|
||
Pulmonary and Critical Care Division, Department of Medicine, University of Pennsylvania Medical Center, Philadelphia, Pennsylvania 19104-4283
Platelet/endothelial cell adhesion molecule (PECAM-1) is a cell adhesion molecule of the immunoglobulin superfamily that plays a role in a number of vascular processes including leukocyte transmigration through endothelium. The presence of a specific 19- amino acid exon within the cytoplasmic domain of PECAM-1 regulates the binding specificity of the molecule; specifically, isoforms containing exon 14 mediate heterophilic cell-cell aggregation while those variants missing exon 14 mediate homophilic cell-cell aggregation. To more precisely identify the region of exon 14 responsible for ligand specificity, a series of deletion mutants were created in which smaller regions of exon 14 were removed. After transfection into L cells, they were tested for their ability to mediate aggregation. For heterophilic aggregation to occur, a conserved 5-amino acid region (VYSEI in the murine sequence or VYSEV in the human sequence) in the mid-portion of the exon was required. A final construct, in which this tyrosine was mutated into a phenylalanine, aggregated in a homophilic manner when transfected into L cells. Inhibition of phosphatase activity by exposure of cells expressing wild type or mutant forms of PECAM-1 to sodium orthovanadate resulted in high levels of cytoplasmic tyrosine phosphorylation and led to a switch from heterophilic to homophilic aggregation. Our data thus indicate either loss of this tyrosine from exon 14 or its phosphorylation results in a change in ligand specificity from heterophilic to homophilic binding. Vascular cells could thus determine whether PECAM-1 functions as a heterophilic or homophilic adhesion molecule by processes such as alternative splicing or by regulation of the balance between tyrosine phosphorylation or dephosphorylation. Defining the conditions under which these changes occur will be important in understanding the biology of PECAM-1 in transmigration, angiogenesis, development, and other processes in which this molecule plays a role.
PLATELET/endothelial cell adhesion molecule (PECAM-1, CD31)1 is a 130-kD integral membrane
glycoprotein of the immunoglobulin superfamily
expressed on endothelial cells, platelets and leukocytes (Newman et al., 1990 PECAM-1 has been noted to function as both an adhesion molecule (Albelda et al., 1991 Recent analysis of PECAM-1 expression in the developing mouse embryo has revealed the presence of multiple
isoforms of murine PECAM-1 (muPECAM-1) that appear to result from the alternative splicing of exons encoding cytoplasmic domain sequences (exons 10-16) (Baldwin
et al., 1994 These data indicate that exon 14 of the cytoplasmic domain contains specific information that regulates the ligand
choice of PECAM-1 in transfected L cells. Although alterations in the cytoplasmic domain have clearly been shown
to affect ligand binding of many cell adhesion molecules
(CAMs) with regard to affinity, to our knowledge, alternative splicing of a cytoplasmic domain has not been reported to regulate ligand specificity of a CAM.
A key question raised by our findings is how changes in
one exon of the cytoplasmic domain of PECAM-1 can dramatically affect the binding characteristics of the molecule.
Exon 14 is a small exon that encodes 19 amino acids (Kirschbaum et al., 1994 Construction of PECAM-1 Cytoplasmic
Domain Mutants
A series of mutant muPECAM-1 constructs were produced in which portions of exon 14 were removed or mutated (see Fig. 1). The altered forms
of PECAM-1 were constructed from the full-length wild-type murine
form of PECAM-1 cDNA subcloned into the PcDNA/Neo vector (Yan et
al., 1995
The following two outside primers were used as the external primers
for these reactions: a sense primer (primer A) (5 The following pairs of primers were used as inside primers in the initial
PCR to create the following mutants:
PECAM-1- PECAM-1- PECAM-1- PECAM-1-686Y
; reviewed in DeLisser et al., 1994a
and
Newman, 1997
). Although the full range of physiologic functions of PECAM-1 are not yet known, evidence exists to
support a role for this molecule in leukocyte transmigration
through endothelium (Muller et al., 1993
; Vaporciyan et
al., 1993
; Bogen et al., 1994
), release of leukocytes from
bone marrow (Leavesley et al., 1994
), cardiovascular development (Baldwin et al., 1994
; Pinter et al., 1997
), and
angiogenesis (DeLisser et al., 1997
; Matsumura et al., 1997
).
; Muller et al., 1992
; DeLisser et al., 1993
) and a signal transduction molecule
(Tanaka et al., 1992
; Piali et al., 1993
; Berman and Muller,
1995
). It is somewhat unique as a cell adhesion molecule,
however, in that conditions have been defined (see below)
in which PECAM-1 mediates homophilic interactions
(DeLisser et al., 1994b
; Yan et al., 1995
) or heterophilic interactions to ligands such as heparin-containing proteoglycans (DeLisser et al., 1993
; Watt et al., 1993
), the integrin
v
3 (Piali et al., 1995
; Buckley et al., 1996
), and an unidentified ligand on activated T cells (Prager et al., 1996
).
Although we believe that increased cell surface density,
through its ability to favor homodimer formation, may be
a factor in regulating PECAM-1 function (Sun et al., 1996
),
the molecular mechanisms that define this ligand specificity are still unknown.
). Forms of human PECAM-1 (huPECAM-1) (Goldberger et al., 1994
) and bovine PECAM-1 (Osawa et
al., 1997
) with alternatively spliced cytoplasmic domains
have also been identified. To investigate the functional
consequences of alternatively spliced muPECAM-1 cytoplasmic domains, L cells were transfected with cDNA for
each variant and their ability to promote cell aggregation was compared (Yan et al., 1995
). In this assay, full-length
muPECAM-1 and all three isoforms containing exon 14 behaved like full-length huPECAM-1 in that they mediated heterophilic aggregation. In contrast, all muPECAM-1
variants missing exon 14 exhibited homophilic aggregation. Exon 14 thus appeared to be an important modulator
of the ligand and adhesive interactions of the extracellular
domain of muPECAM-1. These observations were confirmed and expanded in a recent study examining the role
of exon 14 in the function of huPECAM-1. Similar to the
results with muPECAM-1, all L cell lines expressing mutants of huPECAM-1 lacking exon 14 exhibited homophilic
aggregation while all those expressing huPECAM-1 possessing exon 14 aggregated in a heterophilic fashion (Sun
et al., 1996
).
). A large portion of the amino acids in
this exon are highly conserved in mice (ALGTRATETVYSEIRKVDP) and humans (DLGKKDTETVYSEVRKAVP) (Baldwin et al., 1994
). Within this exon, there
are five amino acids that could potentially serve as phosphorylation sites, including one tyrosine in the context of a
possible SH2 binding domain (YSEI or YSEV). The carboxyl end of the exon has a proline, as well as a number of
highly charged amino acids. It is currently unknown which
sequences in this exon are regulatory. The purposes of this investigation were to more precisely identify the region of
exon 14 responsible for ligand specificity and to use this information to try to begin to understand the mechanism by
which this part of the molecule might regulate function.
Our experiments suggest that the key residue of exon 14 is
the tyrosine at amino acid 686 and that either loss of this
tyrosine from exon 14 or its phosphorylation results in a
change in ligand specificity from heterophilic binding to
homophilic binding. These results imply that vascular cells
could thus determine whether PECAM-1 functions as a
heterophilic or homophilic adhesion molecule by processes such as alternative splicing or by regulation of the
balance between tyrosine phosphorylation or dephosphorylation.
Materials and Methods
). This full-length cDNA served as the template for the sequence
overlap extension (SOE) polymerase chain reactions (Horton et al., 1990
).
Fig. 1.
Cytoplasmic domain mutants of muPECAM-1. The
PECAM-1 cytoplasmic domain is encoded by exons 9-16. A series of muPECAM-1 mutants in which specific exons encoding
regions of the cytoplasmic domain had been deleted were constructed and expressed in L cells as described in Materials and
Methods. The extracellular domain and transmembrane regions
were wild type and the same for each construct. The figure indicates: the name of each construct; the regions of exon 14 that
were deleted or mutated (note: muPECAM-
5
exon 14 is deleted in the sequence ALGRTRATET; muPECAM-
3
exon 14 is deleted in the sequence VYSEIRKVDP); and the aggregation
behavior of murine L cells stably expressing each construct.
[View Larger Version of this Image (43K GIF file)]
-1395TATGAAAGCAAAGAGTGA1412-3
) flanking the BstEII restriction site within the 6th
extracellular Ig-like domain, and an antisense primer (primer B) (5
-2253
CGAATGCATCCAGGAATCGGCTGCTCT2235-3
) complimentary to
a region 70-bp downstream from the stop codon of muPECAM-1 and carrying an NsiI recognition sequence to facilitate subcloning. For each of the
mutants described below a set of inside primers was constructed, each
spanning the area of deletion or mutation and each having substantial
overlap. The sense inside primer was used in a PCR reaction with primer
B to create a fragment that would become the 3
end of the cytoplasmic domain. The antisense inside primer was used in a PCR reaction with primer
A to create a fragment that would become the 5
end of the cytoplasmic
domain. Each of these two fragments were then reacted together in a PCR
reaction to create a longer fragment. These SOE products were then digested with BstEII and NsiI and ligated into PcDNA/neo vector containing muPECAM-1 previously cut with the same restriction enzymes.
5
exon 14 (Missing ALGTRATET in Exon 14).
Sense primer
(5
-2134 EXON14ACAGAGACG2142EXON15ATTCTCATGGAAAA-3
); Antisense primer (5
-EXON15CATGAGATT2142 EXON14CGTCTCTGTGGCTC2129-3
).
3
exon14 (Missing VYSEIRKVDP in Exon 14).
Sense
primer (5
-EXON13CCTCACCAAEXON14GTGTACAGTGAGAT-3
); Antisense primer (5
-EXON14ACTGTACACEXON13TTGGTGAGGCTC-3
).
RKVDP (in Exon 14).
Sense primer (5
-2148 EXON14CAGTGAGATCEXON15AATCTCATGGAAAAC2187-3
); Antisense primer (5
2182
EXON15CCATGAGATTEXON 14GATCTC ACTGTA CAC2145-3
).
F (in Exon 14).
Sense primer (5
-2279GAGACGGTGTTCAGTGACATCCGGAAG2305-3
); Antisense primer (5
-GATCTCACTGAACACCGTCTCTGTGGC-3
).
of the mutation site. Candidate clones finally were
tested for efficient protein translation by transfection into Cos-1 cells before going on to permanent transfections of L cell fibroblasts.
Tissue Culture and Transfection of L Cells
Murine L cells were cultured in RPMI medium with 10% FBS plus
glutamine, and antibiotics. The procedure to transfect PECAM-1 cDNA
into these cells has been previously described in detail (DeLisser et al.,
1994b
). Briefly 105 L cells were plated on a 100-mm tissue culture plate
the night before transfection. The day of the transfection the cells were washed with PBS and fed DME with 10% FBS. Using the CaPO4 method of transfection, 10 µg of muPECAM-1 cDNA and 14 µg of calf thymus DNA were combined with BBS and CaCl2 to form a DNA precipitate. This precipitate was added to the cells in culture and allowed to incubate
~20 h. After 20 hours the cells were washed three times with PBS and fed
RPMI medium with 10% FBS. 24 h after transfection, the cells were split
1:10, and 48 h after transfection the cells were fed G418 selection medium
(0.5 mg/ml). The G418-resistant colonies were grown up and tested by
FACS® for surface expression of PECAM-1.
To isolate cells with higher expression levels of PECAM-1, cells were sorted using magnetic beads coupled with anti-PECAM-1 antibody. The night before sorting, the transfected L cells were trypsinized and replated in the original tissue culture dishes. On the day of sorting, the transfected L cells were washed with PBS twice and dissociated with enzyme-free cell dissociation solution (Specialty Media, Inc., Lavallette, NJ). The cell pellet was resuspended and incubated in 400 µl of rat anti-mouse PECAM-1 primary antibody (mAb 390) for 1 h on a nutator at 4°C. 1 h later, the cells were spun down, washed with PBS twice, resuspended, and then incubated in 400 µl of RPMI medium with 1% FBS that contained 10 µl of Dynabeads M-450 coated with sheep anti-rat IgG (Dynal, Inc. Great Neck, NY) for 30 min on a nutator at 4°C. After 30 min, the bead-coated cells were resuspended in 3 ml of PBS, transferred into a snap cap tube, and concentrated using a Dynal Magnetic Particle Concentrator (Dynal, Inc.). The sorted cells were washed with PBS three times and cultured in RPMI medium with 10% FBS plus G418.
In addition to the muPECAM-1 L cell lines, experiments were also
conducted with L cells transfected with full length huPECAM-1 and with
a truncated form of huPECAM containing the extracellular and transmembrane domains along with exon 9, 10, and 14, PECAM-1(+)9,10,14 (Sun et al., 1996
).
Antibodies
The following antibodies were used: (a) anti-muPECAM-1 mAb 390 generated in rat after immunization with mouse 32D leukocyte cell line
screened against muPECAM-1
12,15 (Baldwin et al., 1994
); (b) anti-
huPECAM-1 polyclonal antibody "Houston" (Albelda et al., 1991
); and
(c) anti-huPECAM-1 mAb 1.3 generously provided by P. Newman
(Blood Center of Southeastern Wisconsin, Milwaukee, WI).
FACS® Analysis. L cells transfected with muPECAM-1 isoforms were nonenzymatically removed from a T-25 tissue culture flask, washed with PBS, and treated with mAb 390 for 1 h at 4°C. The primary antibody was then removed and the cells were washed with PBS. A dilution of 1:200 of fluorescein isothiocyanate-labeled goat anti-rat secondary antibody was added to the cells for 30 min at 4°C. The cells were then washed again in PBS and flow cytometry was performed using an Ortho Cytofluorograph 50H cell sorter equipped with a 2150 data handling system (Ortho Instruments, Westwood, MA). All cell lines established had an approximate mean fluorescence of 110-125 (a level comparable to that seen on endothelial cells) and were >90% positive for muPECAM-1.
Sodium Orthovanadate Treatment
A working solution at 92 mg/ml of sodium orthovanadate (Sigma Chemical Co., St. Louis, MO) was boiled and cooled. The appropriate amount was added to RPMI/10% FBS to a final concentration of 0.5 mM. The L cells were then incubated for the indicated times in this vanadate-containing media. The time of incubation ranged from overnight exposure to 1-h exposure.
Immunoprecipitation and Immunoblotting
Nonionic detergent cellular extracts were prepared by adding small volumes of TNC (0.01 M Tris acetate, pH 8.0, 0.5% NP-40, 0.5 mM Ca2+) with 2 mM PMSF and 100 mM vanadate to cells that had been trypsinized and washed. Cells were lysed on ice for 20 min. The resulting extracts were preabsorbed for 1 h at 4°C with protein G-conjugated Sepharose beads (Pharmacia Fine Chemicals, Piscataway, NJ). After removal from the beads, the precleared supernatants were transferred to another eppendorf with fresh protein G-Sepharose beads and 2 µl of Houston polyclonal antiserum was added for each 100 µl of lysate. Immunoprecipitation was carried out at 4°C for 2 h. After the immunoprecipitation, the beads were washed five times with DOC wash (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 5% deoxycholate, and 0.1% SDS). The sample was then dissolved in loading buffer (62.5 mM Tris base, 2% SDS, 10% glycerol, pH 6.8), and electrophoresed on a 6% polyacrylamide gel.
After resolving on the SDS-PAGE gel, the proteins were transferred to nitrocellulose membranes. The membranes were blocked for at least 1 h in 4% BSA/PBS/.02% azide. Blots were then incubated in either 1 µg/ml mouse anti-phosphotyrosine mAb (clone 4G10; Upstate Biotechnology Inc., Lake Placid, NY) or in the polyclonal anti-huPECAM-1 antiserum at a dilution of 1:700 for 1 h at room temperature. After extensive washing for 1 h, the blots were incubated in HRP donkey anti-mouse Ig (Jackson Immunoresearch Laboratories, Inc., West Grove, PA) at room temperature for 1 h. After washing, the blots were developed with the chemiluminescence reagent (New England Nuclear, Boston, MA) according to the manufacturer's instructions.
Aggregation of L Cell Transfectants
The aggregation assays used in these studies have been described previously in detail by DeLisser et al. (1993)
. Briefly, stable L cell transfectants
that had been plated (0.8-1 × 106 cells/75-cm2 flask) and grown overnight
were nonezymatically removed. The cells were washed twice in 10 mM
EDTA in PBS, pH 7.2, and twice in HBSS without divalent cations. After
washing, the cells were resuspended at a final concentration of 0.8-1 × 106
cells/ml in HBSS with or without 1 mM calcium. Where indicated, the
polyclonal anti-huPECAM-1 antibody Houston was added at a final concentration of 100 µg/ml. After the cells had been dispersed into a single
cell suspension, 1-ml aliquots were transferred to wells in a 24-well nontissue culture plastic tray (Costar Corp., Cambridge, MA) that had been previously blocked with 2% BSA in HBSS for 1 h and washed thoroughly
with HBSS immediately before use. The nontissue culture-treated trays
containing the suspended L cells were rotated on a gyratory platform at
100 rpm, for 45 min at 37°C. Aggregation was quantified by examining
representative aliquots from each sample on a hemocytometer grid using
phase contrast optics. The number of single cells (cells in aggregates of 3 or less) versus those present in aggregates of greater than three cells were
counted from four 1-mm squares. At least 400 cells were counted from
each sample. Data were expressed as the percent total cells present in aggregates.
Mixed Aggregation Assay
To determine if the muPECAM-1-dependent L cell aggregation was mediated by homophilic or heterophilic mechanisms, mixed aggregation assays were performed as described in detail (DeLisser et al., 1993
). In these
experiments, L cell aggregation was performed by mixing nontransfected
and transfected L cells, with the nontransfected L cells fluorescently labeled before mixing. After the nontransfected cells had been washed once
with EDTA, they were resuspended in HBSS to a total volume of 1 ml. 1 ml of rhodamine-conjugated dye solution at a final concentration of 1 mM
(Sigma Chemical Co.), in a buffer provided by the manufacturer, was
added, followed by incubation at room temperature for 5-10 min. Labeling was terminated by adding an equal volume of FBS and washing the
cells in HBSS. The second EDTA wash and the two HBSS washes were
then performed as described above. Each set of cells, one labeled, the
other unlabeled, were resuspended at 0.8-1 × 106 cells/ml. 500-µl aliquots
of each were combined in the wells of the 24-well nontissue culture plate
and allowed to aggregate as described above. After the aggregation was
complete, the cells were viewed under epifluorescence. The number of
fluorescent cells in each aggregate of a given size was counted. Quantitative analysis of the aggregating cell populations was performed as described by Sieber and Roseman (1981)
.
The Region of Exon 14 That Regulates Heterophilic
Aggregation Is within 5 Amino Acids in the 3
Portion
of Exon 14
Since the full-length form of muPECAM-1 (Fig. 1 A) mediates heterophilic aggregation and a form missing exon 14 mediates homophilic aggregation (Fig. 1 B), we initially
designed two additional muPECAM-1 constructs in which
either the 9 amino acids from the NH2-terminal portion of
exon 14 (muPECAM-
5
exon 14; Fig. 1 C) or the 10 amino acids from the carboxyl-terminal portion of exon 14 (muPECAM-
3
exon 14; Fig. 1 D) were removed. These
constructs were sequenced and transfected into L cells.
After selection in G418, cells expressing the constructs
were enriched using magnetic beads and at least three separate cell lines with equivalent muPECAM-1 expression selected.
Fig. 2 demonstrates the cell composition of aggregates
when these cell lines were subjected to mixed aggregation
studies. The construct lacking the NH2-terminal portion of
exon 14, muPECAM-
5
exon 14, showed a bell-shaped
distribution pattern indicating heterophilic aggregation
(Fig. 2 A) similar to that seen with full-length muPECAM-1
(Yan et al., 1995
). In contrast, the construct lacking the
carboxyl-terminal portion of exon 14, muPECAM-
3
exon
14, showed a pattern consistent with homophilic aggregation (Fig. 2 B) similar to that seen with the muPECAM-1
mutant lacking exon 14 (Yan et al., 1995
). These studies
indicate that the region of exon 14 that regulates heterophilic aggregation is within the last 10 amino acids
(VYSEIRKVDP) of the carboxyl portion of exon 14.
5
exon 14 (A), muPECAM-
1-
3
exon 14 (B), muPECAM-1-
RKVDP
(C) or muPECAM-1-686Y
F (D) in
which equal numbers of nontransfected and transfected L cells were mixed together after fluorescent labeling of one of
the cell lines. After incubation, the number of labeled cells within each six-cell aggregate was counted. muPECAM-1-
5
exon 14 (A) and muPECAM-1-
RKVDP
(C) formed aggregates composed primarily of mixtures of nontransfected and transfected cells consistent with a heterophilic
interaction while for muPECAM-1-
3
exon 14 (B) and muPECAM-1-686Y
F
(D) the majority of the aggregates consisted only of transfected cells, indicative
of homophilic binding. The data is representative of at least two experiments. All
the transfectants described above expressed PECAM-1 at comparable levels
by FACS® analysis (mean [log] fluorescence intensities of 100-120).
This carboxyl end of exon 14 appeared to have two potential functional regions. The first was a 5-amino acid region (VYSEI) that places tyrosine in the context of a potential SH2 binding site (Songyang et al., 1993
). The
second region (RKVDP) was a highly charged region with
a terminal proline. To localize the regulatory region more
precisely, an additional construct was made in which only
the last 5 amino acids in the carboxyl end of exon 14 were
removed (muPECAM-
RKVDP, Fig. 1 E). After transfecting and isolating L cells expressing this construct at
comparable levels, multiple clones were tested in mixed
aggregation assays. As shown in Fig. 2 C, these cells aggregated in a heterophilic manner.
Since the muPECAM-
3
exon 14 mutant showed a pattern characteristic of homophilic aggregation, while the
muPECAM-DRKVDP aggregated in a heterophilic manner, these data indicate that the presence of the VYSEI region was the critical region to confer heterophilic binding.
Mutation of a Single Amino Acid in Exon 14 (the Tyrosine at AA686) Can Convert Heterophilic to Homophilic Binding
As mentioned above, the VYSEI sequence fits criteria for
a potential SH2 binding domain. To determine if this tyrosine was important in the ability of this sequence to regulate PECAM-1 function, an additional construct was
made in which the tyrosine at amino acid 686 was mutated
to a phenylalanine (muPECAM-1-686Y
F, Fig. 1 F).
After transfecting and isolating L cells expressing this construct at comparable levels, multiple clones were tested in mixed aggregation assays. As shown in Fig. 2 D, these cells aggregated in a homophilic manner. This experiment indicates that mutation of a single amino acid in exon 14 (the tyrosine at AA686) can convert heterophilic to homophilic binding.
PECAM-1 Can Be Phosphorylated on Tyrosine after Treatment with Sodium Orthovanadate
The results described above indicate that the tyrosine in exon 14 plays a role in the ligand specificity of PECAM-1. It was therefore of interest to study the effects of enhanced tyrosine phosphorylation on PECAM-1 function.
PECAM-1 is known to be phosphorylated primarily on
serine and threonine residues (Newman et al., 1992
; Zhender
et al., 1992). However, recent studies have identified conditions where tyrosine phosphorylation has also been observed (Modderman et al., 1994
; Lu et al., 1996
; Newman,
1997
). To examine the status of tyrosine phosphorylation
in L cells transfected with full-length PECAM-1, cells were
immunoprecipitated with a polyclonal antibody against huPECAM (Houston) and transferred to nitrocellulose
where they were then immunoblotted with either an mAb
to huPECAM-1 (mAb 1.3) or an mAb recognizing phosphotyrosine. HuPECAM-1 was used in these studies since
an antibody capable of immunoblotting murine PECAM was not available and we have observed no differences in
the behavior of muPECAM and huPECAM with regard
to the presence or absence of exon 14 (DeLisser et al., 1993
;
Yan et al., 1995
; Sun et al., 1996
).
As shown in Fig. 3 (lane 1), under resting conditions, L
cells expressing huPECAM-1 show very low levels of tyrosine phosphorylation. Treatment of cells with the tyrosine phosphatase inhibitor, sodium orthovanadate, however, prevented dephosphorylation and resulted in very
high steady state levels of PECAM-1 tyrosine phosphorylation (Fig. 3, lane 2). As a control, treatment of L cells expressing a mutant form of huPECAM-1 lacking the exons
11-16 (PECAM-
11-16) showed no evidence of tyrosine
phosphorylation before (Fig. 3, lane 3) or after (Fig. 3,
lane 4) treatment with sodium orthovanadate.
11-16, lanes 3 and 4), and
huPECAM-1 lacking exons 11-16 with the addition of exon 14 (PECAM-9,10,14, lanes 5 and 6) were immunoprecipitated with a
polyclonal antiserum directed against huPECAM-1, transferred
to nitrocellulose, and immunoblotted with a monoclonal antibody directed against either huPECAM-1 (upper panel) or phosphotyrosine (lower panels). Cells were first exposed to control
media (Vanadate
) or to media containing sodium orthovanadate for 24 h (Vanadate +). The upper panels show uniform expression of PECAM-1 under these conditions. Note that the mutant forms of PECAM-1 have a slightly lower molecular weight.
Under control conditions, little or no phosphotyrosine was detected in the full-length PECAM-1 (lane 1) or in either mutant
(lanes 3 and 5). Treatment of cells with the tyrosine phosphatase
inhibitor, sodium orthovanadate, however, induced very high levels of PECAM-1 tyrosine phosphorylation (lane 2). In contrast, L
cells expressing PECAM-
11-16 did not exhibit tyrosine phosphorylation before (lane 3) or after (lane 4) treatment with sodium orthovanadate. However, orthovanadate treatment of cells
expressing PECAM-9,10,14 resulted in the appearance of a
strong band (lane 6) indicating that the tyrosine on exon 14 was
phosphorylated under these conditions.
Tyrosine Phosphorylation of PECAM Converts Heterophilic to Homophilic Binding
Having demonstrated that treatment of PECAM-expressing L cells with sodium orthovanadate led to high levels of
tyrosine phosphorylation, the functional result of this
change was analyzed by performing aggregation studies.
Sham-transfected L cells, which normally aggregate at
very low levels in the presence or absence of calcium were
not induced to aggregate by the addition of sodium vanadate (Fig. 4 A). As described before, L cells expressing
full-length huPECAM aggregated in a calcium-dependent,
heterophilic fashion (Fig. 4 A). Exposure of these cells to
orthovanadate, however, changed the aggregation pattern
to one that was more robust and calcium independent.
When mixed aggregation studies were performed, a pattern consistent with homophilic aggregation was observed (data not shown). Although our initial studies were performed after exposure of cells to vanadate for 24 h, the effect of vanadate was much more rapid. Fig. 4 B shows a
time course experiment, where the full effects of orthovanadate were evident when the compound was added only
during the aggregation assay (~1 h of exposure).
CD). Sham-transfected L
cells and L cells expressing huPECAM-1
CD did not aggregate in the presence or
absence of calcium. No aggregation was
induced by exposure to vanadate. As expected, L cells expressing full-length huPECAM-1 demonstrated calcium-dependent aggregation under control conditions. Exposure of these cells to orthovanadate,
however, changed the aggregation pattern to one that was more robust and calcium independent. (B) Time course. Standard aggregation studies were performed
with and without calcium (1 mM) in L cell
transfectants expressing full-length huPECAM-1. The cells were exposed to media
containing sodium vanadate for various
lengths of time. Augmentation of aggregation and conversion to calcium-independent aggregation occurred after as little as
1 h of exposure to vanadate. (C) Antibody
inhibition studies. Standard aggregation
studies were performed with and without
calcium (1 mM) in L cell transfectants expressing full-length huPECAM-1 in the
presence or absence of sodium orthovanadate and a polyclonal anti-huPECAM antibody. Exposure of cells to orthovanadate changed the aggregation pattern to one that
was more robust and calcium independent. Both calcium- and calcium-independent aggregation was blocked to nearly baseline levels by the anti-PECAM-1 antibody. These data presented are from at least three experiments done in duplicate or triplicate and of at least two independent clones. Bars represent mean values. Error bars depict the
standard error of the mean. All the transfectants described above expressed PECAM-1 at comparable levels by FACS® analysis (mean
log fluorescence intensities of 100-120).
Additional controls were performed to document the
specificity of this response. Cells expressing a mutant form
of huPECAM-1 lacking the entire cytoplasmic domain
(PECAM-
CD) have no ability to aggregate under normal conditions (DeLisser et al., 1994b
). Addition of orthovanadate did not induce aggregation (Fig 4 A). To further
document that the change in aggregation behavior was PECAM dependent, the ability of an anti-PECAM polyclonal antibody that has previously been shown to inhibit
PECAM-mediated aggregation (Albelda et al., 1991
) was
tested. As shown in Fig. 4 C, addition of this antibody to
cells expressing full-length huPECAM-1 in the presence of
othovanadate blocked both calcium-dependent and -independent aggregation nearly completely.
Similar results were also observed using L cells expressing the murine form of PECAM-1. As shown in Fig. 5,
exposure of muPECAM-1-transfected L cells to orthovanadate for a period as short as 1 h converted calcium-dependent, heterophilic (Fig. 5, A and B) aggregation to
calcium-independent, homophilic (Fig. 5, A and C) aggregation.
Thus, in cells expressing either human or murine PECAM-1, tyrosine phosphorylation of PECAM converts heterophilic to homophilic binding.
Tyrosine Phosphorylation of Exon 14 of PECAM-1 Converts Heterophilic to Homophilic Binding
The experiments described above establish that tyrosine phosphorylation of the cytoplasmic domain can change ligand specificity of mu- or huPECAM-1; however, they do not specifically implicate exon 14 as there are 5 tyrosines that are potential phosphorylation sites within the cytoplasmic domain (in exons 9, and 12-15). To determine the functional importance of phosphorylation of this tyrosine, we needed to study a form of PECAM-1 that (a) contained the tyrosine in exon 14, (b) aggregated in a heterophilic manner, and (c) did not include other regions of the cytoplasmic domain that contained tyrosine residues that could be phosphorylated after exposure to sodium vanadate.
To determine if phosphorylation of exon 14 alone could
induce changes in ligand binding, we therefore used two
previously described huPECAM-transfected L cell lines
(Sun et al., 1996
). huPECAM-1
11-16 contains the extracellular and transmembrane domains of huPECAM-1,
plus a small portion of the cytoplasmic domain that contains exons 9 and 10. This construct thus contains only the tyrosine in exon 9. As described before, L cells transfected
the huPECAM-1
11-16 aggregate in a homophilic manner. huPECAM-1(+)9,10,14 is identical to huPECAM-1
11-16 except that the cytoplasmic domain also contains
all of exon 14 at its 3
end. In contrast to huPECAM-1
11-16, L cells transfected with this construct aggregate
in a heterophilic manner (Sun et al., 1996
); therefore, the
ability of vanadate treatment to convert this form of huPECAM-1 to homophilic binding would strongly implicate
the tyrosine in exon 14 as being important.
L cells containing these two constructs were immunoprecipitated with anti-PECAM-1 antibody and then immunoblotted with antibodies against PECAM-1 or phosphotyrosine before and after treatment with vanadate. As
shown in Fig. 3, the huPECAM-1
11-16 expressing cells
showed no evidence of tyrosine phosphorylation either before or after orthovanadate (lanes 3 and 4), thus indicating
that the tyrosine in exon 9 is not phosphorylated under
these conditions. In contrast, the immunoblot of huPECAM-1 (+)9,10,14 after orthovanadate treatment (compare lane 5 with lane 6) shows a strong band, indicating that the tyrosine on exon 14 is phosphorylated under these
conditions, although it is formally possible that the tyrosine on exon 9 was also phosphorylated (in the presence
of exon 14).
To determine the functional significance of this phosphorylation, L cells transfected with huPECAM-1(+)
9,10,14 were tested in a mixed aggregation assay with and
without orthovanadate. As shown in Fig. 6, addition of
orthovanadate converted binding from calcium-dependent
heterophilic aggregation to calcium-independent homophilic
aggregation.
Thus, phosphorylation of the tyrosine in exon 14 has the ability to convert heterophilic to homophilic binding.
Previous studies using L cell aggregation as a model for
PECAM-1-mediated adhesion have implicated a small region of the cytoplasmic domain, exon 14, as being central
in regulating the ligand binding specificity of both mu- and
huPECAM-1 (DeLisser et al., 1994b
; Yan et al., 1995
; Sun
et al., 1996
). The purpose of this study was to isolate the
precise region of this exon responsible for this activity and,
by doing so, help elucidate the mechanism by which it regulated specificity. Since removal of all exon 14 converted heterophilic to homophilic binding, a series of deletion
mutants were created in which smaller regions of exon 14 were removed. After transfection into L cells, they were
tested for their ability to mediate aggregation. The results
of these studies (Fig. 1) show that for heterophilic aggregation to occur, a conserved 5-amino acid region (VYSEI in
the murine sequence or VYSEV in the human sequence)
in the mid-portion of the exon must be present. Conversely, loss of this small region converted heterophilic to
homophilic binding. Because this region contains a tyrosine in the context of a potential SH2 binding region, a
final construct was generated in which the only mutation
was the conservative change of this tyrosine into a phenylalanine. Unlike L cells expressing wild-type PECAM-1,
L cells expressing this Y
F mutant construct aggregated in a homophilic manner, implicating this tyrosine as critically important in the regulation of ligand binding. A similar mutation in the same tyrosine of huPECAM (Y686)
has also recently been shown to affect migration rates in
PECAM-1-transfected 3T3 cells (Lu et al., 1996
).
The role of this tyrosine was further explored in a series
of experiments examining the effects of enhanced phosphorylation of PECAM-1. This was accomplished by inhibiting tyrosine phosphatase activity by exposing cells to
sodium orthovanadate using a protocol recently described
by Lu et al. (1996)
. Similar to the findings of this group
and others (Newman et al., 1992
; Zhender et al., 1992), we
found that at baseline, PECAM-1 showed only very low levels of tyrosine phosphorylation using a sensitive immunoprecipitation/immunoblotting technique. Inhibition of
phosphatase activity by a short exposure to sodium orthovanadate, however, resulted in high levels of cytoplasmic tyrosine phosphorylation (Fig. 3). Interestingly, this enhanced phosphorylation of PECAM-1 led to a switch from
heterophilic to homophilic aggregation. Although orthovanadate treatment of cells leads to global increases in tyrosine phosphorylation, specificity of this observation with
regard to PECAM-1 was confirmed by (a) lack of effect of
sodium orthovanadate in nontransfected L cells, (b) lack
of effect in L cells transfected with forms of PECAM-1 lacking the cytoplasmic domain, and (c) the ability of an
anti-PECAM-1 antibody to inhibit the phosphatase-induced
homophilic aggregation. Although there are four tyrosines
that can potentially undergo phosphorylation after treatment with orthovanadate, phosphorylation of the tyrosine
on exon 14 was shown to be sufficient to induce conversion of heterophilic to homophilic aggregation in experiments using L cells expressing a construct containing exons 9, 10, and 14. Cells expressing this construct undergo
heterophilic aggregation under control conditions (Sun et
al., 1996
). However, exposure of these cells to orthovanadate induced both tyrosine phosphorylation (Fig. 3) and
conversion to homophilic aggregation (Fig. 6).
Our data thus indicate either loss of the tyrosine in exon
14 (by deletion or mutation) or phosphorylation of this tyrosine (by inhibition of phosphatase activity) results in a
change in ligand specificity from heterophilic to homophilic binding. At first glance, these data appear difficult to reconcile; however, the unifying feature in both
conditions is a loss of the normal nonphosphorylated tyrosine residue, suggesting that this amino acid is critical for
a potential protein-protein interaction. Although a great
deal of attention has been paid to understanding the
mechanisms of the binding of cytoplasmic proteins (i.e.,
SH2 and SH3 domain-containing proteins) to phosphorylated tyrosine residues (i.e., Songyang et al., 1993
), there is
at least one other example of protein interactions that depend on the presence of nonphosphorylated molecules
and, in fact, are inhibited by tyrosine phosphorylation.
Galcheva-Gargova et al. (1996)
have recently described a
zinc finger protein termed ZPR1 that binds only to the cytoplasmic tyrosine kinase domain of the epidermal growth
factor receptor (EGFR) when the receptor is in its nonactivated, nonphosphorylated state. Treatment of cells with
ligand (EGF) induced tyrosine phosphorylation of the
EGFR and caused decreased binding of ZPR1. We speculate that a similar type of interaction may be occurring
with PECAM-1 and thus hypothesize (Fig. 7) that under
baseline conditions, when full-length PECAM-1 is in its nonphosphorylated state, it interacts with a cytoplasmic
protein (a theoretical PECAM binding protein [PBP])
that binds to a region of the cytoplasmic domain at or near
the tyrosine in exon 14 (Fig. 7 A). This binding appears to
keep PECAM-1 in a form that favors heterophilic binding.
Potential mechanisms for this effect could be induction of
a conformation change that is transmitted to the extracellular domain or, possibly, as shown in Fig. 7, maintenance of PECAM-1 in a monomeric, nondimerized form, a conformation that we believe favors heterophilic binding (Sun et
al., 1996
). We postulate that either loss of the tyrosine in
exon 14 due to deletion/mutation (Fig. 7 B) or phosphorylation of this tyrosine (Fig. 7 C) inhibits the interaction of
PECAM-1 with this PBP that then allows either a conformational change or favors the formation of homodimers that promote homophilic binding (Fig. 7 D). It is also possible, as has been recently speculated by Newman
(1997)
, that PECAM-1-induced heterophilic aggregation
is mediated by a second molecule. In our schema, loss of a
PBP bound to the tyrosine in exon 14 that transmitted a
signal to this other L cell adhesion protein could also lead
to a loss of PECAM-1-induced heterophilic aggregation. A search for such a PECAM-1 binding protein is currently
underway in our laboratory.
It is intriguing to note that a very similar tyrosine-containing sequence (IYSEVKK) is also present in the cytoplasmic domain of biliary glycoprotein (BGP/CD66a), an
immunoglobulin superfamily molecule related to carcinoembryonic antigen found on granulocytes and other cells
(Rojas et al., 1990
; Afar et al., 1992
). Biliary glycoprotein
can also be alternatively spliced, and vanadate treatment leads to increased phosphorylation (Afar et al., 1992
). Interestingly, phosphorylation of the analogous tyrosine-containing region leads to binding of the protein tyrosine
phosphatase SHP-1 (Beauchemin et al., 1997
). The functional consequences of these events on the cell adhesion
properties of BGP, which can participate in homotypic
and heterotypic binding (Oikawa et al., 1992
), have not
been described.
It is becoming clear that the tyrosine phosphorylation
status of PECAM-1 may be a critical factor in regulating
the function of the molecule. Although initial studies of
PECAM-1 found evidence of serine and threonine phosphorylation without tyrosine phosphorylation (Newman et
al., 1992
; Zehnder et al., 1992
), a number of recent studies
have begun to define conditions where tyrosine phosphorylation has been detected. Lu et al. (1996)
found that
PECAM-1 was tyrosine phosphorylated in cells after
trypsinization and suggested that
1 integrin engagement
might induce PECAM-1 dephosphorylation. More recently,
this group has found that the tyrosine phosphorylation status of Tyr686 changes during vasculogenesis in the murine
conceptus (Pinter et al., 1997
) and that phosphorylation of
this tyrosine could be induced by cSrc (Lu et al., 1997
). Tyrosine phosphorylation of PECAM-1 has also been observed in endothelial cells after mechanical stimulation
(Osawa et al., 1997
) and after aggregation of the high affinity IgE receptor in a basophilic cell line (Sagawa et al.,
1997
). Tyrosine phosphorylation of platelet PECAM-1 has
also been observed (Modderman et al., 1994
; Newman,
1997
).
In addition to our evidence that the phosphorylation
status of Y686 in PECAM-1 regulates ligand specificity, tyrosine phosphorylation is also likely to be important in
other functions of PECAM-1. Recent work by Newman's
group (Jackson et al., 1997
), suggests that phosphorylation
of the tyrosines in exons 13 and 14 provide a docking site
for the protein tyrosine phosphatase, SHP-2. SHP-2 may
then function as an active phosphatase or serve as a docking protein. Although PECAM-1 is not tyrosine phosphorylated under the conditions of our aggregation assay
(data not shown) and thus not expected to interact with
SHP-2, we did specifically look for evidence of SHP-2/PECAM-1 association by coimmunoprecipitation/immunoblot analysis before, during, and after aggregation. Despite
seeing SHP-2 association with PECAM-1 after vanadate
treatment, we found no evidence of PECAM-1-tyrosine
phosphorylation during aggregation and, as expected, no
association of SHP-2 with PECAM-1 during the aggregation process (data not shown). Thus, while the interaction of SHP-2 and PECAM-1 likely plays a role in "outside-in"
signaling, we found no evidence to suggest that this association is directly involved in determining ligand specificity.
In summary, we have identified a unique mechanism for
control of ligand specificity in an important cell adhesion
molecule. By processes such as alternative splicing or regulation of the balance between tyrosine phosphorylation/
dephosphorylation, vascular cells could determine whether
PECAM-1 functions as a heterophilic or homophilic adhesion molecule. Both of these mechanisms appear to be operative during cardiovascular development (Baldwin et al.,
1994
; Pinter et al., 1997
). Defining other conditions under which these changes occur will be important in understanding the biology of PECAM-1 in transmigration, angiogenesis, inflammation, and other processes in which
this molecule might play an important role.
Received for publication 28 February 1997 and in revised form 15 July 1997.
Address all correspondence to Steven M. Albelda, 809 Maloney Bldg., University of Pennsylvania Medical Center, 3600 Spruce St., Philadelphia, PA 19140-4283. Tel: (215) 662-3307. Fax: (215) 349-5172.The authors thank M. Daise for her technical assistance and Dr. C. Buck for his helpful comments.
This work was supported by grants from the Robert Wood Johnson Foundation Minority Faculty Development Program and National Institutes of Health grants HL-46311 and HL-03382. Much of this work was completed while S.M. Albelda was an Established Investigator of the American Heart Association.
huPECAM-1, human platelet/endothelial cell adhesion molecule; muPECAM-1, murine platelet/endothelial cell adhesion molecule; PBP, PECAM binding protein; PECAM-1, platelet/endothelial cell adhesion molecule.
| 1. | Afar, D., C.P. Stanners, and J.C. Bell. 1992. Tyrosine phosphorylation of biliary glycoprotein, a cell adhesion molecule related to carcinoembryonic antigen. Biochim. Biophys. Acta. 1134: 46-52 [Medline]. |
| 2. |
Albelda, S.M.,
W.A. Muller,
C.A. Buck, and
P. Newman.
1991.
Molecular and
cellular properties of PECAM-1 (endoCAM/CD31): a novel vascular cell-cell adhesion molecule.
J. Cell Biol.
114:
1059-1068
|
| 3. |
Baldwin, H.S.,
H.M. Shen,
H. Yan,
H.M. DeLisser,
A. Chung,
C. Mickanin,
T. Trask,
N.E. Kirschbaum,
P.J. Newman,
S.M. Albelda, and
C.A. Buck.
1994.
Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31): alternatively spliced, functionally distinct isoforms expressed during mammalian
cardiovascular development.
Development (Camb.).
120:
2539-2553
|
| 4. | Beauchemin, N., T. Kunath, J. Robitaille, B. Chow, C. Turbide, E. Daniels, and A. Veillette. 1997. Association of biliary glycoprotein with protein tryosine phosphatase SHP-1 in malignant colon epithelial cells. Oncogene 14: 783-790 [Medline]. |
| 5. | Berman, M.E., and W.A. Muller. 1995. Ligation of platelet/endothelial cell adhesion molecule 1 [PECAM-1/CD31] on monocytes and neutrophils increases binding capacity of leukocyte CR3 [CD11b/CD18]. J. Immunol. 154: 299-307 [Abstract]. |
| 6. |
Bogen, S.,
J. Pak,
M. Garifallou,
X. Deng, and
W.A. Muller.
1994.
Monoclonal
antibody to murine PECAM-1 (CD31) blocks acute inflammation in vivo.
J.
Exp. Med.
179:
1059-1064
|
| 7. |
Buckley, C.D.,
R. Doyonnas,
J.P. Newton,
S.D. Blystone,
E.J. Brown,
S.M. Watt, and
D.L. Simmons.
1996.
Identification of v 3 as a heterotypic ligand
for CD31/PECAM-1.
J. Cell Sci.
109:
437-445
[Abstract].
|
| 8. |
DeLisser, H.M.,
H.-C. Yan,
P.J. Newman,
W.A. Muller,
C.A. Buck, and
S.M. Albelda.
1993.
Platelet/endothelial cell adhesion molecule-1 (CD31)-mediated cellular aggregation involves cell surface glycosaminoglycans.
J. Biol.
Chem.
268:
16037-16046
|
| 9. | DeLisser, H.M., P.J. Newman, and S.M. Albelda. 1994a. Molecular and functional aspects of PECAM-1/CD31. Immunol Today. 15: 490-494 [Medline]. |
| 10. |
DeLisser, H.M.,
J. Chilkotowsky,
H.-C. Yan,
M.L. Daise,
C.A. Buck, and
S.M. Albelda.
1994b.
Deletions in the cytoplasmic domain of platelet-endothelial
cell adhesion molecule-1 (PECAM-1, CD31) result in changes in ligand
binding properties.
J. Cell Biol.
124:
195-203
|
| 11. | DeLisser, H.M., M. Christofidou-Solomidou, R.M. Strieter, M.D. Burdick, C.S. Robinson, R.S. Wexler, J.S. Kerr, C. Garlanda, J. Merwin, J.A. Madri, and S.M. Albelda. 1997. Involvement of endothelial PECAM-1/CD31 in angiogenesis. Am. J. Pathol. In press. |
| 12. | Galcheva-Gargova, Z., K.N. Konstantinov, I.H. Wu, F.G. Klier, T. Barett, and R.J. Davis. 1996. Science (Wash. DC). 272: 1797-1802 [Abstract]. |
| 13. |
Goldberger, A.,
K.A. Middleton,
J.A. Oliver,
C. Paddock,
H.-C. Yan,
H.M. DeLisser,
S.M. Albelda, and
P.J. Newman.
1994.
Biosynthesis and processing of
the cell adhesion molecule PECAM-1 includes production of a soluble form.
J. Biol. Chem.
269:
17183-17191
|
| 14. | Horton, R.M., Z. Cai, S.N. Ho, and L.R. Pease. 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 8: 528-535 [Medline]. |
| 15. |
Jackson, D.E.,
C.M. Ward,
R. Wang, and
P.J. Newman.
1997.
The protein-tyrosine phosphatase SHP-2 binds platelet/endothelial cell adhesion molecule-1 (PECAM-1) and forms a distinct signaling complex during platelet aggregation. 1997.
J. Biol. Chem.
272:
6986-6993
|
| 16. |
Kirschbaum, N.E.,
R.J. Gumina, and
P.J. Newman.
1994.
Organization of the
gene for human platelet/endothelial cell adhesion molecule-1 (PECAM-1)
reveals alternatively spliced isoforms and functionally complex cytoplasmic
domain.
Blood.
84:
4028-4037
|
| 17. | Leavesley, D.I., J.M. Oliver, B.W. Swart, M.C. Berndt, D.N. Haylock, and P.J. Simmons. 1994. Signals from platelet/endothelial cell adhesion molecule enhance the adhesive activity of the very late antigen-4 integrin of human CD34+ hematopoietic progenitor cells. J. Immunol. 153: 4673-4683 [Abstract]. |
| 18. |
Lu, T.T.,
L.G. Yang, and
J.A. Madri.
1996.
Integrin engagement mediates tyrosine dephosphorylation on platelet-endothelial cell adhesion molecule-1.
Proc. Natl. Acad. Sci. USA.
93:
11808-11813
|
| 19. |
Lu, T.T.,
M. Barreuther,
S. Davis, and
J.A. Madri.
1997.
Platelet-endothelial
cell adhesion molecule-1 (PECAM-1/CD31) is phosphorylatable by C-SRC,
binds SRC-SH2 domain and exhibits itam-like properties.
J. Biol. Chem.
272:
14442-14446
|
| 20. | Matsumura, T., K. Wolff, and P. Petzelbauer. 1997. Endothelial cell tube formation depends on cadherin 5 and CD31 interactions with filamentous actin. J. Immunol. 158: 3408-3416 [Abstract]. |
| 21. | Modderman, P.W., A.E.G.K. Von Dem Borne, and A. Sonnenberg. 1994. Tyrosine phosphorylation of P-selectin in intact platelets and in a disulfide-linked complex with immunoprecipitated pp60. Biochem. J. 299: 613-621 . |
| 22. |
Muller, W.A.,
M.E. Berman,
P.J. Newman,
H.M. DeLisser, and
S.M. Albelda.
1992.
A heterophilic adhesion mechanism for platelet/endothelial cell adhesion molecule 1 (CD31).
J. Exp. Med.
175:
1401-1404
|
| 23. |
Muller, W.A.,
S.A. Weigl,
X. Deng, and
D.M. Phillips.
1993.
PECAM-1 is required for transendothelial migration of leukocytes.
J. Exp. Med.
178:
449-460
|
| 24. | Newman, P.J.. 1997. Cell Adhesion in vascular biology. The biology of PECAM-1. J. Clin. Invest. 99: 3-8 [Medline]. |
| 25. |
Newman, P.J.,
M.C. Berndt,
J. Gorski,
G.C. White III,
S. Lyman,
C. Paddock, and
W.A. Muller.
1990.
PECAM-1 (CD31) cloning and relation to adhesion
molecules of the immunoglobulin gene superfamily.
Science (Wash. DC).
247:
1219-1222
|
| 26. |
Newman, P.J.,
C.A. Hillery,
R. Albrecht,
L.V. Parise,
M.D. Berndt,
A.V. Mazurov,
L.C. Dunlop,
J. Zhang, and
S.E. Rittenhouse.
1992.
Activation-dependent
changes in human platelet PECAM-1: phosphorylation, cytoskeletal association, and surface membrane redistribution.
J. Cell Biol.
119:
239-246
|
| 27. | Oikawa, S., K. Motomu, Y. Matsuoka, K. Goro, and N. Hiroshi. 1992. Homotypic and heterotypic Ca2+-independent cell adhesion activities of bilary glycoprotein, a member of the carcinoembryonic antigen family expressed on CHO cell surfaces. Biochem. Biophys. Res. Commun. 186: 881-887 [Medline]. |
| 28. | Osawa, M., M. Masuda, N. Harada, R. Bruno-Lopes, and K. Fujiwara. 1997. Tyrosine phosphorylation of platelet endothelial cell adhesion molecule-1 (PECAM-1, CD31) in mechanically stimulated vascular endothelial cells. Eur. J. Cell Biol. 72: 229-237 [Medline]. |
| 29. |
Piali, L.,
S.M. Albelda,
H.S. Baldwin,
P. Hammel,
R.H. Gisler, and
B.A. Imhof.
1993.
Murine platelet endothelial cell adhesion molecule (PECAM-1)/
CD312 modulates 2 integrins on lymphokine-activated killer cells.
Eur. J. Immunol.
23:
2464-2471
[Medline].
|
| 30. |
Piali, L.,
P. Hammel,
C. Uherek,
F. Bachmann,
R.H. Gisler,
D. Dunon, and
B.A. Imhof.
1995.
CD31/PECAM-1 is a ligand for v 3 integrin involved in
adhesion of leukocytes to endothelium.
J. Cell Biol.
130:
451-460
|
| 31. | Pinter, E., M. Barreuther, T. Lu, B.A. Imhof, and J.A. Madri. 1997. Platelet-endothelial cell adhesion molecule-1 (PECAM-1/CD31) tyrosine phosphorylation state changes during vasculogenesis in the murine conceptus. Am. J. Pathol. 150: 1523-1529 [Abstract]. |
| 32. |
Prager, E.,
R. Sunder-Plassmann,
C. Hansmann,
C. Koch,
W. Holter,
W. Knapp, and
H. Stocklinger.
1996.
Interaction of CD31 with a heterophilic
counterreceptor involved in downregulation of human T cell responses.
J.
Exp. Med.
184:
41-50
|
| 33. | Rojas, M., A. Fuks, and C.P. Stammers. 1990. Biliary glycoprotein, a member of the immunoglobulin supergene family, function in vitro as Ca2+-dependent intercellular adhesion molecule. Cell Growth Differ. 1: 527-533 [Abstract]. |
| 34. |
Sagawa, K.,
W. Swain,
J. Zhang,
E. Unsworth, and
R.P. Siraganian.
1997.
Aggregation of the high affinity IgE receptor results in the tyrosine phosphorylation of the surface adhesion protein PECAM-1 (CD-31).
J. Biol. Chemistry.
272:
13412-13418
|
| 35. |
Sieber, F., and
S. Roseman.
1981.
Quantitative analysis of intercellular adhesive
specificity in freshly explanted and cultured cells.
J. Cell Biol.
90:
55-62
|
| 36. | Songyang, Z., S.E. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W.G. Haser, F. King, T. Roberts, S. Rafnofsky, R.J. Lechleider, et al . 1993. SH2 domains recognize specific phosphopeptide sequences. Cell. 72: 767-778 [Medline]. |
| 37. |
Sun, J.,
J.H. Williams,
H.C. Yan,
S.M. Albelda, and
H.M. DeLisser.
1996.
PECAM-1 homophilic adhesion is mediated by Ig-like domains 1 and 2 and depends on the cytoplasmic domain and the level of surface expression.
J. Biol.
Chem.
271:
18561-18570
|
| 38. |
Tanaka, Y.,
S.M. Albelda,
K.J. Horgan,
G.A. van Seventer,
Y. Shimizu,
W. Newman,
J. Hallam,
P.J. Newman,
C.A. Buck, and
S. Shaw.
1992.
CD31 expressed on distinctive T cell subsets is a preferential amplifier of 1 integrin-mediated adhesion.
J. Exp. Med.
176:
245-253
|
| 39. |
Vaporciyan, A.A.,
H.M. DeLisser,
H.C Yan,
I.I. Mendiguren,
S.R. Thom,
M.L. Jones,
P.A. Ward, and
S.M. Albelda.
1993.
Involvement of platelet-endothelial cell adhesion molecule-1 in neutrophil recruitment in vivo.
Science
(Wash. DC).
262:
1580-1582
|
| 40. |
Watt, S.M.,
J. Williamson,
H. Genevier,
J. Fawcett,
D.L. Simmons,
A. Hatzfeld,
S.A. Nesbitt, and
D.R. Coombe.
1993.
The heparin binding PECAM-1 adhesion molecule is expressed by CD34+ hematopoietic precursor cells with
early myeloid and B-lymphoid cell phenotypes.
Blood.
82:
2649-2663
|
| 41. |
Yan, H.C.,
H.S. Baldwin,
J. Sun,
C.A. Buck,
S.M. Albelda, and
H.M. DeLisser.
1995.
Alternative splicing of a specific cytoplasmic exon alters the binding
characteristics of murine platelet/endothelial cell adhesion molecule-1 (PECAM-1).
J. Biol. Chem.
270:
23672-23680
|
| 42. |
Zehnder, J.L.,
K. Hirai,
M. Shatski,
J.L. McGregor,
L.J. Levitt, and
L.L.K. Leung.
1992.
The cell adhesion molecule CD31 is phosphorylated after cell activation.
J. Biol. Chem.
267:
5243-5249
|
This article has been cited by other articles: