|
||
Gene Families


* Howard Hughes Medical Institute and Department of Pharmacology, University of Washington, School of Medicine, Seattle,
Washington 98195; and
Institute of Neuroscience, University of Oregon, Eugene, Oregon 97403
We have examined whether the development of embryonic muscle fiber type is regulated by
competing influences between Hedgehog and TGF-
signals, as previously shown for development of neuronal cell identity in the neural tube. We found that ectopic expression of Hedgehogs or inhibition of protein
kinase A in zebrafish embryos induces slow muscle precursors throughout the somite but muscle pioneer cells
only in the middle of the somite. Ectopic expression in
the notochord of Dorsalin-1, a member of the TGF-
superfamily, inhibits the formation of muscle pioneer
cells, demonstrating that TGF-
signals can antagonize
the induction of muscle pioneer cells by Hedgehog. We
propose that a Hedgehog signal first induces the formation of slow muscle precursor cells, and subsequent
Hedgehog and TGF-
signals exert competing positive
and negative influences on the development of muscle
pioneer cells.
DURING vertebrate embryogenesis, the paraxial mesoderm gives rise to somites, which are paired
blocks of mesoderm that lie adjacent to the notochord and neural tube. As somites mature, they become
subdivided, with cells in different regions of the somite developing into different cell types, sclerotome, myotome, and dermatome. The differentiation of the somite into
specific cell types is under the influence of inductive signals from surrounding tissues, such as notochord, neural
tube, and the surface ectoderm (for review, see Hauschka,
1994 A variety of extracellular signaling molecules, including
members of hedgehog (Fan and Tessier-Lavigne, 1994 Vertebrate skeletal muscle contains muscle fibers of
several types, which can be broadly classified as slow or
fast fibers on the basis of differences in contraction speeds,
metabolic activities, and motoneuron innervation. The
earliest developing embryonic muscle fibers have intrinsic
fiber type properties (Butler et al., 1982 We have examined the potential roles of members of
the hedgehog and TGF- Animals
Embryos were staged by hours (h) after fertilization at 28.5°C (Kimmel et
al., 1995 Plasmid Constructions
pCS-twhh- pCS-twhh- pCS-twhh-bGFP.
The reporter gene, "bright" green fluorescent protein
(bGFP) with a serine 65 to threonine mutation (Heim et al., 1995 pCS-twhh-dsl-1myc.
dorsalin-1 cDNA was amplified from 9-d chick embryos by reverse transcriptase PCR using primers based on the published
chick dsl-1 DNA sequence (Basler et al., 1993 pT7TSshh, pT7TStwhh, pT7TS-X-shhfs, pCS2+dnPKA-GFP, and
pSP64T-PKA*.
Plasmid pT7TSshh and pT7TStwhh contain the zebrafish
shh and twhh cDNAs, respectively (Ekker et al., 1995b In Vitro mRNA Synthesis
shh and twhh RNAs were transcribed from DNA plasmid T7TSshh or
T7TStwhh as described (Ekker et al., 1995b Microinjection
For DNA microinjection, linearized DNA was dissolved in distilled H2O
to a final concentration of 50 µg/ml. For mRNA injection, mRNA was dissolved in distilled H2O to a final concentration of 100 µg/ml. A final concentration of 0.1% phenol red was added to the DNA or RNA solution to
facilitate visualization during microinjection. Approximately 2 nl of DNA
or RNA solution was microinjected into the cytoplasm of zebrafish embryos at the one- or two-cell stage.
Antibody Labeling
For antibody labeling, embryos were fixed in 4% paraformaldehyde in 1×
PBS for 2 h at room temperature. Embryos were washed twice for 5 min
in 1× PBS and once for 5 min in water. Embryos were then soaked in cold
acetone for 10 min at Immunofluorescent labeling of sections with the F59 and 4D9 monoclonal antibodies was done as previously described (Crow and Stockdale,
1986 Zebrafish Muscle Fiber Type Development
Three distinct types of embryonic muscle fibers can be
identified in zebrafish based on position, gene expression,
and pattern of immunoreactivity with several monoclonal
antibodies. Their development is summarized in Fig. 1.
Slow muscle precursors, known as adaxial cells, develop
adjacent to the notochord and then migrate radially
through the somite to become a monolayer of muscle cells on the surface of the myotome (Devoto et al., 1996b
Ectopic Expression of hedgehogs Induces Extra Slow
Muscle Cells
Previous studies have shown that ectopic expression of
Hedgehog induces MyoD and supernumerary muscle pioneer cells, suggesting that it may play an important role in
muscle development in zebrafish (Currie and Ingham,
1996
Hedgehog Signaling Is Required for Slow
Muscle Development
Protein kinase A (PKA) is an integral part of the Hedgehog signaling pathway (for review see Perrimon, 1995
Ectopic Expression of Dorsalin-1 in the Notochord
Inhibits Muscle Pioneer Development
Interestingly, we observed that the ectopic muscle pioneer
cells induced by Hedgehogs appeared only in the region of
the somite nearest the notochord; ectopic muscle pioneers
were absent in the dorsal or ventral thirds of the somite.
Because Hedgehogs were active in the induction of non-
muscle pioneer slow muscle cells in these regions, this suggested that inhibitory signals from tissues near these regions may antagonize the activity of Hedgehogs.
Competition between BMP4 expressed in the dorsal
neural tube and Sonic hedgehog expressed in the ventral
neural tube has been shown to play an important role in
dorsoventral patterning of the spinal cord (Basler et al.,
1993 In initial experiments, we found that injection of Dorsalin-1 mRNA had a severe ventralizing effect during gastrulation, similar to that caused by injection of BMP4 mRNA
(Hammerschmidt, et al., 1996b). Thus, to assess potential
later effects on somite patterning, we expressed Dorsalin-1
in the notochord after gastrulation. Additionally, expression of Dorsalin-1 in the notochord localized the protein to the region of the somites, where we anticipated the lowest activity of the putative inhibitor of Hedgehog signaling.
To express a potential inhibitor specifically in this region
of the somites, we put dorsalin-1 under the control of a
promoter from the tiggy-winkle hedgehog gene. The floor
plate normally expresses Tiggy-winkle hedgehog. Paradoxically, we found that 5.2 kb of the 5
Embryos injected with the dorsalin-1 DNA construct
(twhh-dsl-1myc) developed with apparently normal anteroposterior and dorsoventral axes. As expected, the tiggy-winkle hedgehog promoter drove expression of Dorsalin-1
specifically in notochord cells (Fig. 4B, arrowheads), consistent with the expression pattern of the Notochord Expression of Dorsalin-1 Fails to Block the
Development of Non-muscle Pioneer Slow Muscle Cells
Muscle pioneers are derived from a subset of slow muscle
precursor cells, whereas most of the precursor cells develop into non-muscle pioneer slow muscle cells (Devoto
et al., 1996b
Expression of Dorsalin-1 in Notochord Blocks Muscle
Pioneer Cell Induction by Hedgehogs
These results demonstrate that Hedgehogs can induce
slow muscle cells, including both muscle pioneers and
non-muscle pioneer slow muscle cells, and that Dorsalin-1
can specifically inhibit the development of muscle pioneer
cells. Dorsalin-1 could act by inhibiting the expression of
hedgehog genes in the notochord, or by antagonizing
Hedgehog protein activity. If Dorsalin-1 represses expression of hedgehog genes, then overexpression of Hedgehog should overcome the inhibitory effect of Dorsalin-1 on
muscle pioneer formation. We tested this prediction by
coinjecting Hedgehog RNAs with twhh-dsl-1myc DNA and
analyzing the injected embryos by double labeling with anti-myc antibody (labeling myc-tagged Dorsalin-1) and
with the 4D9 antibody (labeling muscle pioneer cells).
Compared to embryos injected with control RNA (Fig. 6
A), the expression of Dorsalin-1 in the notochord (Fig. 6
C, arrowhead) inhibited development of muscle pioneers
in adjacent somites (Fig. 6 C, bracket), regardless of
whether embryos were coinjected with RNA encoding
Tiggy-winkle hedgehog (100%, n = 65; not shown) or
Sonic hedgehog (100%, n = 43). In contrast, induction of
muscle pioneers by Hedgehogs was unaffected in embryos
coinjected with Sonic hedgehog RNA and the control
DNA construct twhh-bGFP (Fig. 6 B). These data suggest that Dorsalin-1 blocks the differentiation of slow muscle
precursor cells into muscle pioneer cells by antagonizing
the activity of Hedgehogs rather than by simply inhibiting
their expression.
Dorsalin-1 Likely Acts Downstream of PKA in Muscle
Pioneer Development
As discussed above, Hedgehog signaling is mediated by inhibition of PKA activity (for review see Perrimon, 1995
To learn whether Dorsalin-1 can antagonize the ability
of dnPKA to induce both muscle pioneer cells and non-
muscle pioneer slow muscle cells, we coinjected dnPKA
RNA and twhh-dsl-1myc DNA into zebrafish embryos and
labeled serial sections or whole-mount embryos with the
4D9 antibody (to detect muscle pioneer cells) or with the
F59 antibody (to detect all slow muscle cells). We found
that Dorsalin-1 inhibited muscle pioneer induction by dnPKA (100%, n = 84; Fig. 7 F compared to E, and Fig. 7 I
compared to H; arrowhead in I indicates Dorsalin-1-expressing cell). This result suggests that the inhibitory effect of
Dorsalin-1 on muscle pioneers is downstream of PKA activity. In contrast, induction of non-muscle pioneer slow
muscle cells by dnPKA was apparently unaffected by Dorsalin-1 (Fig. 7 C compared to B). In many dnPKA/twhh-dsl-1myc coinjected embryos, the entire somite was transformed into slow muscle cells, even in regions where there
were no muscle pioneers because of the action of Dorsalin-1. This is consistent with the results obtained in embryos injected with the twhh-dsl-1myc DNA construct alone
(Fig. 5). Dorsalin-1 apparently affected only the muscle pioneer population of slow muscle cells. These data confirm
that the inhibitory effect of Dorsalin-1 on formation of
slow muscle cells is specific for muscle pioneer cells. Together, these data suggest that Hedgehog signaling induces
slow muscle cells and that BMP-like signaling is involved
in the specification of distinct slow muscle cell identities.
We have investigated the mechanisms regulating the induction and differentiation of slow muscle fibers in zebrafish. Our results suggest that Hedgehog signals are involved in the initial induction of slow muscle precursor
cells, whereas the subsequent differentiation of these precursors into distinct types of embryonic slow muscle cells
may involve an inhibitory TGF- Induction of Slow Muscle by Hedgehogs
We have shown that ectopic expression of members of the
hedgehog gene family during early zebrafish development
induces extra slow muscle cells, suggesting that Hedgehog
signaling participates in the establishment of slow muscle
cell identity. This is further supported by our observation
that inhibition of PKA, likely to occur during Hedgehog
signaling, mimics the activity of Hedgehog in slow muscle
induction and that constitutive activation of PKA blocks
the development of slow muscle cells. Several observations support the hypothesis that one or more Hedgehogs
are the endogenous factors that induce the formation of
slow muscle precursors during normal development. First,
slow muscle precursors develop adjacent to the notochord,
becoming apparent after notochord precursor cells begin
to express hedgehog genes (Krauss et al., 1993 Muscle Pioneer Induction
We found that ectopic expression of either Sonic hedgehog or Tiggy-winkle hedgehog induced ectopic muscle pioneer cells. Our data differ from a previous report that ectopic expression of Sonic hedgehog was unable to induce
muscle pioneers, unless another member of the Hedgehog
family, Echidna hedgehog, was coexpressed (Currie and
Ingham, 1996 We propose that early signaling by Hedgehogs is sufficient to trigger the development of slow muscle identity,
but that muscle pioneer development requires additional
later exposure to Hedgehogs (Fig. 8 A). This hypothesis is
supported by the following observations. First, slow muscle precursors are distinct from the other presomitic cells
before muscle pioneers become distinct from the other
slow muscle precursors. Second, injection of Hedgehog
RNA was consistently more effective at inducing non-
muscle pioneer slow muscle cells than muscle pioneer
cells. Third, hedgehog RNA injection induces muscle pioneers more effectively in anterior somites than in posterior somites of the embryo (data not shown). If the injected
hedgehog RNA is degraded over time, then there would
consistently be more ectopic hedgehog early in development (in anterior somites) than there would be later in development (in posterior somites). Finally, in several mutants (no tail, floating head), Hedgehog expression becomes
progressively reduced, relative to wild-type embryos, as
development proceeds. In these mutants, muscle pioneers
are missing, whereas other slow muscle cells develop relatively normally, especially in the earlier developing anterior somites (Devoto et al., 1996a
A BMP-like Inhibitory Signal Opposing the Action of
Hedgehogs on Muscle Pioneer Cells
During normal zebrafish embryogenesis, slow muscle precursor cells that move dorsally and ventrally in the somite
develop into non-muscle pioneer slow muscle cells. Although ectopic expression of Hedgehogs and dnPKA induces ectopic non-muscle pioneer slow muscle cells
throughout the somite, neither induces ectopic muscle pioneers in the dorsal or ventral thirds of the somite. We
showed that expression in the notochord of dorsalin-1, a
BMP4-like gene normally expressed in the neural tube
(Basler et al., 1993 We have shown that when it is expressed in the notochord, Dorsalin-1 has a specific effect on muscle pioneer
identity and does not affect the differentiation of non-
muscle pioneer slow muscle fibers. Several studies have
suggested that BMPs have a limited range of diffusion,
raising the question of whether non-muscle pioneer cells
are also exposed to Dorsalin-1 protein when it is expressed
in the notochord. We think that the specificity of Dorsalin-1 action on muscle pioneer cells but not on the non-muscle pioneer cells due to a difference in the exposure to
Dorsalin-1 is unlikely for several reasons. First, Dorsalin-1
was expressed in the notochord just before the migration
of adaxial cells away from the notochord, and thus all slow
muscle precursors would be exposed to Dorsalin-1 (data
not shown). Second, in the case of dominant negative
PKA and Dorsalin-1 coinjection, non-muscle pioneer slow
muscle cells were induced in the region adjacent to the notochord cells expressing Dorsalin-1, whereas muscle pioneer cells were inhibited in this region (compare Fig. 7, C
with F), suggesting that the lack of effect on non-muscle
pioneer cells is unlikely the result of a limited range of
Dorsalin-1 action.
It is likely that slow muscle identity is established earlier
than muscle pioneer cell identity. Slow muscle precursors
are morphologically and molecularly distinct at the end of
gastrulation (Devoto, et al., 1996b; Weinberg, et al., 1996),
whereas muscle pioneers are not identifiably separate
from the other slow muscle precursors until the time of
somite formation, when they express engrailed genes and
develop their distinctive morphology (Felsenfeld et al.,
1991 twhh Promoter
In this study, we showed that the 5.2-kb twhh promoter
could drive expression of heterologous cDNAs specifically
in the notochord. This notochord specificity was unexpected considering that the endogenous twhh gene is exclusively expressed in the floor plate. It is possible that the
5.2-kb twhh promoter we isolated and used may lack a repressor sequence present in the twhh gene that inhibits the
notochord expression of the twhh gene. Our results highlight the power of using tissue-specific promoters to direct
expression of proteins to specific tissue types, at specific
times, in the zebrafish embryo. This will be generally useful for analyzing later functions of genes that also have
functions during gastrulation (see also Kroll and Amaya,
1996 Model
Based on our results and studies by other laboratories, we
propose that the differentiation of slow muscle cells in zebrafish is regulated by at least two signals, Hedgehogs and
BMP-like proteins (Fig. 8). During early stages of development, Hedgehogs secreted from midline cells induce
paraxial mesodermal cells to become adaxial cells, the precursors of slow muscle. We propose that this early exposure to Hedgehogs is sufficient to signal the development of non-muscle pioneer slow muscle cells; however, it is insufficient for the development of muscle pioneer cells. Differentiation of muscle pioneers requires prolonged exposure to the inductive Hedgehog signals, and minimal
exposure to an inhibitory BMP-like signal. In the dorsal
and ventral regions of the somite, an inhibitory BMP4-like
signal blocks the response to Hedgehog, whereas in the middle region of the somite, this inhibitory BMP-like activity is absent or very low and consequently restricts the
development of muscle pioneer cells to the middle region
of the somite. The mechanism for setting up this low BMP-like activity in the middle region of the somite is unknown.
One possibility is an uneven distribution of the BMPs and
BMP-like protein within the somite. The dorsal and ventral regions are exposed to a high concentration of the
BMP-like protein, while the middle region is exposed to a
low concentration of BMP-like protein. Evidence supporting this hypothesis comes from studies of mediolateral patterning of the chick somite. In chick embryos, the lateral
part of the somite is exposed to a high concentration of
BMP4 expressed in the lateral plate mesoderm (Pourquié
et al., 1996 Our model is similar to that proposed for the dorsoventral patterning of the spinal cord (Liem et al., 1995
; Christ and Ordahl, 1995
).
;
Johnson et al., 1994
), Wnt (Munsterberg et al., 1995
), and
TGF-
(Pourquié et al., 1996
) gene families, have been implicated in patterning the somite. Ventral midline tissues
express Sonic hedgehog, which plays a critical role in sclerotome and myotome induction (Fan and Tessier-Lavigne,
1994
; Johnson et al., 1994
). Wnts, which are expressed in
the neural tube, act in combination with Hedgehog to induce myogenesis in vitro (Munsterberg et al., 1995
). Lateral plate mesoderm in chick embryos expresses BMP4, a
TGF-
gene family member that is a candidate for inducing the differentiation of the lateral myogenic precursors
in the somite, which give rise to the muscles of the limbs
and body wall (Pourquié et al., 1996
). This effect of BMP4
is opposed by an unknown diffusible factor expressed in
the neural tube (Pourquié et al., 1996
).
; Thornell et al.,
1984
; Crow and Stockdale, 1986
; Harris et al., 1989
; Fredette and Landmesser, 1991a
,b; Hughes et al., 1993
; Devoto et al., 1996b
). Transplantation experiments and in vitro clonal analyses have demonstrated that these early
myoblasts are committed to form particular fiber types
(Miller and Stockdale, 1986a
,b; Van Swearingen and
Lance-Jones, 1995
). However, the factors that regulate the
embryonic development of myogenic precursor cell identity are still unknown.
gene families in the development of different muscle fiber types in zebrafish. We provide evidence that slow muscle cells are induced by
Hedgehogs, and that this induction is likely due to respecification of fast muscle precursor cells into slow muscle
cells. We also show that ectopic expression of Hedgehogs induces supernumerary muscle pioneer cells. This induction of muscle pioneers is repressed by ectopic expression
in the notochord of Dorsalin-1, a BMP4-related protein.
Our data suggest that members of the hedgehog and TGF-
gene families play opposing roles in patterning the developing somite.
MATERIALS AND METHODS
; available at World Wide Web address http://zfish.uoregon.edu). Chorions were removed with watchmaker's forceps, and embryos were maintained in Ringer's solution (Westerfield, 1995
). Older embryos were
anesthetized in a 0.6 mM solution of tricaine (Sigma Chemical Co., St.
Louis, MO) to inhibit movement during observation.
-gal.
To link the tiggy-winkle hedgehog (twhh)1 promoter to
the gene encoding nuclear
-galactosidase (n
-gal), plasmid pGEM-7Z-twhh5.5 containing a 5.5-kb genomic fragment of the twhh gene (Ekker et al., 1995b
) was digested with SacI and BamHI and then deleted at
the 3
end of the promoter to position
49 with respect to the ATG translation start codon by EXO-III nuclease using an Erase-a-Base kit
(Promega Corp., Madison, WI). The resulting plasmid, pGEM-7Z- twhh5.2, containing the 5.2-kb twhh promoter, was partially digested with
BstXI and EcoRI to release the DNA insert. The EcoRI site at the 5
end
of the insert was then blunted by Klenow DNA polymerase and subcloned
into the pBluescript-SK BstXI site that had been partially blunted by T4
DNA polymerase. The resulting plasmid, pBluescript-SK-twhh5.2, was digested with SacI and then blunted by T4 DNA polymerase. This linearized plasmid, pBluescript-SK-twhh5.2, was subsequently digested with
SalI. The DNA insert containing the 5.2-kb twhh promoter sequence was
purified and cloned into plasmid pCS-n
-gal (a gift from D. Turner, R. Rupp, J. Lee, and H. Weintraub, Fred Hutchinson Cancer Research Center, Seattle, WA) at the SalI and HindIII sites, the latter site having been blunted by Klenow DNA polymerase. The resulting plasmid, pCS-twhh-
-gal, contains the 5.2-kb twhh promoter and the nuclear
-gal reporter gene.
-gal-vec.
To make the twhh promoter into a convenient expression vector for expressing heterologous cDNAs, the BamHI site upstream of the twhh promoter in the plasmid pCS-twhh-
-gal was deleted.
The resulting plasmid, which retains the BamHI site between the promoter and the
-gal, was isolated and designated pCS-twhh-
-gal-vec. Genes of interest can be cloned into the BamHI and XhoI sites of this vector by replacing the
-gal sequence.
), was cloned into vector pCS-twhh-
-gal-vec BamHI/XhoI sites by blunt end ligation. The resulting plasmid was named pCS-twhh-bGFP.
). The sequences for the 5
and 3
PCR primers were 5
CTCTGTCTGTAAAGATTCAAC 3
and 5
GTACAGTTTCACAGACAGCAG 3
, respectively. The PCR product
was subcloned into the pCR-II vector (Invitrogen, San Diego, CA). The
c-myc-tagged derivative (dsl-1myc) was constructed as previously described (Basler et al., 1993
), with all subcloning steps carried out in the
pCR-II vector. To place dsl-1myc after the twhh promoter, the DNA insert
of dsl-1myc was first subcloned into the EcoRI site of expression vector pCS2+ (a gift from D. Turner, R. Rupp, J. Lee, and H. Weintraub), which has a cytomegalovirus promoter and a polyadenylation site. The resulting
plasmids were named pCS2+-dsl-1myc. To link dsl-1myc to the twhh promoter, the dsl-1myc insert was released from pCS2+-dsl-1myc by BamHI and
XhoI digestion and then subcloned into pCS-twhh-
-gal-vec BamHI and
XhoI sites by replacing the
-gal sequence. The final construct, pCS-twhh-dsl-1myc, contains the 5.2-kb twhh promoter and dsl-1myc.
); plasmid pT7TS-X-shhfs contains the Xenopus shh with a single base pair insertion, resulting in a frame shift in amino acid position No. 39 (Ekker et al., 1995a
).
Plasmid pCS2+dnPKA-GFP contains the dominant negative form of PKA
regulatory subunit (Ungar and Moon, 1996
). Plasmid pSP64T-PKA* contains the constitutively active PKA catalytic subunit (Hammerschmidt et al., 1996a
).
). Capped mRNAs were transcribed from linearized DNA template with a T7 RNA polymerase in
vitro transcription kit (mMESSAGE mMACHINE T7, Ambion, Inc., Austin, TX) according to the manufacturer's instructions.
-Gal Labeling
-Gal labeling was carried out with minor modification of published procedures (Westerfield et al., 1992
). Embryos were fixed for 30 min at room
temperature with rotation, with or without removing the chorion, in 4%
paraformaldehyde, 0.2% glutaraldehyde, 4% sucrose, 0.15 mM CaCl2, and
1× PBS. To visualize
-gal activity, embryos were rinsed twice for 15 min
with PBS containing 0.1% Triton X-100 and then incubated in reaction solution containing 0.04% x-gal (bromo-4-chloro-indoxyl-
-D-galactoside),
1 mM MgCl2, 3.3 mM K4[Fe3(CN)6], and 3.3 mM K3[Fe2(CN)6] at room
temperature for 1-2 h. The reaction was stopped by replacing the substrate solution with PBS.
20°C. Embryos were washed once with water for 5 min, and twice with 1× PBS for 5 min each, and once with BDP (0.1% bovine serum albumin, 1% dimethylsulfoxide, 1× PBS) for 5 min. For labeling using monoclonal antibodies, the embryos were incubated with avidin-blocking reagent (Vector Laboratories, Burlingame, CA) and 10% goat
serum in BDP for 30 min at room temperature. The embryos were then
rinsed twice for 5 min in BDP and subsequently incubated with 1:5 diluted
antiengrailed monoclonal antibody 4D9 (Patel et al., 1989
) and/or 1:500
diluted anti-c-myc monoclonal antibody (Oncogene Science, Cambridge,
MA) together with biotin-blocking reagent (Vector Laboratories) overnight at 4°C with shaking. The embryos were then washed three times for
30 min with BDP, followed by incubation with 1:500 diluted biotin-labeled
secondary antibody (Vector Laboratories) in BDP for 1 h at 37°C. Embryos were then washed three times for 30 min with BDP and incubated
with 1:1 diluted ABC solution (avidin biotin complex) for 30 min at room temperature. Embryos were washed three times for 30 min in BDP and
then presoaked in DAB solution (0.05% diaminobezidine, 1% DMSO,
1× PBS) for 10 min at room temperature. The DAB soaking solution was
then replaced by DAB staining solution containing 0.003% of H2O2 in
DAB soaking solution. The staining was monitored and stopped by washing twice for 10 min with BDP. Embryos were photographed in PBS.
; Devoto et al., 1996b
).
RESULTS
). A
subset of the slow muscle precursors, located at the future
horizontal myoseptum, remain in contact with the notochord and become flattened cells that extend from the notochord to the lateral surface of the myotome (Waterman,
1969
; van Raamsdonk et al., 1974
; Devoto et al., 1996b
).
These cells, called muscle pioneers (Felsenfeld et al.,
1991
), are the only slow muscle precursors to express the
engrailed1 and engrailed2 genes at high levels (Hatta et al., 1991
; Ekker et al., 1992
). Fast muscle precursors, in contrast, develop from lateral presomitic cells and remain
deep within the myotome.
Fig. 1.
Development of
zebrafish muscle fiber types.
(A) Schematic transverse
section through the segmental plate. Adaxial cells (red) are in the segmental plate adjacent to the notochord (N)
and are precursors to both
muscle pioneer slow muscle
cells and non-muscle pioneer
slow muscle cells. Lateral
presomitic cells (white),
which include precursors to
fast muscle cells, are lateral
to the adaxial cells. Arrows indicate that adaxial cells will migrate past the lateral presomitic cells after somite formation. (B) Schematic transverse section through the trunk of a 24 h embryo. The non-muscle pioneer slow muscle cells (red with black outline) have migrated to the surface of the myotome, while the muscle pioneer slow muscle cells (red with green outline) have become flattened cells that contact both the notochord and the lateral surface of the myotome. The fast muscle cells (white) are now deep in the myotome.
[View Larger Version of this Image (25K GIF file)]
; Hammerschmidt et al., 1996a
; Weinberg et al., 1996
).
To examine directly whether hedgehog genes influence the
development of muscle fiber type identity, we expressed
zebrafish sonic hedgehog or tiggy-winkle hedgehog ectopically by injection of RNA into cleavage stage embryos. We
then examined the developing embryos for induction of
slow muscle cells using several monoclonal antibodies that
recognize the entire population of slow muscle cells, including the muscle pioneers. F59 recognizes myosin heavy chain in fish (Miller et al., 1989
); in zebrafish it specifically labels slow muscle fibers during the first day of development, and then later it also weakly labels fast muscle fibers
(Devoto et al., 1996b
). We also used zn5 (Trevarrow et al.,
1990
) and S58 (Crow and Stockdale, 1986
) antibodies that
also label slow but never label fast muscle fibers in zebrafish (Devoto et al., 1996b
). We found that both Sonic
hedgehog and Tiggy-winkle hedgehog induced the development of many extra slow muscle cells. Specifically, as in
uninjected embryos, only one layer of slow muscle cells was present in the superficial layer of the somite in control embryos injected with frame-shifted sonic hedgehog RNA
(Fig. 2 A), whereas in embryos injected with sonic hedgehog (Fig. 2 B) or tiggy-winkle hedgehog (Fig. 2 C) RNA,
almost all cells in the somite differentiated into slow muscle. These ectopic slow muscle cells were also labeled by
the S58 and zn5 antibodies, indicating that these cells had
fully differentiated as slow muscle fibers (data not shown).
Presumably, these extra slow muscle cells are formed at
the expense of fast muscle because they occupy the locations where fast muscle cells normally form, and because
nearly all the muscle cells in the somite exhibited these
slow muscle properties. Both Sonic hedgehog (Fig. 2, E
and H) and Tiggy-winkle hedgehog (Fig. 2, F and I) also
induced extra muscle pioneer cells, as determined by labeling with the anti-engrailed monoclonal antibody, 4D9.
In control embryos injected with frame-shifted sonic
hedgehog, two to six muscle pioneer cells were normally
present in each somite (Fig. 2, D and G) as in uninjected
embryos, whereas Sonic hedgehog induced an average of
20 muscle pioneer cells per somite (88%, n = 87; Fig. 2, E
and H), and Tiggy-winkle hedgehog induced an average of
10 muscle pioneer cells per somite (75%, n = 105; Fig. 2, F
and I).
Fig. 2.
Induction of slow muscle cells by zebrafish Sonic hedgehog (Shh) and Tiggy-winkle hedgehog (Twhh). (A, B, and C) Sections (dorsal to the top) showing fluorescence localization of slow muscle cells labeled with F59, an anti-myosin heavy chain antibody, in embryos injected with frame shifted sonic hedgehog (Shhfs) (A), Shh (B), or Twhh (C). (D, E, and F) Sections (dorsal to the top) showing
fluorescence localization of muscle pioneer cells labeled with 4D9, an anti-engrailed antibody, in embryos injected with Shhfs (D), Shh
(E), or Twhh (F). (G, H, and I) Whole-mount Nomarski images showing muscle pioneer cells labeled with the 4D9 antibody in embryos
injected with Shhfs (G), Shh (H), or Twhh (I). Embryos in G, H, and I are oriented in side views, with anterior to the left and dorsal to
the top. Bars, 50 µm.
[View Larger Version of this Image (77K GIF file)]
).
PKA constitutively represses Hedgehog target genes, and
Hedgehog acts to relieve this repression. Thus, expression
of a dominant negative isoform of PKA mimics Hedgehog
signaling in both Drosophila (Jiang and Struhl, 1995
; Li et
al., 1995
; Pan and Rubin, 1995
) and in vertebrates (Fan et
al., 1995
; Hammerschmidt et al., 1996a
; Ungar and Moon, 1996
). Our results (Fig. 2) suggested that Hedgehog is sufficient to trigger slow muscle development. To test
whether Hedgehog signaling is required for slow muscle
development, we ectopically expressed the constitutively
active PKA isoform (Orellana and McKnight, 1992). Compared with control embryos (Fig. 3 A), slow muscle cells labeled with F59 antibody appeared to be absent in embryos injected with RNA encoding the constitutively active isoform of PKA (Fig. 3 B). Frequently, injected RNAs
are localized to one region of the embryo (Hammerschmidt et al., 1996a
). Consistent with this, transverse sections through control (Fig. 3 C) and active PKA-injected embryos demonstrated a local loss of slow muscle cells in
the active PKA injected embryos (Fig. 3 D). Together with
the Hedgehog ectopic expression data (Fig. 2), this result
suggests that Hedgehog signaling is required for the development of all slow muscle cells, including muscle pioneer
cells (Hammerschmidt et al., 1996a
, and data not shown).
Fig. 3.
Inhibition of slow muscle
cells by a constitutively active isoform of PKA. (A) Whole-mount
Nomarski images showing slow
muscle cells labeled with the F59
antibody in a representative control embryo. (B) Whole-mount Nomarski images showing slow muscle
cells labeled with the F59 antibody
in a representative embryo injected with a constitutively active form of
PKA. (C) Section (dorsal to the
top) showing localization of slow
muscle cells labeled with F59 in a
control embryo. (D) Sections (dorsal to the top) showing local loss of
slow muscle cells in an embryo injected with a constitutively active
form of PKA.
[View Larger Version of this Image (95K GIF file)]
; Liem et al., 1995
). Somite patterning may also be
regulated by competing positive and negative signals, including BMP4 (Fan and Tessier-Lavigne, 1994
; Pourquié et al., 1996
). To learn whether a BMP4-like protein can affect the development of muscle cell identity in zebrafish,
we tested whether ectopic expression of Dorsalin-1, a
BMP4-like factor, would inhibit the formation of muscle
pioneer cells in surrounding somites. We used the chick
Dorsalin-1 in this study for several reasons. First, the dorsal neural tube (Basler et al., 1993
), a tissue known to play
a role in somite patterning (Lassar and Munsterberg, 1996
;
Pourquié, et al., 1996), expresses Dorsalin-1. Second, Dorsalin-1 can antagonize Hedgehog signaling in the dorsoventral patterning of the neural tube (Basler et al., 1993
;
Liem et al., 1995
). Third, at the time we initiated this
study, no gene encoding BMP or a BMP-like protein expressed in the neural tube had been isolated from zebrafish. More recently, a BMP-like gene named radar was
reported in zebrafish; however, this clone contains only
the partial coding region (Rissi et al., 1995
).
-flanking sequence
from the tiggy-winkle hedgehog gene leads to expression of heterologous proteins, including
-galactosidase, specifically in the notochord (Fig. 4 A; a further characterization
of this promoter is in progress). Thus, we used this promoter fragment to express Dorsalin-1 in the notochord.
Fig. 4.
Dorsalin-1 blocks the development of muscle pioneer cells.
(A)
-gal expression in embryos injected with twhh-
-gal was monitored by enzyme activity and Nomarski microscopy at early pharyngula stage
(~24 h). At this stage, the expression
of
-galactosidase was notochord
specific in >90% (n = 120) of the injected embryos that expressed the
construct. We first detected
-galactosidase expression in the early segmentation stage (~12 h), specifically in notochord cells of injected embryos (84%, n = 57, data not shown).
(B) Immunolocalization with anti-
c-myc antibody in embryos injected
with the DNA construct twhh-dsl-1myc. The twhh promoter drives expression of dsl-1myc in notochord cells
(arrowheads). (C and D) Double labeling with anti-c-myc antibody and anti-engrailed antibody, 4D9, in embryos injected with either the DNA construct twhh-bGFP (C)
or twhh-dsl-1myc (D). The bracket in D marks the region affected by Dorsalin-1. The dsl-1myc expressing notochord cells in D are indicated by the arrowheads. Muscle pioneer cells in C and D are indicated by arrows. Cells in only some regions of the embryos expressed
the transgenes (B and D, arrowheads), consistent with the mosaic expression of other injected DNAs (Westerfield et al., 1992
). In 93%
(n = 54) of the embryos lacking muscle pioneer cells in some of their somites, nearby notochord cells expressed Dorsalin-1. Embryos
are oriented in side views, with anterior to the left and dorsal to the top. Bar, 50 µm.
[View Larger Version of this Image (82K GIF file)]
-gal reporter
gene under control of the same promoter (Fig. 4A). To analyze whether Dorsalin-1 has an inhibitory effect on the
development of muscle pioneer cells, we examined embryos injected with the twhh-dsl-1myc for differentiation of
muscle pioneer cells labeled with the 4D9 antibody. As
shown by the bracket in Fig. 4 D, muscle pioneer cells (arrows) were absent in the somites adjacent to notochord cells expressing the twhh-dsl-1myc construct. In contrast,
muscle pioneer cells developed normally in embryos injected with the control construct, twhh-bGFP (Fig. 4 C, arrows). A single Dorsalin-1-expressing cell in the notochord was able to inhibit the formation of muscle pioneer
cells in the flanking two to four somites. Usually there
were more somites affected rostral than caudal to the Dorsalin-1-expressing notochord cell (data not shown). This is
probably because notochord cells shift caudally relative to
the somites, from about 12 h to at least 48 h (Devoto, S.H.,
and M. Westerfield, in preparation). This correlation between Dorsalin-1 expression in the notochord and the absence of muscle pioneer cells in adjacent somites indicates that the differentiation of muscle pioneer cells can be
blocked by a BMP-like signal, establishing a BMP-like
molecule as a viable candidate for an inhibitory signal that
prevents muscle pioneer differentiation in the dorsal and
ventral regions of the somite.
). To learn whether ectopic expression of Dorsalin-1 in the notochord inhibits the development of muscle pioneer cells specifically or whether non-muscle pioneer slow muscle cells are also affected, we injected
embryos with twhh-dsl-1myc DNA and labeled with the F59
antibody, which recognizes all of the slow muscle cells
(Fig. 1; Devoto et al., 1996b
). As shown by the bracket in
Fig. 5 A, there was a gap in F59 labeling in the middle of
some of the somites in embryos injected with twhh-dsl-1myc. Transverse sections through unaffected regions (Fig.
5 B) and affected regions (Fig. 5 C) demonstrated that this
gap in labeling is a result of the absence of the muscle pioneer population of slow muscle cells, which are normally
located adjacent to the notochord (Fig. 5 B, arrows). In
contrast, the dorsal and ventral populations of slow muscle
cells (the non-muscle pioneer slow muscle cells; Fig. 5, B
and C, arrowheads) are apparently unaffected by Dorsalin-1. These data demonstrate that notochord expression of Dorsalin-1 specifically interferes with the development
of muscle pioneer cell identity and does not affect the development of the non-muscle pioneer slow muscle cells
from adaxial cells.
Fig. 5.
Dorsalin-1 specifically affects the development of muscle pioneer cells but not the non-muscle pioneer slow muscle
cells. (A) Whole-mount staining of embryo injected with DNA
construct twhh-dsl-1myc using F59 to monitor slow muscle cells.
The bracket marks the region affected by Dorsalin-1. (B) Section
through an unaffected region with both muscle pioneer cells (arrows) and non-muscle pioneer slow muscle cells (arrowhead) labeled with F59. (C) Section through an affected region with normal non-muscle pioneer slow muscle cells labeled with F59
antibody (arrowhead) but no muscle pioneer cells. The orientation is anterior to the left (A) and dorsal to the top (A-C). Bars:
(A) 100 µm; (B and C) 50 µm.
[View Larger Version of this Image (141K GIF file)]
Fig. 6.
Ectopic Dorsalin-1 represses muscle pioneer cell induction by Hedgehogs. Embryos were double labeled with anti-myc
antibody to monitor expression of dsl-1myc and with the 4D9 antibody to monitor muscle pioneer cells. (A) Embryos injected with
Shhfs RNA as control. (B) Embryos coinjected with twhh-bGFP
DNA and zebrafish Shh RNA show induction of extra muscle pioneer cells. (C) Embryos coinjected with twhh-dsl-1myc DNA and
zebrafish Shh RNA also show induction of extra muscle pioneer
cells, but not in the region (bracket) near the notochord cell expressing Dorsalin-1 (arrowhead). Embryos are oriented in side
views, with anterior to the left and dorsal to the top. Bar, 50 µm.
[View Larger Version of this Image (94K GIF file)]
).
PKA constitutively represses Hedgehog target genes, and
inhibition of PKA by Hedgehog alleviates this repression.
To test whether blocking PKA activity induces slow muscle cells, we injected RNA encoding a dominant negative
mutant form of the PKA regulatory subunit (dnPKA; Ungar and Moon, 1996
) or frame-shifted Sonic hedgehog as
an injection control and then examined the somites by antibody labeling for muscle pioneer cells and for other slow
muscle cells. dnPKA induced the development of extra
slow muscle cells (94%, n = 102), including both the muscle pioneer (Fig. 7, E and H) and non-muscle pioneer slow
muscle cells (Fig. 7 B). In contrast, injection of frame-shifted sonic hedgehog as a control had no effect on the
development of slow muscle cells (Fig. 7, A, D, and G).
Fig. 7.
dnPKA induces slow muscle cells. (A-C) Sections showing slow muscle cells labeled with F59 in embryos injected with Shhfs (A), dnPKA (B), or dnPKA/twhh-dsl-1myc (C). Extra slow muscle cells are induced in both B and C. (D-F) Sections showing muscle pioneer cells labeled with 4D9 in embryos injected with Shhfs (D), dnPKA (E), or dnPKA/twhh-dsl-1myc (F). Muscle pioneer cells are induced by dnPKA (E) but are repressed by dsl-1 (F). (G-I) Whole-mount labeling with anti-c-myc and 4D9 antibodies in embryos injected with Shhfs (G), dnPKA (H), or dnPKA/twhh-dsl-1myc (I). The bracket in I marks the region affected by Dorsalin-1. The dsl-1myc
expressing cell in I is indicated by the arrowhead. The orientation is dorsal to the top (A-I) and anterior to the left (G-I). Bar, 50 µm.
[View Larger Version of this Image (88K GIF file)]
DISCUSSION
signal. This proposed inhibitory signal antagonizes the Hedgehog activity in dorsal
and ventral regions of the somite. Our data suggest that
opposing actions of hedgehog and TGF-
gene family
members may regulate the differentiation of specific slow
muscle fiber cell types in the zebrafish somite.
; Roelink et
al., 1994
; Currie and Ingham, 1996
; Devoto et al., 1996b
). Second, all slow muscle precursors strongly express the
patched gene, which is induced by Hedgehog signaling
(Concordet et al., 1996
), suggesting that they receive and
respond to Hedgehog. Third, there is a loss of slow muscle
cells in mutants in which Hedgehog signaling is reduced
(Talbot et al., 1995
; Devoto et al., 1996a
; Weinberg et al.,
1996
). Together with the results reported here, these observations provide compelling evidence that Hedgehogs induce slow muscle cells.
). The reason for this discrepancy is unclear,
although the two studies used different plasmids that generate RNAs with different untranslated regions. It is possible that these differences affected the stability or translation of the RNA. Our results are consistent with those
reported by Hammerschmidt et al. (1996a)
, who found
that ectopic expression of either mouse Sonic hedgehog or
Indian hedgehog induced extra muscle pioneer cells in zebrafish embryos.
).
Fig. 8.
Opposing actions of
Hedgehog and BMP4-like proteins regulate slow muscle cell
identity. (A) At the tail bud
stage, paraxial mesoderm cells
are induced by Hedgehog secreted from notochord precursor cells to become adaxial cells,
the slow muscle precursors. A
subset of the adaxial cells located adjacent to the notochord are induced to become muscle
pioneer cells by continued Hedgehog signal from the notochord
cells and floor plate cells. In contrast, other slow muscle precursors migrate to the lateral surface
of the myotome and differentiate into non-muscle pioneer
slow muscle cells. BMP4-like inhibitory signal antagonizes the
hedgehog signals in dorsal and ventral regions of the somite and blocks the induction of muscle pioneer cells in these regions. (B) Schematic illustration of this model in cross section at the tailbud stage (upper embryo, arrow denotes Hedgehog signal), and at the somitogenesis stage (lower embryo, arrow denotes Hedgehog signal and stippling denotes the BMP4-like signal). The distribution of muscle pioneers is determined by the distribution of these competing signals.
[View Larger Version of this Image (24K GIF file)]
), can inhibit the development of muscle
pioneer cells. This suggests that an inhibitory signal such
as Dorsalin-1 might normally prevent the development of
muscle pioneers in the dorsal and ventral portions of the
somite (Fig. 8 B). In addition to inhibitory BMP-like signals originating from the neural tube, other BMP-like factors expressed ventral to the notochord (Rissi et al., 1995
)
and elsewhere (Liem et al., 1995
; Pourquié et al., 1996
) are
candidates for antagonizing Hedgehog signaling.
; Hatta et al., 1991
; Ekker et al., 1992
). Expression of
dorsalin-1 from the twhh promoter begins before the appearance of muscle pioneer identity and before the migration of the slow muscle precursors away from the notochord (data not shown). Thus, all of the slow muscle cells
are likely to be exposed to Dorsalin-1; this suggests that
the development of non-muscle pioneer slow muscle precursors is unaffected by exposure to Dorsalin-1 at this time, perhaps because they are already committed to a
slow muscle fate. We have not tested whether BMP-like
signals acting earlier, during gastrulation, influence the development of non-muscle pioneer slow muscle cells.
).
). BMP4 from this source acts as a diffusible lateralizing signal to specify the hypaxial muscle lineage
(Pourquié et al., 1996
). In zebrafish, several BMPs and
BMP-like proteins have been shown to be expressed in tissues near the somite during segmentation stages. For example, a BMP-like gene, radar, is specifically expressed in
the dorsal neural tube and hypochord cells (Rissi et al.,
1995
), and BMP2 and BMP4 are expressed primarily in
the mesenchyme of dorsal and ventral fins (Nikaido et al.,
1997
). Therefore, it is likely that there is a gradient in the
distribution of BMP and BMP-like proteins within the
somite, with higher concentrations in the dorsal and ventral regions of the somite and lower concentrations in the middle region of the somite. Alternatively, the BMP inhibitory activity might be reduced in the middle region of the
somite (around the notochord) by an opposing signal from
the notochord that blocks the BMP-like activity in this region. Chordin (Piccolo et al., 1996
), Noggin (Zimmerman
et al., 1996
), and Follistatin (Hemmati-Brivaniou et al.,
1994
) can each bind to and inactivate BMPs and other
TGF-
family members, and in Xenopus these genes are
also expressed in the notochord (Smith and Harland, 1992
;
Hemmati-Brivanlou et al., 1994; Sasai et al., 1994
). Thus,
Chordin, Noggin, or Follistatin could repress the BMP-like activity in the notochord region, allowing the development of muscle pioneer cells. Further experiments are required to learn which mechanism is correct, and possibly
both mechanisms are used to establish an uneven distribution of BMP-like inhibition of muscle pioneer development. This BMP4-like signal may also stimulate migration
of adaxial cells toward the surface of the somite, where
they are consequently exposed to a lower concentration of
Hedgehogs. Regardless of the mechanism, this model predicts that these opposing signals determine slow muscle cell identities; adaxial cells that remain near the notochord express engrailed and develop into muscle pioneers, whereas
the adaxial cells in the dorsal and ventral regions of the
somite do not develop into muscle pioneers.
; Ericson et al., 1996
). Sonic hedgehog expressed by the notochord induces ventral cell types, such as floor plate and
motorneurons, whereas BMP4 expressed in the dorsal
neural tube induces dorsal cell types, such as neural crest,
roof plate cells, and dorsal commissural neurons (Liem et
al., 1995
). The activity of Hedgehog and BMP4 are mutually antagonistic; Hedgehog inhibits the responses to BMP4, and BMP4 in turn inhibits the responses to Hedgehog (Liem et al., 1995
). It has been suggested that patterning of the chick somite also involves the opposing actions
of signals from surrounding tissues, including the neural
tube and notochord (Fan and Tessier-Lavigne, 1994
;
Pourquié et al., 1996
). These signals include Sonic hedgehog and BMP4 (Munsterberg et al., 1995
; Pourquié et al.,
1996
). Our results suggest that in addition to regulating the
broad subdivisions of the somite into sclerotome and dermamyotome, the opposing actions of hedgehog and TGF-
gene family members also regulate the development of
embryonic muscle fiber-type identity.
Received for publication 24 April 1997 and in revised form 25 June 1997.
Address all correspondence to Randall T. Moon, Howard Hughes Medical Institute, Box 35370, Room K536C HSB, University of Washington, Seattle, WA 98195. Tel.: (206) 543-1722. Fax: (206) 616-4230. e-mail: rtmoon{at}u.washington.eduWe are indebted to C.B. Kimmel (University of Oregon, Eugene, OR), D. Raible, H. Roelink, and A. Ungar for their comments on the manuscript.
We thank C.S. Goodman (University of California, Berkeley) for the
monoclonal antibody, 4D9, F. Stockdale (Stanford University, Stanford,
CA) for the F59 monoclonal antibody, and D. Turner and R. Rupp for the
CS2+ vector and the cytomegalovirus-n
-gal DNA construct, and A.P. McMahon (Harvard University, Cambridge, MA) for the pSP64T-PKA* construct. We thank Michele McDowell and Ruth BreMiller for help with
histology, and the members of our laboratories for their helpful discussions.
This work was supported by Public Health Services Grants HD29360, HD22486, and NS21132. R.T. Moon is an investigator of the Howard Hughes Medical Institute.
-gal,
-galactosidase;
bGFP, bright
green fluorescence protein;
PKA, protein kinase A;
twhh, tiggy-winkle
hedgehog..
| 1. | Basler, K., T. Edlund, T.M. Jessell, and T. Yamada. 1993. Control of cell pattern in the neural tube: regulation of cell differentiation by dorsalin-1, a
novel TGF family member. Cell. 73:687-702.
|
| 2. | Butler, J., E. Cosmos, and J. Brierley. 1982. Differentiation of muscle fiber types in aneurogenic brachial muscles of the chick embryo. J. Exp. Zool. 224: 65-80 [Medline]. |
| 3. | Christ, B., and C.P. Ordahl. 1995. Early stages of chick somite development. Anat. Embryol. (Berl.). 191: 381-396 [Medline]. |
| 4. | Concordet, J.P., K.E. Lewis, J.W. Moore, L.V. Goodrich, R.L. Johnson, M.P. Scott, and P.W. Ingham. 1996. Spatial regulation of zebrafish patched homologue reflects the roles of sonic hedgehog and protein kinase A in neural tube and somite patterning. Development (Camb.). 122: 2835-2846 [Abstract]. |
| 5. | Crow, M.T., and F.E. Stockdale. 1986. Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113: 238-254 [Medline]. |
| 6. | Currie, P.D., and P.W. Ingham. 1996. Induction of a specific muscle cell type by a Hedgehog-like protein in zebrafish. Nature (Lond.). 382: 452-455 [Medline]. |
| 7. | Devoto, S.H., E. Melançon, S.L. Amacher, J.S. Eisen, and M. Westerfield. 1996a. Influence of axial mesoderm on the development of slow muscle precursors. Dev. Biol. 175: 386 . |
| 8. | Devoto, S.H., E. Melançon, J.S. Eisen, and M. Westerfield. 1996b. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development (Camb.). 122: 3371-3380 [Abstract]. |
| 9. | Ekker, M., J. Wegner, M.A. Akimenko, and M. Westerfield. 1992. Coordinate embryonic expression of three zebrafish engrailed genes. Development (Camb.). 116: 1001-1010 [Abstract]. |
| 10. | Ekker, S.C., L.L. McGrew, C.J. Lai, J.J. Lee, D.P. von Kessler, R.T. Moon, and P.A. Beachy. 1995a. Distinct expression and shared activities of members of the hedgehog gene family of Xenopus laevis. Development (Camb.). 121: 2337-2347 [Abstract]. |
| 11. | Ekker, S.C., A.R. Ungar, P. Greenstein, D.P. von Kessler, J.A. Porter, R.T. Moon, and P.A. Beachy. 1995b. Patterning activities of vertebrate Hedgehog proteins in the developing eye and brain. Curr. Biol. 5: 944-955 [Medline]. |
| 12. | Ericson, J., S. Morton, A. Kawakami, H. Roelink, and T.M. Jessell. 1996. Two critical periods of sonic hedgehog signaling required for the specification of motor neuron identity. Cell. 87: 661-673 [Medline]. |
| 13. | Fan, C.M., and M. Tessier-Lavigne. 1994. Patterning of mammalian somites by surface ectoderm and notochord: evidence for sclerotome induction by a hedgehog homolog. Cell. 79: 1175-1186 [Medline]. |
| 14. | Fan, C.M., J.A. Porter, C. Chiang, D.T. Chang, P.A. Beachy, and M. Tessier-Lavigne. 1995. Long-range sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway. Cell. 81: 457-465 [Medline]. |
| 15. | Felsenfeld, A.L., M. Curry, and C.B. Kimmel. 1991. The fub-1 mutation blocks initial myofibril formation in zebrafish muscle pioneer cells. Dev. Biol. 148: 23-30 [Medline]. |
| 16. | Fredette, B.J., and L.T. Landmesser. 1991a. A reevaluation of the role of innervation in primary and secondary myogenesis in developing chick muscle. Dev. Biol. 143: 19-35 [Medline]. |
| 17. | Fredette, B.J., and L.T. Landmesser. 1991b. Relationship of primary and secondary myogenesis to fiber type development in embryonic chick muscle. Dev. Biol. 143: 1-18 [Medline]. |
| 18. |
Hammerschmidt, M.,
M.J. Bitgood, and
A.P. McMahon.
1996a.
Protein kinase
A is a common negative regulator of hedgehog signaling in the vertebrate
embryo.
Genes Dev.
10:
647-658
|
| 19. |
Hammerschmidt, M.,
G.N. Serbedzija, and
A.P. McMahon.
1996b.
Genetic
analysis of dorsoventral pattern formation in the zebrafish: requirement of a
BMP-like ventralizing activity and its dorsal repressor.
Genes Dev.
10:
2452-2461
|
| 20. |
Harris, A.J.,
R.B. Fitzsimons, and
J.C. McEwan.
1989.
Neural control of the sequence of expression of myosin heavy chain isoforms in fetal mammalian
muscles.
Development (Camb.).
107:
751-769
|
| 21. | Hatta, K., R. Bremiller, M. Westerfield, and C.B. Kimmel. 1991. Diversity of expression of engrailed-like antigens in zebrafish. Development (Camb.). 112: 821-832 [Abstract]. |
| 22. | Hauschka, S.D. 1994. Development, anatomy, and cell biology. In Myology. A. Engel and C. Franzini-Armstrong, editors. McGraw Hill Press, NY. 3-73. |
| 23. | Hemmati-Brivaniou, A., O.G. Kelly, and D.A. Melton. 1994. Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell. 77: 283-291 [Medline]. |
| 24. | Heim, R., A.B. Cubitt, and R.Y. Tsien. 1995. Improved green fluorescence [letter]. Nature (Lond.). 373: 663-664 [Medline]. |
| 25. | Hughes, S.M., M. Cho, I. Karsch, Mizrachi, M. Travis, L. Silberstein, L.A. Leinwand, and H.M. Blau. 1993. Three slow myosin heavy chains sequentially expressed in developing mammalian skeletal muscle. Dev. Biol. 158: 183-199 [Medline]. |
| 26. | Jiang, J., and G. Struhl. 1995. Protein kinase A and hedgehog signaling in Drosophila limb development. Cell. 80: 563-572 [Medline]. |
| 27. | Johnson, R.L., E. Laufer, R.D. Riddle, and C. Tabin. 1994. Ectopic expression of Sonic hedgehog alters dorsal-ventral patterning of somites. Cell. 79: 1165-1173 [Medline]. |
| 28. | Kimmel, C.B., W.W. Ballard, S.R. Kimmel, B. Ullmann, and T.F. Schilling. 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203: 253-310 [Medline]. |
| 29. | Krauss, S., J.P. Concordet, and P.W. Ingham. 1993. A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos. Cell. 75: 1431-1444 [Medline]. |
| 30. | Kroll, L.K, and E. Amaya. 1996. Transgenic Xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development (Camb.). 122: 3173-3183 [Abstract]. |
| 31. | Lassar, A.B., and A.E. Munsterberg. 1996. The role of positive and negative signals in somite patterning. Curr. Opin. Neurobiol. 6: 57-63 [Medline]. |
| 32. | Li, W., J.T. Ohlmeyer, M.E. Lane, and D. Kalderon. 1995. Function of protein kinase A in hedgehog signal transduction and Drosophila imaginal disc development. Cell. 80: 553-562 [Medline]. |
| 33. | Liem, K.F., G. Tremml Jr., H. Roelink, and T.M. Jessell. 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell. 82: 969-979 [Medline]. |
| 34. |
Miller, J.B., and
F.E. Stockdale.
1986a.
Developmental origins of skeletal muscle fibers: clonal analysis of myogenic cell lineages based on expression of
fast and slow myosin heavy chains.
Proc. Natl. Acad. Sci. USA.
83:
3860-3684
|
| 35. |
Miller, J.B., and
F.E. Stockdale.
1986b.
Developmental regulation of the multiple myogenic cell lineages of the avian embryo.
J. Cell Biol.
103:
2197-2208
|
| 36. |
Miller, J.B.,
S.B. Teal, and
F.E. Stockdale.
1989.
Evolutionarily conserved sequences of striated muscle myosin heavy chain isoforms. Ectopic mapping
by cDNA expression.
J. Biol. Chem.
264:
13122-13130
|
| 37. |
Munsterberg, A.E.,
J. Kitajewski,
D.A. Bumcrot,
A.P. McMahon, and
A.B. Lassar.
1995.
Combinatorial signaling by Sonic hedgehog and Wnt family
members induce myogenic bHLH gene expression in the somite.
Genes Dev.
9:
2911-2922
|
| 38. | Nikaido, M., M. Tada, T. Saji, and N. Ueno. 1997. Conservation of BMP signaling in zebrafish mesoderm patterning. Mech. Dev. 61: 75-88 [Medline]. |
| 39. |
Orellana, S.A., and
S. Mcknight.
1992.
Mutations in the catalytic subunit of
cAMP-dependent protein kinase result in unregulated biological activity.
Proc. Natl. Acad. Sci. USA.
89:
4726-4730
|
| 40. | Pan, D., and G.M. Rubin. 1995. cAMP-dependent protein kinase and hedgehog act antagonistically in regulating decapentaplegic transcription in Drosophila imaginal discs. Cell. 80: 543-552 [Medline]. |
| 41. | Patel, N.H., E. Martin, Blanco, K.G. Coleman, S.J. Poole, M.C. Ellis, T.B. Kornberg, and C.S. Goodman. 1989. Expression of engrailed proteins in arthropods, annelids, and chordates. Cell. 58: 955-968 [Medline]. |
| 42. | Perrimon, N.. 1995. Hedgehog and beyond. Cell. 80: 517-520 [Medline]. |
| 43. | Piccolo, S., Y. Sasai, B. Lu, and E.M. De Robertis. 1996. Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4. Cell. 86: 589-598 [Medline]. |
| 44. | Pourquié, O., C.M. Fan, M. Coltey, E. Hirsinger, Y. Watanabe, C. Bréant, P. Francis-West, P. Brickell, M. Tessier, Lavigne, and N.M. Le Douarin. 1996. Lateral and axial signals involved in avian somite patterning: a role for BMP4. Cell. 84: 461-471 [Medline]. |
| 45. |
Rissi, M.,
J. Wittbrodt,
E. D'Elot,
M. Naegeli, and
F.M. Rosa.
1995.
Zebrafish
Radar: a new member of the TGF- superfamily defines dorsal regions of
the neural plate and the embryonic retina.
Mech. Dev.
49:
223-234
[Medline].
|
| 46. | Roelink, H., A. Augsburger, J. Heemskerk, V. Korzh, S. Norlin, A. Ruiz i Altaba, Y. Tanabe, M. Placzek, T. Edlund, T.M. Jessell, and J. Dodd. 1994. Floor plate and motor neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord. Cell. 76: 761-775 [Medline]. |
| 47. | Sasai, Y., B. Lu, H. Steinbeisser, D. Geissert, L.K. Gont, and E.M. De Robertis. 1994. Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell. 79: 779-790 [Medline]. |
| 48. | Smith, W.C., and R.M. Harland. 1992. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell. 70: 829-840 [Medline]. |
| 49. | Talbot, W.S., B. Trevarrow, M.E. Halpern, A.E. Melby, G. Farr, J.H. Postlethwait, T. Jowett, C.B. Kimmel, and D. Kimelman. 1995. A homeobox gene essential for zebrafish notochord development. Nature (Lond.). 378: 150-157 [Medline]. |
| 50. | Thornell, L.E., R. Billeter, G.S. Butler, Browne, P.O. Eriksson, M. Ringqvist, and R.G. Whalen. 1984. Development of fiber types in human fetal muscle. An immunocytochemical study. J. Neurol. Sci. 66: 107-115 [Medline]. |
| 51. | Trevarrow, B., D.L. Marks, and C.B. Kimmel. 1990. Organization of hindbrain segments in the zebrafish embryo. Neuron. 4: 669-679 [Medline]. |
| 52. | Ungar, A.R., and R.T. Moon. 1996. Inhibition of protein kinase A phenocopies ectopic expression of hedgehog in the CNS of wild-type and cyclops mutant embryos. Dev. Biol. 178: 186-191 [Medline]. |
| 53. | van Raamsdonk, W., A. van der Stelt, P.C. Diegenbach, W. van de Berg, H. de Bruyn, J. van Dijk, and P. Mijzen. 1974. Differentiation of the musculature of the teleost Brachydanio rerio. Z. Anat. Entwicklngs gesch. 145: 321-342 . |
| 54. | Van Swearingen, J., and C. Lance-Jones. 1995. Slow and fast muscle fibers are preferentially derived from myoblasts migrating into the chick limb bud at different developmental times. Dev. Biol. 170: 321-337 [Medline]. |
| 55. | Waterman, R.E.. 1969. Development of the lateral musculature in the teleost, Brachydanio rerio: a fine structural study. Am. J. Anat. 125: 457-493 [Medline]. |
| 56. | Weinberg, E.S., M.L. Allende, C.S. Kelly, A. Abdelhamid, P. Andermann, G. Doerre, D.J. Grunwald, and B. Riggleman. 1996. Developmental regulation of zebrafish MyoD in wild-type, no tail, and spadetail embryos. Development (Camb.). 122: 271-280 [Abstract]. |
| 57. | Westerfield, M. 1995. Microscopic observation. In The Zebrafish Book. M. Westerfield, editor. University of Oregon Press, Eugene, OR. 4.1-4.5. |
| 58. |
Westerfield, M.,
J. Wegner,
B.G. Jegalian,
E.M. DeRobertis, and
A.W. Püschel.
1992.
Specific activation of mammalian Hox promoters in mosaic transgenic
zebrafish.
Genes Dev.
6:
591-598
|
| 59. | Zimmerman, L.B., J.M. De Jesus-Escobar, and R.M. Harland. 1996. The Spermann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell. 86: 599-606 [Medline]. |
This article has been cited by other articles: