane 3). Upon transformation with plasmid pUN100-GFP-NUP49, an additional band migrating at the
expected size for the GFP-Nup49p fusion protein was detected by both anti-Nup49p and anti-GFP antibodies (lane
4). In white colonies, derived from the VD1R strain expressing GFP-Nup49p, wild-type Nup49p was no longer
detected (lane 5), thereby confirming that GFP-Nup49p is able to rescue the otherwise lethal phenotype of a nup49
null mutant. As judged by the intensity of the signals obtained with anti-Nup49p, GFP-Nup49p displayed a similar
expression level as compared to endogenous Nup49p when
expressed either in wild-type (lanes 4 and 5) or in NUP133disrupted cells (nup133
; lane 2).
(lane 1), nup133
+ pUN100-GFPNUP49 (lane 2), VD1R (lane 3), VD1R + pUN100-GFP-NUP49 (lane 4), and VD1R + pUN100-GFP-NUP49 and lacking pCH1122NUP49 (lane 5). Equivalent amounts of extracts from each strain were analyzed by SDS-PAGE and immunoblotting using an antiNup49p and an anti-GFP antibody. The positions of Nup49p and GFP-Nup49p and the molecular masses (kD) of a protein standard are
indicated. (B) Colocalization of GFP-Nup49p and nuclear pore complex antigens. Wild-type (WT) and nup133
cells expressing GFPNup49p, which is detected in the fluorescein channel (GFP), were fixed and processed for indirect immunofluorescence using the monoclonal antibody mAb414 followed by rhodamine-labeled goat-anti mouse IgG. DNA staining and the Nomarski optics view are shown.
(C) In vivo localization of GFP-Nup49p using confocal microscopy. Two successive sections (0.5 µm apart) are presented. A ringlike
staining of the nuclear periphery, typical for nucleoporins, is observed in wild-type cells (WT). Arrows show absence of nuclear pore
complexes in areas of close association between the nucleus and the vacuole. In nup133
and to a lesser extent nup85
strains, nuclear
pores are clustered. Bars, 5 µm.
The subcellular localization of GFP-Nup49p was analyzed in both wild-type and nup133
cells that display a
constitutive NPC clustering phenotype (Doye et al., 1994
;
Li et al., 1995
; Pemberton et al., 1995
). Cells were fixed
and immunofluorescence was performed using the monoclonal antibody mAb414 that recognizes nuclear pore antigens (Aris and Blobel, 1989
) (Fig. 1 B). In wild-type cells,
a similar punctate staining around the nuclear envelope
was detected with both GFP-Nup49p and the monoclonal
antibody mAb414. The localization of GFP-Nup49p at the
NPC was further confirmed by its colocalization with the mAb414 epitopes at the NPC clusters present in nup133
cells (Fig. 1 B).
Similar results were obtained when GFP-Nup49p localization was examined in living cells using confocal microscopy (Fig. 1 C). The preservation of the cell morphology
further enabled the visualization of specific features of
NPC distribution within wild-type cells, such as the lack of
labeling in areas of close association between the nucleus
and the vacuole (Severs et al., 1976
). In agreement with
the NPC-clustering phenotypes previously observed in
nup133
and NUP85-disrupted (nup85
) cells (Doye et al.,
1994
; Li et al., 1995
; Pemberton et al., 1995
; Goldstein et
al., 1996
), GFP-Nup49p was localized within one or few
clusters in nup133
cells (Fig. 1 C), whereas an intermediate phenotype with small aggregates, crescent-shaped and
faint ringlike structures, could be observed in nup85
cells.
In conclusion, these results indicate that GFP-Nup49p is
functionally targeted to the NPC. Similarly, it has been recently reported that GFP-tagged Nup85p is functional and
localized to the NPC (Goldstein et al., 1996
).
The ability to follow GFP-Nup49p-expressing cells in
vivo was essential to analyze the successive changes in nuclear envelope shape during cell division. In wild-type cells
followed at 10-min intervals, insertion of the nucleus into
the neck, nuclear elongation and migration into the bud,
and the final bilobed shape of the nucleus during karyokinesis could be readily assessed (Fig. 2 A). Therefore, in
cells displaying such a homogeneous NPC distribution, GFP-Nup49p provides an alternative tool to previously
described fluorescent lipophilic dyes such as DiOC6 (Koning et al., 1993
) to monitor in vivo changes in nuclear shape
and position.
cells at
10-min intervals. Cells expressing
GFP-Nup49p were examined by confocal microscopy as described in
Materials and Methods. Each image is a two-dimensional projection
of images collected at all relevant
z-axes. (A) In wild-type RS453a cells,
elongation of the nucleus towards
the daughter cell can be observed.
(B) In synchronized nup133
a cells,
a dynamic distribution of the clusters of NPCs is observed (left).
Soon after cell division (right), both
mother and daughter nuclei move
towards the future buds; note the
position of clustered NPCs close to
each novel budneck. During karyokinesis (bottom), elongated clusters
that span the two nuclei can also be
seen.
In nup133
cells, changes in the distribution of the NPC
clusters were observed within 10 min (Fig. 2 B, left). Just
after cell division, as the nuclei moved towards the site of
the future buds, the rotation of the nuclei and/or the modified distribution of NPC clusters within the nuclear envelope frequently led to aggregated NPCs that were positioned close to the budnecks (Fig. 2 B, right). In other
cells, an elongated cluster of pores that spanned the two
nuclei was seen during karyokinesis (Fig. 2 B, bottom).
These results indicate a dynamic distribution of the NPC
clusters within the nuclear envelope and further suggest
that the localization of the NPC aggregates is, in general,
not random, but rather permits the distribution of clustered NPCs to the daughter nucleus.
Induction of Nup133p Expression in nup133
Cells Restores a Homogeneous Distribution of Nuclear
Pore Complexes
To investigate further the role of Nup133p in NPC distribution, a GAL-nup133 strain was constructed, in which
Nup133p expressed under the control of the inducible
GAL10 promotor was integrated at the NUP133 locus by
homologous recombination. On galactose-containing medium (YPGalA), the GAL10 promotor is induced, and
GAL-nup133 cells showed normal growth properties both
at 24 and 37°C (Fig. 3 A). In agreement with the temperature-sensitive phenotype of NUP133-disrupted cells (Doye
et al., 1994
), GAL-nup133 cells displayed a growth defect
at 37°C upon repression of the GAL10 promotor on glucose-containing plates (YPDA). However, a residual growth could be observed at 37°C, which correlated with the low
level of Nup133p detected by Western blotting (Fig. 3 B),
and probably reflected a leak of the GAL10 promoter.
During galactose induction, Nup133p level increased after
4 h and was similar to wild-type Nup133p after about 8 h.
GAL-nup133 cells grown overnight in galactose-containing medium reached a Nup133p-expression level similar to
Nup133p when the protein was overexpressed from a high
copy number plasmid.
(
), wild-type RS453 (+), nup133
carrying the high copy number plasmid pRS424-NUP133 (++), and GAL-nup133 grown overnight in YPDA medium (0) or shifted
for 2, 4, 6, 8, and 24 h to YPGalA medium. Total protein corresponding to similar amounts of cells were analyzed by SDS-PAGE
and immunoblotting using an anti-Nup133p antibody. AntiNop1p antibody was used to control the amounts of protein
loaded. The molecular masses (kD) of a protein standard are indicated. (C) Analysis of NPC distribution during Nup133p induction. Cells from strain GAL-nup133 carrying plasmid pUN100GFP-NUP49 were grown in SDC-leu medium (0) or shifted to
SGalC-leu medium for 2, 4, 6, 8, or 24 h as indicated and analyzed by confocal microscopy. Each image is a two-dimensional projection of images collected at all relevant z-axes using the fluorescein channel. The fluorescent staining patterns reflect the intracellular distribution of NPCs.
NPC distribution was visualized in GAL-nup133 cells
expressing GFP-Nup49p at various stages during galactose
induction. When the GAL10 promoter was repressed,
clusters of NPCs along the nuclear envelope were revealed
by the GFP-Nup49p fluorescence (Fig. 3 C); however, the
overall number of aggregates was higher when compared
to nup133
cells (see Fig. 1 C). A further increase in the
number of nuclear pore clusters was observed after 4 h
growth in galactose-containing medium. Finally, a ringlike
staining reflecting a homogeneous distribution of the NPCs
appeared in some cells after 6 h, and was detected in most
cells after growth for 8 h in galactose-containing medium.
Since the intensity of the GFP signal directly reflects the
amount of the fusion protein, the brighter fluorescence intensity of the NPC clusters when compared to the ringlike
staining suggests that Nup133p induction finally leads to a
homogeneous distribution of the NPCs within the nuclear
envelope but does not alter their overall number. The correlation between the expression level of Nup133p (Fig. 3
B) and the number of NPC clusters (Fig. 3 C) suggests that
induction of Nup133p expression induces a progressive
fragmentation of the NPC aggregates that finally leads to a
wild-type nuclear pore distribution. However, because of
the delay (8 h) required to reach a wild-type NPC distribution, this final phenotype could reflect either the insertion
in the nuclear envelope of de novo synthesized pores during successive cell divisions or the redistribution of preexisting nuclear pore complexes.
Analysis of GFP-Nup133p Targeting to nup133
Nuclei
To analyze whether Nup133p-induced NPC redistribution
could be uncoupled from successive nuclear divisions, we
devised an in vivo assay based on the use of heterokaryons. kar1 mutants that display nuclear fusion defects thus
leading to the formation of heterokaryons have been previously used in S. cerevisiae for assaying the shuttling of
proteins from one nucleus to another (Flach et al., 1994
)
or the targeting of Tub4p to the spindle pole body (Marschall et al., 1996
). The basic design of our experiment was
therefore to construct heterokaryons between nup133
cells and cells either expressing or overexpressing Nup133p, the kar1-1 mutation being carried by either of the two
mating partners. We expected that Nup133p synthesized
by the wild-type cell should be targeted to the nup133
nucleus upon zygote formation, thereby complementing the
NPC clustering phenotype.
To follow the targeting of Nup133p during this mating
process, a GFP-NUP133 fusion gene, expressed under the
authentic NUP133 promotor, was inserted both in the single copy number pUN100 plasmid or the high copy number plasmid pRS424. As a further control, we tagged with
GFP the previously characterized nup133
N mutant that
is targeted to the NPCs but does not complement the clustering phenotypes of nup133
cells (Doye et al., 1994
).
Both GFP-Nup133p and GFP-nup133
Np fusion proteins
were able to rescue the temperature-sensitive phenotype
of nup133
cells (data not shown). On Western blots, the
expression level of wild-type Nup133p and GFP-Nup133p
detected with the anti-Nup133p antibody were equivalent
(Fig. 4 A, lanes 1 and 2). Since the antigen used to raise the
anti-Nup133p antibody has a limited overlap with the
GFP-nup133
Np mutant, a faint signal could only be detected with anti-Nup133p in yeast cells overexpressing this fusion protein (lane 6). While GFP-Nup133p and GFPnup133
Np expressed on a single-copy number plasmid
were hardly detectable with the anti-GFP antibody (data
not shown), a comparable staining intensity was obtained
with this antibody for the overexpressed GFP-Nup133p and GFP-nup133
Np proteins (Fig. 4 A, lanes 5
and 6
).
It should be noted that the anti-GFP antibody gave similar
staining intensities for GFP-Nup49p expressed on a centromeric plasmid and for overexpressed GFP-Nup133p or
GFP-nup133
Np (Fig. 4 A, compare lane 7
to lanes 5
and 6
). Although variations in the transfer efficiency of the two proteins on nitrocellulose cannot be excluded, this
result suggests that in yeast, the Nup49p nucleoporin is
more abundant than Nup133p.
Np. (A) Immunoblotting analysis. To follow the
expression of wild-type and GFP-tagged Nup133p, whole cell extracts were analyzed by SDS-PAGE and immunoblotting using
either an antibody directed against the amino-terminal domain of
Nup133p or an anti-GFP antibody. The following strains were analyzed: kar1-1 (lane 1), nup133
+ pUN100-GFP-NUP133 (lane
2), nup133
+ pUN100-GFP-nup133
N (lane 3), nup133
+ pRS424-NUP133 (lanes 4 and 4
), nup133
+ pRS424-GFPNUP133 (lanes 5 and 5
), and nup133
+ pRS424-GFPnup133
N (lanes 6 and 6
). As reference, a whole cell extract
from strain VD1R + pUN100-GFP-NUP49 was loaded on the
same gel (7
). The positions of Nup133p (
), GFP-Nup133p (
), GFP-nup133
Np (
), and GFP-Nup49p (*) are indicated. (B)
Confocal analysis of nup133
cells expressing GFP-Nup133p and
GFP-nup133
Np chimeras. (a) Expression of GFP-Nup133p carried by plasmid pUN100 gives rise to a faint, ringlike staining. (b)
GFP-nup133
Np expressed on the pUN100 centromeric plasmid
localizes within NPC clusters. (c and d) When carried by the high
copy number plasmid pRS424, GFP-Nup133p (c) and GFPnup133
Np (d) present a heterogeneous expression level; some
cells display an additional cytoplasmic and nuclear staining. Images correspond to individual sections recorded by confocal microscopy. To enable quantitative comparison, the power intensity
of the laser was set to the same value in each case.
Confocal analysis of nup133
cells expressing GFPNup133p revealed a ringlike staining around the nuclear
envelope, indicating that this fusion protein is targeted to
the NPCs and complements the clustering phenotype of
the nup133
mutant (Fig. 4 B, a). In agreement with Western blotting data, the fluorescent signal was, however,
weaker as compared to the one obtained in GFP-Nup49p-
expressing cells. As previously reported for the protein
A-tagged mutant (Doye et al., 1994
), GFP-nup133
Np expressed on a centromeric plasmid localized within NPC
clusters (Fig. 4 B, b). Upon overexpression of either fusion, a heterogeneous signal was obtained that probably
reflected the variable amount of copies of the 2µ plasmid
present in each cell (Fig. 4 B, c and d). Cells that highly
overexpressed GFP-Nup133p displayed not only a typical
ringlike staining but also a very strong nuclear and cytoplasmic staining, whereas the vacuoles were not labeled (Fig. 4 B, c).
These various constructs were used to analyze the targeting of GFP-Nup133p to the nucleus of nup133
cells in
heterokaryon assays. Fusions were first made between nup133
cells and nup133
kar1-1 cells expressing GFPNup133p on a centromeric plasmid (Fig. 5 A). Before fusion, the nup133
nucleus was not labeled, whereas GFPNup133p expression in the nup133
kar1-1 cell gave rise to
a ringlike staining. Because of the low expression level of
GFP-Nup133p, no more than three successive images
could be recorded for each zygote. After heterokaryon
formation, GFP-Nup133p labeling was initially restricted
to one or two aggregates along the nuclear envelope of the
nup133
nucleus. Within 10 to 20 min, the number of labeled aggregates increased (Fig. 5 A). At later stages, a homogeneous ringlike staining was observed (data not shown).
As control, we also analyzed the targeting of GFP-Nup133p
to wild-type nuclei by mating nup133
kar1-1 cells expressing GFP-Nup133p with wild-type cells. Under those conditions, a progressive and homogeneous labeling around the
nuclear envelope of the wild-type nucleus was observed
(Fig. 5 B). This result indicates that upon mating, GFPNup133p can be targeted to the clustered NPCs present in
nup133
cells as well as to the randomly distributed NPC
present in wild-type cells.
and wild-type cells
upon mating. (A and B)
nup133
(A) or wild-type
(B) cells were mated with
nup133
kar1-1a cells carrying the pUN100-GFPNUP133 plasmid as described in Materials and
Methods. Heterokaryons defective for nuclear fusion
were followed by confocal
microscopy. Schematics of
the heterokaryon boundaries are shown for reference.
(C and D) nup133
kar1-1
cells were mated with
nup133
a cells carrying the
pRS424-GFP-NUP133 (C) or
the pRS424-GFP-nup133
N plasmid (D). Heterokaryons
were followed by confocal
microscopy. Time 0 corresponds to the last image recorded before cytoduction, i.e., when no cytoplasmic
staining is detectable in the
left (nup133
kar1-1) cells. A
transmission image of the
first two heterokaryons is
shown for reference.
Using a similar procedure, targeting of overexpressed
GFP-Nup133p was analyzed upon mating between nup133
kar1-1 and nup133
cells overexpressing GFP-Nup133p
(Fig. 5 C). Because of the cytoplasmic staining associated
with overexpression of GFP-Nup133p, early stages of cytoplasmic fusion could be visualized. Under these conditions,
GFP-Nup133p, which was probably provided by the cytoplasmic pool, was rapidly targeted to a restricted area of
the nuclear envelope. Within 10-20 min, a homogeneous
labeling around the nup133
nucleus was observed. We
examined the specificity of this targeting by mating nup133
kar1-1 cells with cells overexpressing GFP-nup133
Np.
As shown in Fig. 5 D, GFP-nup133
Np was also rapidly
targeted to a defined area of the nuclear envelope, but unlike in the case of GFP-Nup133p, this labeling did not further spread along the nuclear envelope, even 60 min after
cytoduction. Taken together, these results indicate that
both fusions are efficiently targeted to both randomly distributed and clustered NPCs in which the binding sites for
Nup133p are thus accessible. Furthermore, the appearance of a homogeneous labeling around the nuclear envelope of nup133
nuclei correlates with the amount of incorporated GFP-Nup133p and requires the presence of its
amino-terminal domain.
Analysis of NPC Redistribution upon Mating between
nup133
and Wild-Type Cells
The previous experiments suggested that Nup133p is able
to induce the redistribution of the nup133
clustered NPCs.
To further demonstrate that the homogeneous distribution of GFP-Nup133p around the nuclear envelope correlates
with the redistribution of the nuclear pore complexes themselves, similar cytoduction experiments were performed,
in which GFP-Nup49p expressed in the nup133
cells was
used to follow NPC distribution.
In the first set of experiments, nup133
cells expressing
GFP-Nup49p were mixed with kar1-1 cells and analyzed
by confocal microscopy. Fig. 6 A illustrates the GFPNup49p localization pattern of a typical heterokaryon at
various stages after cell fusion. At early stages (0-12 min),
NPC clusters on the nup133
nuclear envelope were
brightly labeled with GFP-Nup49p, whereas the wild-type
nucleus was not labeled. Subsequently, a decreased intensity of the GFP-Nup49p signal within the NPC clusters was found, coincident with the appearance of additional aggregates and the spreading of the fluorescent labeling along
the nuclear envelope. Finally, nearly wild-type nuclear
pore distribution was generally observed within 40 to 60 min. At this late stage, zygotes usually displayed a typical
trilobed shape. In the mean time, a homogeneous albeit
fainter labeling of the wild-type nucleus progressively appeared, indicating that GFP-Nup49p expressed by the
nup133
cell can be targeted to the other nucleus.

cells
carrying the pUN100-GFP-NUP49 plasmid were mixed with kar1-1a cells. An example of such a heterokaryon, followed at
12-min intervals using confocal microscopy, is presented. The transmission image (bottom) shows the morphology of the
zygote at the end of the experiment (48 min). (B) nup133
kar1-1a cells expressing GFP-Nup49p were mixed with
nup133
cells expressing Nup133p carried by the high copy number plasmid
pRS424-NUP133. Heterokaryons were
followed at 10-min intervals. At time 0 (when the septum between the mating
cells was still detectable), the clustered nuclear pores from the nup133
kar1-1 nuclei
are stained with GFP-Nup49p. After cytoduction, the redistribution of nuclear
pores labeled with GFP-Nup49p occurs within 10-20 min. A faint labeling of the
other nuclei can be detectable after 20 min. In the upper heterokaryon, redistribution of the GFP-Nup49p labeling had
occurred within 8 min (right). Small aggregates randomly distributed around the nuclear envelope are detectable. The other
heterokaryon had already reached a later stage in the mating process (as revealed by
its trilobed morphology on the corresponding transmission image) and presents a staining of both nuclei.
Strikingly, when nup133
kar1-1 cells expressing GFPNup49p were mixed with yeast cells overexpressing Nup133p,
the redistribution of the clustered NPCs could then be
achieved within 10 min (Fig. 6 B). Intermediate stages
could sometimes be recorded, in which small NPC aggregates were homogeneously distributed around the nuclear
envelope (Fig. 6 B, right). The increased rate of NPC redistribution upon mating with cells overexpressing
Nup133p was also revealed by the shape of the zygote in
which no bud formation was yet detectable. In contrast,
the progressive labeling of the wild-type nucleus occurred
independently of the expression level of Nup133p (compare Fig. 6, A and B). These results were further confirmed by random analysis of ~100 individual heterokaryons recorded at various stages during the mating process.
Schematic representation of the successive steps occurring
during either mating process are summarized in Fig. 7, A
and B. The fast rate of NPC redistribution observed when
overexpressed Nup133p is provided to the nup133
nucleus suggests that, under such conditions, the homogeneous GFP-Nup49p labeling reflects the redistribution of
preexisting NPCs.
cells expressing GFP-Nup49p and cells expressing or overexpressing Nup133p (see also Fig. 6). (C and D)
Analysis of GFP-Nup49p targeting to the nup133
nucleus upon mating between nup133
cells and cells expressing GFP-Nup49p together with wild-type Nup133p (C) or overexpressed Nup133p (D). The localization of GFP-Nup49p and the shape of heterokaryons recorded on the CCD camera at various stages during the mating process are presented. The delay required for these processes, as estimated through kinetic analysis of individual heterokaryons, is indicated on the left.
To try to demonstrate that NPC redistribution can effectively be uncoupled from de novo NPC biogenesis, a final
set of experiments were performed, in which GFP-Nup49
was provided by the wild-type nucleus together with wildtype or overexpressed Nup133p. The rationale of this experiment was that if NPC redistribution requires de novo
NPC biogenesis, this process should be stimulated by the overexpressed Nup133p. Accordingly, the rate of incorporation of GFP-Nup49p in the nup133
nuclei should be
increased and intermediate stages with brightly labeled
aggregates should be observed. For these experiments, random analysis of ~100 individual heterokaryons, recorded at various stages during the mating process, was
performed. Similar results were also obtained by kinetic
analysis of heterokaryons (data not shown). Heterokaryons representative of either mating experiment are respectively presented in Fig. 7, C and D. Upon mating between
nup133
cells and kar1-1 cells expressing GFP-Nup49p,
the GFP-Nup49p labeling initially appears within one or
few NPC clusters. At later time points, an increased number of GFP-Nup49p-labeled aggregates can be seen,
which finally leads to a smooth ringlike staining (Fig. 7 C).
In contrast, when a strain overexpressing Nup133p was
used, >90% of the analyzed heterokaryons follow the kinetics summarized in Fig. 7 D: a homogeneous and very
faint staining of the entire nuclear envelope can be initially
detected within 20 min after cytoduction. At later time
points, the intensity of the labeling progressively increases.
Furthermore, the rate of GFP-Nup49p incorporation within
the nup133
nucleus is similar to the one observed upon
targeting of GFP-Nup49p to wild-type nuclei (compare
Fig. 6, A and B, to Fig. 7 D). As summarized in Fig. 7,
these results indicate that under such mating conditions,
NPC redistribution occurs before the incorporation of
GFP-Nup49p in the nup133
nucleus.
In this paper, we have demonstrated that it is possible to
GFP-tag Nup49p and Nup133p to produce functional fusions that rescue lethal or temperature-sensitive phenotypes of strains that contain deletion of the corresponding
genes. In both wild-type and nup133
cells, GFP-Nup49p
colocalizes with antigens recognized by the antinucleoporin
mAb414. In addition, in nup133
and nup85
cells the fluorescent signal was concentrated within a restricted area
of the nuclear envelope corresponding to the clustered
NPCs; similar results were also obtained when GFPNup133p is expressed in nup85
cells (data not shown).
This labeling is in agreement with the clustering phenotype
observed in nup133
and nup85
cells fixed and processed
for electron microscopy (Doye et al., 1994
; Li et al., 1995
;
Pemberton et al., 1995
; Goldstein et al., 1996
). Furthermore, when cells were not processed for immunostaining, specific features of NPC distribution, such as the absence
of NPCs from areas in close association between the nucleus and the vacuoles, could be observed by confocal microscopy. This staining is consistent with previous reports
using freeze-fracture electron microscopy, which showed
the absence of nuclear pores in nuclear envelope areas adjacent to the vacuole (Severs et al., 1976
). Taken together,
these results clearly demonstrate that the in vivo localization of the GFP-nucleoporin fusions faithfully reflects NPC distribution in both wild-type and nucleoporin mutant yeast cells.
Recently, a light microscopy method in which single
NPCs can be visualized and their three-dimensional arrangement assessed in permeabilized 3T3 cells has been
described (Kubitscheck et al., 1996
). However, because of
the higher density of NPCs in wild-type yeast cells (11-15
pores/µm2) as compared to 5 pores/µm2 in 3T3 cells (Severs et al., 1976
; Maul and Deaven, 1977
; Kubitscheck et al.,
1996
), single yeast nuclear pores labeled with GFP-Nup49p cannot be visualized by this method (Kubitscheck, U., personal communication). Therefore, to analyze the dynamics
of nuclear pore distribution in yeast, we have used the
properties of NUP133-disrupted (nup133
) cells that display a constitutive NPC clustering that is not associated
with drastic alterations in the structure of the nuclear envelope (Doye et al., 1994
; Li et al., 1995
). This strain enabled us to follow two aspects of NPC dymanics: the
movements of NPC clusters in dividing nup133
cells and
the redistribution of the clustered NPCs once Nup133p is
provided to nup133
cells.
In dividing nup133
cells expressing GFP-Nup49p, apparent movements of NPC clusters could be visualized,
whereas no major changes in their distribution were detected in cells in stationary phase (data not shown). In dividing cells, the dynamic distribution of the NPC clusters
could thus be related to modifications in the nuclear shape
and/or to the nuclear rotation that is required for correct
positioning of the spindle pole bodies. It has also been reported that in S. cerevisiae, both nuclear surface area and
nuclear pore number rapidly increase during nuclear division up until cell division (Jordan et al., 1977
). The progressive spreading of NPC clusters along the nuclear envelope could therefore be induced by membrane formation
if localized in between NPC clusters. Alternatively, lateral
movements of NPC clusters within the nuclear envelope,
possibly driven by interactions with as yet unidentified structures, may also be involved in this process (see below).
To induce the redistribution of the clustered NPCs
present in nup133
cells, Nup133p was either expressed
under the control of the inducible GAL10 promoter or
provided to nup133
cells upon mating and subsequent cytoduction. Using both approaches, a correlation could be
made between the expression level of Nup133p and the
degree of nuclear pore clustering: an intermediate clustering phenotype could be observed in cells that expressed
low levels of Nup133p, whereas random NPC distribution
was only achieved once wild-type levels of Nup133p were
reached. This result suggests that a threshold level of
Nup133p is required for homogeneous NPC distribution in
wild-type cells. The correlation between the amount of
Nup133p provided to the nup133
nucleus upon cytoduction and the rate of NPC redistribution further demonstrates that Nup133p is directly involved in this process.
A major question raised in this study was to determine
how Nup133p establishes an even NPC distribution, and
whether this redistribution could be uncoupled from de
novo NPC biogenesis and turnover. Indeed, upon mating
between nup133
cells expressing GFP-Nup49p and wildtype cells, whereas a progressive redistribution of the clustered NPC was observed, a homogeneous labeling of the
wild-type nucleus could be detected within 20 to 30 min.
Similarly, when GFP-Nup49p was provided by the wildtype cell, its targeting to the nup133
-clustered NPCs
could be observed. Similar results were also obtained upon
analysis of GFP-Nup133p targeting to either wild-type or nup133
nuclei. This progressive labeling of the nucleus
might correspond to the targeting of additional GFPtagged nucleoporin subunits to the preexisting nuclear
pores, to the exchange between GFP-fusion proteins and
preexisting nucleoporins, or to the incorporation of GFPNup49p upon de novo synthesis of NPCs. Since nothing is known so far concerning the rate of NPC biogenesis in
yeast heterokaryons, we cannot discriminate between the
incorporation of GFP-tagged nucleoporins in either preexisting or newly assembled NPCs. Since the precise subcellular localization of Nup49p and Nup133p has not been
analyzed so far, these two nucleoporins might thus be peripheral and accordingly easily exchangeable components of the NPC. In contrast, a set of abundant nucleoporins including Pom152p, Nic96p, Nup157p, Nup170p,
and Nup188p have been proposed to form the octagonal
core structure of the NPC (Aitchison et al., 1995b
; Nehrbass et al., 1996
) and accordingly might only be incorporated during NPC assembly. Similar cytoduction assays, if
extended to the analysis of such nucleoporins, may thus allow discrimination between exchange of subunits within
preexisting NPCs and de novo NPC assembly. Therefore,
we cannot exclude that the apparent nuclear pore redistribution occurring within the nup133
nucleus upon mating
with wild-type cells may, at least in part, involve NPC biogenesis. Under these standard conditions, NPC redistribution can therefore not be uncoupled from a putative de
novo assembly of nuclear pores.
In contrast, the use of yeast cells overexpressing Nup133p
in such cytoduction experiments enables us to dissociate
NPC redistribution from this putative de novo NPC biogenesis. Under these mating conditions, the amount of
available Nup133p is no longer limiting. The rapid targeting of overexpressed Nup133p to the clustered NPCs, as
visualized when Nup133p is tagged with GFP, correlates with the increased rate of NPC redistribution, which can
occur within 10 min. This could imply that simultaneous
degradation of the clustered NPCs and de novo biogenesis
of randomly distributed nuclear pores could take place.
However, since no detectable labeling of the wild-type nuclei could be observed within this short period, both processes should be specifically stimulated in the nup133
nuclei.
In addition, since the rate of NPC redistribution correlates with the amount of Nup133p provided to the nup133
nucleus, these two processes should be directly induced by
Nup133p. One would then expect Nup133p to play a key
role in both NPC biogenesis and degradation. Yet, unlike
Nsp1p and Nic96p, whose depletion/mutation induces a
decrease in nuclear pore density (Mutvei et al., 1992
; Zabel et al., 1996
), NUP133 disruption does not significantly alter the overall number of nuclear pores (Doye et al.,
1994
; Li et al., 1995
; Pemberton et al., 1995
). Furthermore, upon mating between nup133
cells and cells overexpressing Nup133p, analysis of GFP-Nup49p targeting
revealed that the incorporation of GFP-Nup49p is not stimulated in the nup133
nuclei. In contrast, we could
demonstrate that NPC redistribution occurs before the incorporation of GFP-Nup49p in the nup133
nucleus. These
results therefore indicate that NPC redistribution does not
require de novo NPC biogenesis but rather corresponds to
the redistribution of preexisting clustered NPCs. This
rapid redistribution is most likely achieved through lateral
movements of preexisting NPCs within the nuclear envelope.
The finding that NPCs can rapidly move within the nuclear envelope was rather unexpected. Although rapid
movements of transmembrane proteins that may result
from membrane fluidity have been frequently reported,
NPCs are elaborate structures embedded in two membranes, the inner and the outer nuclear membrane. NPC in
higher eukaryotes were also shown to be physically anchored in the nuclear lamina (Aaronson and Blobel,
1974
). In addition, filamentous structures associated with
the baskets and projecting deeply inside the nucleus (Franke and Scheer, 1970
; Scheer et al., 1976
; Ris and Malecki, 1993
) and a nuclear lattice that is thought to connect
the distal rings of NPC baskets (Goldberg and Allen,
1992
) have been observed in amphibian oocytes. Filaments protruding from the cytoplasmic side of the NPCs
may also anchor the nuclear pores within the cytoskeleton
(Scheer et al., 1976
; for review see Goldberg and Allen,
1995
). Similarly, both cytoplasmic and nuclear filaments associated with the nuclear pore complexes have been observed in S. cerevisiae (Allen and Douglas, 1989
; Rout and
Blobel, 1993
). Although not demonstrated in higher eukaryotes, lateral movements of NPCs within the nuclear
envelope may therefore require specific modifications of
these NPC-anchoring structures. For example, drastic
changes in NPC distribution are found during apoptosis (Falcieri et al., 1994
). This may be related to nuclear lamina disassembly which has also been observed to occur
during the active phase of apoptosis (Lazebnik et al.,
1993
). However, since no lamins have yet been identified
in yeast, lateral mobility may be a specific characteristic of
yeast NPCs. Finally, the rapid redistribution of preexisting
NPCs, so far only demonstrated in our cytoduction assays,
may reflect a specific feature of nup133
cells in which interactions between NPCs and putative anchoring structures would be impaired.
Various factors have been previously suggested to influence nuclear pore distribution in eukaryotic cells (discussed in Markovics et al., 1974
; Severs et al., 1976
). One
factor is the presence of condensed chromatin in close
proximity to the inner nuclear membrane. In addition, the
vacuolar membrane was proposed to constitute one constraint on nuclear pore distribution in yeast (Severs et al.,
1976
). Unlike in these various models, changes in NPC distribution that occur in nucleoporin mutants have not been
found associated with major changes in vacuolar or chromatin organization: in these mutants, pore-free areas are
not associated with vacuolar membranes. In addition, immunolocalization of Rap1p, a telomere binding protein (Klein et al., 1992
), revealed a normal telomere distribution in nup133
cells (Gotta et al., 1996
). As an alternative
explanation, the orientation of the clustered NPCs may reflect a higher order structure within the nucleus since NPC
clusters in nup120-disrupted cells were generally found
opposite to the nucleolus (Aitchison et al., 1995a
).
Among the nucleoporins that affect NPC distribution,
Nup84p, Nup85p, and Nup120p are tightly associated within
a nuclear pore subcomplex (Siniossoglou et al., 1996
).
NPC clustering may thus correspond to a specific defect
shared by a subset of proteins associated within one or a
few NPC substructures. A weak homology has been previously reported between the amino-terminal domain of
Nup133p that encompasses our nup133-
N deletion and a
central domain within Nup120p (Aitchison et al., 1995a
).
In addition, nup133
and nup120
cells display a similar
constitutive clustering phenotype that is not associated
with major alteration of the nuclear envelope at permissive temperature (Doye et al., 1994
; Aitchison et al., 1995a
;
Heath et al., 1995
; Li et al., 1995
). Although phenotypical analysis of the corresponding nup120 deletion mutant
would be necessary to test this hypothesis, the interaction
of Nup133p and Nup120p with a common partner may be
required for inducing or maintaining the homogeneous
distribution of NPCs in the nuclear envelope. Our future
goal will be to identify such component(s) interacting with
the amino-terminal domain of Nup133p and required for
homogeneous NPC distribution.
Received for publication 15 August 1996 and in revised form 4 December 1996.
Address all correspondence to Valérie Doye, CNRS UMR144, Institut Curie, 26, rue d'Ulm, 75231 Paris Cedex 05, France. Tel.: (33) 1 42 34 64 13. Fax: (33) 1 42 34 64 21. E-mail: Valerie.Doye{at}curie.frWe would like to thank Michel Bornens for his constant support and Franck Perez (University of Geneva, Switzerland), for helpful suggestions throughout the course of this work. We are also indebted to Vincent Galy for his help in the mating experiments. We also thank Franck McKeon (Harvard Medical School, Boston, MA) for providing the S65T/V163A GFP mutant, Elmar Schiebel (Max-Planck-Institute, Martinsried, Germany), Christophe Cullin and Agnès Baudin (CGM, CNRS, Gif-sur-Yvette, France), Patrick Linder (Biozentrum, Bazel, Switzerland), and Ed Hurt (University of Heidelberg, Germany) for sharing plasmids, strains, and antibodies. The critical reading of the manuscript by C. Dargemont, E. Fabre (Institut Pasteur, Paris, France), G. Almouzni, S. Holmes, R. Golsteyn, T. Ruiz, and E. Bailly is gratefully acknowledged.
This work was supported by CNRS (UMR144), by the Institut Curie and from a grant from the "Fondation pour la Recherche Medicale." N. Belgareh received a fellowship from the "Ministère de l'Enseignement et de la Recherche Supérieure."
DAPI, 4
,6
-diamindino-2-phenylindole;
GFP, green fluorescent protein;
MD, megadaltons;
NPC, nuclear
pore complex;
SDC or SGalC, synthetic dextrose or galactose complete
media;
YPDA or YPGalA, yeast extract, bactopeptone, dextrose or galactose, and adenine.