|
||
-Catenin Mutant, and of the
Wnt-signaling Pathway by
-Catenin in Xenopus Embryos

* Cell Biology Program, Department of Biochemistry and Biophysics, and Howard Hughes Medical Institute, University
of California, San Francisco, California 94143-0724; and
Cellular Biochemistry and Biophysics Program, Memorial
Sloan-Kettering Cancer Center, New York 10021
In Xenopus laevis development,
-catenin
plays an important role in the Wnt-signaling pathway
by establishing the Nieuwkoop center, which in turn
leads to specification of the dorsoventral axis. Cadherins are essential for embryonic morphogenesis since they mediate calcium-dependent cell-cell adhesion and
can modulate
-catenin signaling.
-catenin links
-catenin to the actin-based cytoskeleton. To study the
role of endogenous
-catenin in early development, we
have made deletion mutants of
N-catenin. The binding domain of
-catenin has been mapped to the NH2-terminal 210 amino acids of
N-catenin. Overexpression of mutants lacking the COOH-terminal 230 amino
acids causes severe developmental defects that reflect
impaired calcium-dependent blastomere adhesion. Lack of normal adhesive interactions results in a loss of
the blastocoel in early embryos and ripping of the ectodermal layer during gastrulation. The phenotypes of
the dominant-negative mutants can be rescued by coexpressing full-length
N-catenin or a mutant of
-catenin that lacks the internal armadillo repeats.
We next show that coexpression of
N-catenin antagonizes the dorsalizing effects of
-catenin and Xwnt-8.
This can be seen phenotypically, or by studying the effects of expression on the downstream homeobox gene
Siamois. Thus,
-catenin is essential for proper morphogenesis of the embryo and may act as a regulator of
the intracellular
-catenin signaling pathway in vivo.
CELLS in a developing organism depend on various
forms of adhesion for their proper morphogenetic
movements. Several types of adhesion molecules
have been described during the early development of the
frog Xenopus laevis. Widely studied are the cadherins, which are transmembrane glycoproteins that mediate calcium-dependent cell-cell adhesion (for review see Huber
et al., 1996a In the early development of Xenopus, Recently, cadherins have been shown to be involved in
the regulation of the Wnt-signaling pathway (Fagotto et al.,
1996 In addition to affecting In the present study, we have used deletion mutants of
Plasmid Construction
The construct named GFP The constructs GFP GFP was subcloned from pCDNA-1 into pCS2+ using the sites
BamHI-XbaI. The construct GFP The construct GFP Treatment of Embryos and mRNA Injections
All synthetic mRNAs were prepared using the SP6 Message Machine
capped mRNA kit (Ambion, Inc., Austin, TX). GFP, GFP Xenopus laevis frogs were obtained from Nasco (Fort Atkinson, WI).
Sperm was added to eggs in 1x MMR: 100 mM NaCl, 5 mM, Hepes-Na, pH 7.4, 2 mM KCl, 1 mM MgCl2, and 2 mM CaCl2. After 5 min, 0.1x MMR was added to dilute the sperm and initiate fertilization. Embryos
were dejellied after 10 min with 2.5% cysteine hydrochloride, pH 8.0, and
allowed to develop in 0.1x MMR. 10 nl of a synthetic mRNA solution was
injected either at the two- or four-cell stage using a glass micropipette.
Embryos were allowed to develop to various stages (as described by
Nieuwkoop and Faber, 1967 Immunoblots and Immunoprecipitations
For experiments determining the association of Histology
For paraplast sectioning and staining, stage 11-12 embryos were fixed
overnight in MEMFA (0.1 M MOPS, pH 7.4, 2 mM EGTA, 1 mM MgSO4,
3.7% formaldehyde). Embryos were then dehydrated through an ethanol
series (50, 70, 90, 95, 100, and 100%) and placed in 100% butanol for 1.5 h.
Embryos were carefully transferred to paraplast (Oxford Labware, St.
Louis, MO) at 55-60°C for several hours and then positioned and embedded in paraplast. Sectioning was done at 7 µM using a rotary microtome.
Sections were mounted and stained with eosin-hematoxylin using standard protocols. For plastic sections, embryos were fixed in MEMFA, dehydrated through an ethanol series, and embedded in glycol-methacrylate
(Historesin, Leica, Heidelberg, Germany). 5-µM sections were stained with
0.5% toluidine blue.
Animal Cap Aggregation Assays
Both blastomeres of two-cell embryos were injected with 1.5 ng of
mRNA. Animal caps were explanted at stage 9 in 1x MMR. To observe
involution and healing, they were placed in 1x MMR in six-well tissue
culture plates coated with 1% agarose for 1 h. Calcium-dependent aggregation assays were performed on either five or six animal caps. Explants
were immediately dissociated in CMF medium (20 mM Na-Hepes, pH
7.2-7.4, 88 mM NaCl, 1 mM KCl) using a Pasteur pipette. Then CaCl2 was
added back to 2 mM, and blastomeres were allowed to reaggregate on a
rotating table for 1 h.
RNAse Protection Assays
For experiments involving animal cap explants, mRNAs were coinjected
into the animal hemisphere of one cell of two-cell embryos. At stage 9, animal caps were removed from 10-15 embryos and allowed to develop
until same stage embryos were stage 10.5. For experiments testing levels
of endogenous Siamois expression, whole embryos injected in both dorsal
blastomeres at the four-cell stage were taken at stage 10. Total RNA was
extracted using RNAzol B according to the manufacturer's methods (Tel-Test, Inc., Friendswood, TX). RNAse protection assays were performed
using the RPA II and MAXIscript T7 kits from Ambion. The EF1 The NH2-terminal Domain of GFP was fused to various constructs of
Mutants that Lack the COOH Terminus of The injection of mRNA encoding
Table I.
Frequency of Gastrulation Defects by
). The cadherins are in turn linked through
their cytoplasmic domains to several cytoplasmic proteins
called catenins.
-catenin (and its homologue plakoglobin)
has been shown to bind directly to the cadherin cytoplasmic domain, and
-catenin has been shown to bind to the
NH2 terminus of
-catenin (and plakoglobin) (Hülsken et
al., 1994
; Funayama et al., 1995
; Jou et al., 1995
; Aberle et al.,
1996
). In turn,
-catenin appears to bind to
-actinin and
actin, establishing a link between the cadherins and the cytoskeleton (Knudsen et al., 1995
; Rimm et al., 1995
). The
regulation of interactions mediated by these molecules is
crucial for proper embryogenesis.
-catenin is a 102-kD protein with homology to vinculin
(Herrenknecht et al., 1991
; Nagafuchi et al., 1991
). Two
genes encoding isoforms of this protein have been described with
N-catenin having 81.6% identity to the originally described
-catenin (Hirano et al., 1992
).
N-catenin has similar properties to
-catenin: both bind to the
cadherin complex, but
N-catenin is more prevalent in the
nervous system (Hirano et al., 1992
). PC9 cells that normally lack
-catenin exhibit cadherin-dependent aggregation upon introduction of
-catenin, identifying the latter
as a molecule that promotes cadherin-dependent adhesion
(Hirano et al., 1992
). In addition, reintroduction of
-catenin or
N-catenin into the same cell line has been shown
to induce a polarized phenotype typical of epithelial cells
and has also been shown to alter the growth rate (Watabe et al., 1994
). Expression of fusion proteins between E-cadherin and the COOH terminus of
-catenin circumvents
the requirement of
-catenin for cell adhesion but reduces
cell migration, suggesting that
-catenin functions in the
cadherin-catenin complex as a regulatable linker between
the cytoplasmic domain of cadherins and
-catenin (Nagafuchi et al., 1994
). Recently, a gene trap screen in mice
identified a fusion between the NH2-terminal 632 amino
acids of
-catenin and
-geo reporter. Embryos homozygous for this mutant allele were shown to exhibit deficits in
cell adhesion resulting in embryonic lethality (Torres et al.,
1997
). Thus,
-catenin appears to be essential both for
cadherin-based adhesion in vitro and for embryonic development in vivo.
-catenin is initially supplied maternally and is expressed zygotically after the midblastula transition (Schneider et al., 1993
). The
protein is found in a large intracellular pool but localizes
to membranes in the late blastula to early gastrula, eventually accumulating in the presumptive ectoderm and blastopore lip regions (Schneider et al., 1993
). The localization
to the ectoderm layer after gastrulation correlates with the
expression of E-cadherin, which is essential for proper ectoderm formation (Levine et al., 1994
). Other studies involving cadherins have shown that overexpression of the
cytoplasmic domain of N-cadherin, the primary neuronal
cadherin, results in the dissociation of ectodermal cells in
midgastrulation, presumably by competing with the endogenous cadherins for catenin binding (Kintner, 1992
). Expression of a similar extracellular truncation of XB-cadherin, which is normally expressed earlier in development,
results in perturbations in anterior structures that are different than those observed after expression of an N-cadherin dominant-negative mutant (Dufour et al., 1994
).
Overexpression of C-cadherin (also called EP-cadherin)
or E-cadherin cytoplasmic domains has also been shown to have differing effects. These results suggest that different cadherin cytoplasmic domains transmit individual as
well as shared signals (Dufour et al., 1994
; Broders and
Thiery, 1995
).
). The Wnt-signaling pathway is required for normal
body-axis formation of Xenopus embryos (see Gumbiner,
1995
). Components in this pathway include members of the
Wnt family of secreted proteins; Wnt receptors of the
D-frizzled family; an inhibitory Wnt-binding protein Xfrzb-1; several cytoplasmic proteins, specifically Xdishevelled, glycogen synthase kinase-3
(GSK-3),
-catenin, and APC;
and the transcription factors Lef-1 and Tcf-1 of the high
mobility group family and Siamois, a homeobox-containing protein (for review see Peifer, 1997
; Huber et al.,
1996a
; Miller and Moon, 1996
; Gumbiner, 1995
). The dual
role of
-catenin in adhesion and signaling leads to questions regarding its coordinate regulation. In early Xenopus embryos,
-catenin has been shown to be essential in establishing the Nieuwkoop center and is required for dorsal
mesoderm induction, but it is not required for blastomere
adhesion, perhaps because a homologous catenin, plakoglobin, is also expressed (DeMarais and Moon, 1992
; Heasman et al., 1994
; Karnovsky and Klymkowsky, 1995
).
Xwnt-8, when expressed in the early Xenopus blastula, is thought to induce ectopic
-catenin-dependent signaling,
which leads to embryo dorsalization (Smith and Harland,
1991
; Fagotto et al., 1997
). Adenomatous polyposis coli
tumor suppressor protein (APC)1 negatively regulates
-catenin, possibly by targeting it for degradation (for review see Peifer, 1997
; Munemitsu et al., 1995
). Paradoxically, APC can also induce an ectopic dorsoanterior axis in
Xenopus, suggesting that it is an active component in the
Wnt-signaling pathway (Vleminckx et al., 1997
). Since
APC has been shown to form cytosolic complexes with
-
and
-catenin (or plakoglobin), regulation of levels of
these complexes may be important in
-catenin signaling
(Hülsken et al., 1994
). GSK-3 also regulates the levels of
-catenin and its association with APC (Dominguez et al.,
1995
; Rubinfeld et al., 1996
; Yost et al., 1996
). Recently,
-catenin has been shown to also bind to the high mobility
group transcription factor Lef-1 and to be translocated
with it to the nucleus, where the complex activates transcription (Behrens et al., 1996
; Molenaar et al., 1996
; Huber et al., 1996b
; Brunner et al., 1997
; van de Wetering et
al., 1997
; Riese et al., 1997
).
-catenin's signaling capacity,
proteins in the Wnt-signaling pathway can also influence
intercellular adhesion. Members of the Wnt-5A class of
molecules disrupt calcium-dependent adhesion and also
antagonize the signaling effects of the Wnt-1 family (of which
Xwnt-8 is a member) (Torres et al., 1996
). Moreover, in
cell lines, Wnt-1 stabilizes the free cytosolic pool of
-catenin and of APC-catenin complexes (Papkoff et al., 1996
;
Papkoff, 1997
). This can affect cell-cell adhesion by stabilizing
-catenin or plakoglobin binding to cadherins (Bradley et al., 1993
; Hinck et al., 1994b
). Finally, overexpression of C-cadherin in Xenopus embryos has been shown to
inhibit
-catenin signaling (Fagotto et al., 1996
). Therefore, cadherin-based adhesion and the Wnt-signaling pathway are interdependent.
N-catenin to ascertain the endogenous functions of
-catenin in early Xenopus development. We first map the binding site of
-catenin to the NH2 terminus of
-catenin. We
then show that mutants lacking the COOH-terminal third
of
-catenin, when overexpressed in Xenopus embryos,
cause severe defects in gastrulation that can be explained by severely impaired calcium-dependent cell adhesion. Finally, we find that overexpression of
-catenin can affect
the dorsalizing properties of Xwnt-8 or
-catenin when
these proteins are introduced early into ventral blastomeres; it can also perturb normal dorsoanterior axis formation when injected into dorsal blastomeres. We therefore propose that the COOH terminus of
-catenin is essential
for the proper function of this molecule, that
-catenin
plays an instrumental role in the adhesion of Xenopus
blastomeres and their subsequent morphogenesis, and that
-catenin may also be a modulator of
-catenin signaling.
Materials and Methods
NcatCterm was made by fusing green fluorescent protein (GFP) to the NH2 terminus of
N-catenin. GFP was obtained
in the vector pCDNA-1 (Invitrogen, Carlsbad, CA) from Dr. C.M. Fan
(University of California, San Francisco, CA), and chick
N-catenin in
pBS SK+ (Stratagene, La Jolla, CA) was obtained from Dr. Masatoshi
Takeichi (Hirano et al., 1992
). GFP was amplified using PCR. The primers were upstream, GGTCGACCCATGAGTAAAGGAGAAGAACTTTTCACTGG, and downstream, CCAAGCTTATTTGTATAGTTCATCCATGCC. This product was ligated into pCR3 (Invitrogen). The resulting vector (pCR3-GFPa) was cut with XhoI. An XhoI fragment containing
N-catenin was excised from pBS SK+. This results in a deletion of the
first NH2-terminal 750 bases of the full-length clone. This fragment was ligated into the pCR3-GFPa vector.
NtermGFP was made using PCR, amplifying GFP and fusing it to a
COOH-terminal deletion mutant of
N-catenin. The upstream primer
was, CCCGGGGATGAGTAAAGGAGAAGAACTTTTCACTGG, and
downstream, CCAAGCTTATTTGTATAGTTCATCCATGCC. The resulting product was ligated into pCR3.
N-catenin in pBS SK+ was cut
with BamHI and BalI and fused into the BamHI-SmaI sites in the pCR3-GFPb construct. BalI, which cuts at position 2121, removes the COOH-terminal 724 bases of
N-catenin. The constructs described above were all
sequenced through junctional regions.
NcatCterm and
NcatNtermGFP were subcloned
from pCR3 into pCS2+ for expression in Xenopus embryos using the
BamHI and XbaI sites. pCS2+ (Rupp et al., 1994
) was a gift from Dr.
Monica Vetter (University of Utah, Salt Lake City, UT).
Arm is described as
R in Kypta et al. (1996)
and was excised from the expression vector p6R using the sites SalI and XbaI. It was
subcloned into pCS2+ using XhoI and XbaI.
Ncat was made using pEGFP-C1 (CLONTECH
Laboratories, Inc., Palo Alto, CA).
N-catenin was cut from pBS SK+ using EcoRI and NsiI, and subcloned into pEGFP-C1 using EcoRI and PstI.
The resultant clone was cut with AgeI, and Klenow was used to create a
blunt 5
end. The insert was cut out with XbaI and subcloned into the
StuI-XbaI sites of pCS2+. To remove intervening 5
-untranslated sequence that contains a stop codon, site-directed mutagenesis was performed using the Quick-Change mutagenesis kit (Stratagene, La Jolla,
CA). The primers were CCCCACCCACCGAGATCTGGGAGTATGACTTC and its reverse complement. This introduced a BglII site in the intervening sequence at the site of the stop codon, so that BglII from
pEGFP-C1 could be used to delete this sequence.
NcatNterm was made by introducing a stop codon
at position 2121 of
N-catenin in GFP
FL. The primers used for site-
directed mutagenesis with the Stratagene kit were GACCAGCTTATTGCTGGCTAGAGTGCAAGGGC and its reverse complement.
NcatCterm, and
NcatNtermGFP in pCS2+ were all linearized using Asp718. NotI was used to linearize
Arm, Xwnt-8, GFP
Ncat, and GFP
NcatNterm. Xwnt-8 in pGEM5Zf(
)/RI was provided by Dr. Richard Harland (University of California, Berkeley, CA) (Smith and Harland, 1991
). Dr. Barry Gumbiner provided the T1 HA-tagged
-catenin construct in the vector
pSP64, which was linearized with EcoRI (Funayama et al., 1995
).
). Animals were visualized for green fluorescence using a 10x objective on a fluorescent microscope (model Microphot FXA; Nikon, Inc., Melville, NY). All photography of embryos was
done using a Leica M420 macrophot microscope (Deerfield, IL). For experiments determining levels of dorsalization, embryos were injected at
the four-cell stage in one ventral blastomere and scored at tadpole stages
using the Dorsoanterior index scale (Kao and Elinson, 1988
). For experiments leading to ventralized embryos, both dorsal blastomeres were injected at the four-cell stage.
-catenin with the various
N-catenin constructs, 1.5 ng mRNA was injected into one cell of two-cell
embryos. Embryos developed until stage 9-10, when 10 embryos were
lysed in 1 ml of NP-40 LB (20 mM Tris-Cl, pH 8.0, 150 mM NaCl, 50 mM
NaF, 10 mM DTT, 1 mM EDTA, 10 mg/ml aprotinin, 10 mg/ml leupeptin,
1% NP-40). Samples were spun at 8,169 g for 15 min. For immunoblots,
reducing SDS sample buffer was added to 40 µl of extracts, boiled at
100°C, and loaded on 7.5% SDS-polyacrylamide gels. Immunoprecipitations were performed as described in Kypta et al. (1996)
. 2.5 µg of an anti-
-catenin monoclonal antibody (Transduction Labs, Lexington, KY) were
used for immune precipitations. The anti-GFP polyclonal antibody serum was developed in the lab by Kuanhong Wang and Dr. Ulrich Müller (University of California, San Francisco, CA) and was used at a concentration
of 1:500. For experiments using
Arm to immunoprecipitate
N-catenin
constructs, the same immunoprecipitation protocol was used with 10 µl (1 µg) of the monoclonal anti-myc tag antibody 9E10 (Santa Cruz Biotech
Inc., Santa Cruz, CA). Cell fractionation experiments were performed exactly as described by Fagotto et al. (1996)
but without acetone precipitations. 40 µl of the soluble fraction were boiled in SDS reducing sample
buffer and loaded directly on 7.5% SDS-polyacrylamide gels. For experiments determining the levels of endogenous Xenopus
-catenin bound to
immune complexes of cadherins, 10 embryos were lysed in NP-40 lysis
buffer and immunoprecipitated using the monoclonal C-cadherin antibody
6B6 (Brieher and Gumbiner, 1994
) as described above. The polyclonal antisera to
N-catenin (CME) was raised in the lab by Dr. Cindy-Murphy Erdosh. It was raised against a peptide corresponding to the COOH-terminal peptide of 21 amino acids (SQKKHISPVQALSEFKAMDSF) of
N-catenin and was used at a dilution of 1:1,000 for Western blots. Equal amounts of precipitates were loaded in each lane of SDS-PAGE gels.
probe
construct was a gift from Dr. Tom Musci (University of California, San
Francisco) (Cornell et al., 1995
), and the Siamois (pXSia BglII 350) probe
was a gift from Dr. Patrick Lemaire (Cambridge University, Cambridge,
UK) (Carnac et al., 1996
). Both constructs were linearized with HindIII and transcribed using T7 polymerase. 10 µg of total RNA was protected with
5 x 105 cpm of probe. Protected fragments were run on 5% denaturing
polyacrylamide gels. Experiments were performed three times.
Results
N-Catenin Is Essential
for
-Catenin Binding
N-catenin to permit assays of expression and localization. Fig. 1 illustrates
the domains of
N-catenin and
-catenin present in each
of the constructs used in these studies. mRNA prepared
using each construct was injected into one cell of two-cell
Xenopus embryos. To quantitate expression of different
N-catenin protein fragments, immunoblots were performed
using a GFP polyclonal antibody for detection. Results in
Fig. 2 A show that each of the proteins was expressed efficiently, a result confirmed by fluorescence detection of
GFP. When a monoclonal antibody against
-catenin was
used to immunoprecipate
-catenin and associated proteins, all
N-catenin constructs except GFP
NcatCterm,
which lacks the NH2-terminal 210 amino acids catenin (Fig. 2 B, lane 5), were shown to bind to
-catenin. Thus,
this NH2-terminal domain is essential for
N-catenin binding to
-catenin.
Fig. 1.
-catenin-GFP and
-catenin constructs used in this
work. GFP was added to either the NH2 terminus of full-length,
or to the NH2 or COOH termini of deletion mutants of chick
N-catenin. 1 represents the start methionine of
N-catenin, and
906 is the terminal amino acid residue. See Materials and Methods for details on the construction of these mutants. Full-length
-catenin has a COOH-terminal hemagglutinin (HA) tag, and
Arm has a COOH-terminal myc tag.
[View Larger Version of this Image (20K GIF file)]
Fig. 2.
Expression of
-catenin-GFP fusion proteins in Xenopus embryos and the localization of the
-catenin binding site.
(A) Expression of proteins detected by anti-GFP. (B) After immunoprecipitations with anti-
-catenin, associated
-catenin was
detected using anti-GFP. In both A and B, the numbering is as
follows: lane 1, GFP injected; lane 2, uninjected; lane 3,
NcatNtermGFP + GFP; lane 4,
NcatNtermGFP +
Arm; lane 5,
GFP
NcatCterm; lane 6, GFP
Ncat; lane 7, GFP
NcatNterm. Note that GFP
NcatCterm, the protein lacking the NH2 terminus of
N-catenin, does not bind to
-catenin (B, lane 5). Results show that the presence of GFP does not prevent
-catenin binding to
-catenin, provided that the NH2-terminal binding domain
is present. In addition, coexpression of
Arm does not affect expression levels. In each case, 1.5 ng total RNA was injected into
one blastomere at the two-cell stage.
[View Larger Version of this Image (48K GIF file)]
N-Catenin
Cause Severe Defects in Gastrulation
N-catenin with
COOH-terminal domain deletions (
NcatNtermGFP or
GFP
NcatNterm) caused severe defects in embryogenesis,
noticeable first at the onset of gastrulation. The observed
phenotype was a marked ripping of the outer ectodermal layer of the embryo, similar to what has been observed after the overexpression of the extracellular domain of E-cadherin (Levine et al., 1994
) or the cytoplasmic domain of
N-cadherin (Kintner, 1992
), but on a more global scale,
with the embryos succumbing to the defects at stage 11, unable to develop further. Fig. 3 shows the onset of this
ripping as seen in embryos expressing GFP
NcatNterm or
NcatNtermGFP (Fig. 3, C and D). In these photos, the
noticeable effects are observed at the dorsal involuting lip of the blastopore. Embryos injected with GFP
Ncat or
GFP
NcatCterm mRNA developed normally (Fig. 3, A
and B) and expressed high levels of the respective proteins
as visualized by immunoblots (Fig. 2) or GFP fluorescence
(data not shown). Table I shows that the COOH-terminal
deletion mutations are very potent, with 99-100% of the
embryos injected with these mRNAs developing this phenotype. GFP-injected controls, or embryos injected with GFP
Ncat or GFP
NcatCterm mRNA, rarely developed gastrulation defects (6% in the case of GFP
NcatCterm).
Fig. 3.
Mutants lacking the COOH terminus of
N-catenin result in severe gastrulation defects. (A) GFP
Ncat-injected embryos develop normally. (B) GFP
NcatCterm-expressing embryos develop normally. (C and D) Both
NcatNtermGFP- and
GFP
NcatNterm-injected mRNAs induce defects beginning at
stage 10, here shown by rips (arrows) occurring at the dorsal lips
of the embryos. Embryos are shown with the ventral side toward
the top. mRNA was injected into the animal pole of one cell of
two-cell embryos.
[View Larger Version of this Image (88K GIF file)]
-Catenin-GFP
Fusion Proteins
When single blastomeres of later-staged embryos were
injected with
NcatNtermGFP, i.e., one blastomere of a
four- or eight-cell embryo, embryos developed further but
had incomplete morphogenesis with open areas shedding
cells (data not shown). These data point to the COOH-terminal 230 amino acid residues of
N-catenin as essential
for its proper function of the protein since overexpression of mutants lacking this domain caused severe deficiencies
in morphogenesis.
Arm and GFP
Ncat Rescue the Defects Caused by
N-Catenin Mutants
To ensure that the effects due to the mRNA injections were
specific for
-catenin, we performed coinjection experiments.
The first mRNA coinjected was a
-catenin construct lacking the internal armadillo repeats (
Arm), which was described previously as
R in Kypta et al. (1996)
. This protein has been shown to retain binding to
-catenin but
does not bind to cadherins or APC (Funayama et al.,
1995
). Fig. 4 shows that
NcatNtermGFP bound to immunoprecipitates of
Arm in Xenopus extracts. Coexpression of
Arm with either
NcatNtermGFP or GFP
NcatNterm resulted in a complete rescue of the phenotype,
when the ratio of rescuing mRNA to
N-catenin truncation mRNA was 4:1 (Fig. 5, B and E, and Table II). Coinjecting the same amount of GFP mRNA as a control did
not rescue the phenotype (Fig. 5, A and D, and Table II).
Arm binds
-catenin-
GFP fusion proteins. The 9E10
monoclonal antibody that recognizes the myc tag on
Arm was
used to immunoprecipitate, and
anti-GFP was used with subsequent
immunoblotting to detect
-catenin-GFP fusion proteins in the precipitates. Embryos were coinjected
with 0.3 ng of the first mRNA and
1.2 ng of the second. First lane, GFP +
Arm; second lane,
NcatNtermGFP +
Arm; third lane, uninjected.
Arm and GFP
Ncat rescue the defects
caused by dominant-negative
-catenin mutants. (A, B,
and C)
NcatNtermGFP + GFP,
Arm, or GFP
Ncat,
respectively. (D-F) GFP
NcatNterm + GFP,
Arm, or GFP
Ncat. In all cases, 0.3 ng of
NcatNtermGFP or
GFP
NcatNterm mRNA
was coinjected with 1.2 ng of
the second mRNA. Mutants
in A and D do not develop
further than gastrulation.
Rescued mutants gastrulate
(B and C, and E and F) and
continue to develop normally. mRNA was injected
into the animal pole of one
cell of two-cell embryos.
|
Table II.
|
Similarly, the construct encoding full-length
N-catenin
named GFP
Ncat completely rescued the gastrulation-defective phenotypes induced by overexpression of the
COOH-terminal deletion mutants of
N-catenin. This full-length
N-catenin construct with GFP fused to the NH2
terminus caused no observable phenotype when high protein expression was achieved by injecting mRNA encoding this protein into one cell of two-cell embryos. Again, when
this mRNA was coinjected with GFP
NcatNterm, the embryos developed normally with no apparent defects (Fig.
5, C and F). A summary of these results is presented in Table II. Coinjection of GFP
Ncat mRNA rescued consistently and completely embryos injected with the COOH-terminal truncation mutants of
N-catenin. In most cases,
Arm completely rescued the defects caused by
NcatNtermGFP, but there was some variability in batches of
mRNA, so the final average rescue was incomplete with
17% of embryos expressing a mutant phenotype.
To further characterize the variant phenotype, stage
10.5-11 embryos were sectioned and examined histologically (Fig. 6). At this stage, normal embryos have well-
developed germ layers surrounding a central blastocoel
(Fig. 6 A). In contrast, embryos expressing GFP
NcatNterm
or
NcatNtermGFP protein showed a complete loss of the
blastocoel and complete disorganization of the interior of
the embryo (Fig. 6, C and D). In addition, defects in the integrity of the outer ectodermal layer are apparent in these
embryos. This disorganization is in stark contrast to embryos injected with GFP
NcatCterm (Fig. 6 B), which develop normally. Further magnification of embryos shows
the disorganized nature of cells in the ectodermal layer of
an embryo expressing
NcatNtermGFP (Fig. 6 F). Cells have lost adhesive contacts and are round compared to
cells of an embryo expressing GFP
NcatCterm (Fig. 6 E).
-catenin-
GFP fusion proteins. Stage 10-11 embryos were fixed in MEMFA
and imbedded in paraplast (A and C) or plastic (B, D, E, and F)
for sectioning. Arrowheads point to the blastocoel (bc). The abbreviation dl denotes the presumptive dorsal side of the embryos.
(A) An uninjected normal embryo. (B) An embryo injected with
GFP
NcatCterm mRNA, (C)
NcatNtermGFP, and (D) GFP
NcatNterm. Embryos expressing
NcatNtermGFP completely
lack the blastocoel and are disorganized compared to normal embryos. Also noticeable is the lack of integrity of the ectodermal
layers in the two mutants. Higher magnification emphasizes the
disorganization of cells in an embryo expressing
NcatNtermGFP compared to a normal embryo expressing GFP
NcatCterm.
mRNA was injected into the animal pole of both cells of two cell
embryos. Bars: (A-D) 200 µm; (E and F) 100 µm.
Arm Displaces
NcatNtermGFP and
GFP
NcatNterm from Their Association with
Cadherins to a Soluble Fraction
To provide evidence addressing the mechanism by which
the
-catenin construct
Arm, which lacks a cadherin binding site, rescued the defects caused by the expression of
the COOH-terminal deletion
N-catenin constructs, cell
fractionation methods were used. Following a protocol described by Fagotto et al. (1996)
, embryos were homogenized in a detergent-free buffer and fractionated by centrifugation. Most of
-catenin remains in solution after this
fractionation (Hinck et al., 1994). The pellet obtained after
high-speed centrifugation was extracted with a nonionic
detergent (1% NP-40) and incubated with concanavalin A
beads to obtain a glycoprotein-enriched fraction, where
cadherins, and their associated proteins are found. After this procedure, a high majority of each of the
-catenin
constructs was found in the soluble pool, but a significant
portion was also found in the pellet, associated with cadherins. The distributions of these
N-catenin-GFP chimeras
was visualized using anti-GFP, and results are presented in
Fig. 7, A (supernatant) and B (pellet). From this experiment, it is again clear that GFP
NcatCterm, although highly expressed in the soluble fraction, is not associated
with cadherins or other glycoproteins and therefore was
not found in the glycoprotein-enriched pellet (Fig. 7, A
and B, lane 3). GFP
Ncat, the functional full-length
N-catenin construct, appeared in both fractions (Fig. 7, A and
B, lane 8). When 0.3 ng of
NcatNtermGFP or GFP
NcatNterm was coinjected with 1.2 ng of GFP mRNA, a
large amount of each
N-catenin-GFP chimera was found
in the glycoprotein-enriched fraction of the precipitate
(Fig. 7 B, lanes 4 and 6). However, when the same amount
(1.2 ng) of
Arm was coinjected, the levels in the pellet
fraction of the
N-catenin-GFP chimeras decreased significantly (Fig. 7 B, lanes 5 and 7). In the case of
NcatNtermGFP, coinjection of
Arm resulted in its displacement to the soluble fraction (compare Fig. 7, lanes 4 and 5 between A and B). Another type of experiment revealed
similar results: embryos extracted in NP-40 buffer were
subjected to immunoprecipitation with an antibody raised
to C-cadherin and subsequently immunoblotted with anti-GFP. Again, when
Arm was coinjected with
NcatNtermGFP, the binding of
NcatNtermGFP to C-cadherin was
diminished (data not shown). Both of these experiments
were performed several times and yielded consistent data.
These results suggest a likely mechanism for how
Arm
rescued the dominant-negative effects of the COOH-terminal-deleted
N-catenin constructs.
Arm is likely to
bind avidly to the
N-catenin mutants and sequester them,
thereby diminishing their binding to functional
-catenin
in cadherin complexes.
NcatNterm and
NcatNtermGFP
from the glycoprotein fraction to the soluble fraction by
Arm.
(A) Soluble fractions immunoblotted with the anti-GFP polyclonal antibody. (B) Glycoprotein fractions immunoblotted with
the anti-GFP polyclonal antibody. Lanes in both cases are 1, uninjected; 2, GFP injected; 3, GFP
NcatCterm injected; 4,
NcatNtermGFP + GFP; 5,
NcatNtermGFP +
Arm; 6, GFP
NcatNterm + GFP; 7, GFP
NcatNterm +
Arm; 8, GFP
Ncat. Note
the decrease in B between lanes 4 and 5 and lanes 6 and 7, implying that
Arm acts by binding to the
-catenin mutants, keeping them from binding to the cadherin complex. When coinjections
were done, 0.3 ng of the first mRNA was coninjected with 1.2 ng
of the second mRNA.
Binding of Endogenous Xenopus
-Catenin to
Cadherins Diminishes in Embryos Injected with
Dominant-negative
-Catenin Constructs
To substantiate the model that the dominant-negative
-catenin mutants function by displacing endogenous
-catenin
from binding to cadherin complexes, immunoprecipitations
were performed with a monoclonal antibody to C-cadherin.
The immune complexes were subsequently immunoblotted
with an antibody raised against a peptide corresponding to
the COOH-terminal 21 amino acids of chick
N-catenin. This antibody (CME) does not recognize
NcatNtermGFP
or GFP
NcatNterm, both of which lack the COOH-terminal domain of
N-catenin. Results in Fig. 8 illustrate that the
levels of endogenous
-catenin decreased significantly in
embryos expressing
NcatNtermGFP or GFP
NcatNterm (lanes 3 and 4), as compared to embryos expressing GFP
or GFP
NcatCterm (lanes 1 and 2).
-catenin was not detected in uninjected embryos subjected to immunoprecipitations with an anti-myc antibody (9E10) (Fig. 8, lane 5).
The decrease of endogenous
-catenin bound to a cadherin-
enriched fraction was also observed when embryo lysates were precipitated with conconavalin A (data not shown).
-catenin bound to cadherins decrease in embryos expressing the dominant-negative
mutants
NcatNtermGFP or GFP
NcatNterm. Embryos were
lysed in NP-40 buffer and immunoprecipitated using the monoclonal antibody to C-cadherin 6B6. The immunoprecipitates were
immunoblotted with the polyclonal anti-
N-catenin antibody (CME). The lanes correspond to embryos injected with mRNA
for 1, uninjected; 2, GFP; 3,
NcatNtermGFP; 4, GFP
NcatNterm;
5, uninjected. Lane 5 represents uninjected embryos subjected to immunoprecipitation with an anti-myc epitope antibody (9E10)
as a negative control. Embryos were injected into both cells at the two-cell stage to obtain protein expression in the highest possible number of cells. Notice that the levels of endogenous
-catenin decrease significantly in lanes 3 and 4 compared to lanes 1 and 2.
Animal Cap Assays Reveal that Embryos Injected
with Dominant-negative
-Catenin Constructs Lack
Calcium-dependent Cell Adhesion
To extend the results revealing disorganization of sectioned embryos (Fig. 6), we performed animal cap assays
using embryos expressing the dominant-negative
-catenin COOH-terminal deletion constructs to reveal the degree of dissociation of blastomeres. Animal caps explanted
from embryos expressing GFP
Ncat, which developed normally, rounded up and healed in 1x MMR after an hour at
room temperature (Fig. 9 A). However animal caps taken
from embryos expressing either COOH-terminal truncation of
N-catenin did not undergo this process. Instead,
blastomeres dissociated and were shed from the explants
(Fig. 9 B).
-catenin. (A) Animal
caps in 1x MMR normally heal and involute after 1 h as shown in
GFP
Ncat-injected embryos. (B)
NcatNtermGFP-expressing animal caps fail to involute, and dissociated blastomeres disperse after 1 h. (C) Dissociated GFP-expressing animal caps reaggregate
in 2 mM Ca2+, whereas in D animal caps expressing
NcatNtermGFP do not. mRNA was injected into the animal pole of both
cells of two-cell embryos.
Further experiments were performed to determine
whether this disaggregation is based upon a calcium-dependent, and thus presumably cadherin-based, adhesion system.
Both blastomeres at the two-cell stage were injected with
control mRNA, or mRNAs encoding the dominant-negative
-catenin mutants. Animal caps were explanted from six
stage 9 embryos and immediately dissociated by pipetting
in calcium-free CMF medium. Calcium was added back to
2 mM, and the blastomeres were allowed to reaggregate
for 1 h on a rotating table. Blastomeres expressing the
COOH-terminal deletion constructs did not reaggregate, or
they formed very small aggregates (Fig. 9 D), whereas blastomeres expressing GFP, GFP
NcatCterm, or GFP
Ncat
formed large cohesive aggregates (Fig. 9 C, not all data
shown). The presence of GFP-derived fluorescence revealed
that most of the blastomeres expressed
N-catenin-GFP chimeric proteins (data not shown).
N-Catenin Antagonizes the Dorsalizing Effects of
Xwnt-8 and
-Catenin in Ventral Blastomeres
Both Xwnt-8 and
-catenin have been established as potent dorsalizing factors that cause axis duplication after
mRNA encoding these proteins is injected into ventral blastomeres of four-cell Xenopus embryos (Sokol et al., 1991
;
Funayama et al., 1995
). Overexpression of C-cadherin in
dorsal blastomeres results in ventralized embryos, and coinjection of C-cadherin with
-catenin in ventral blastomeres antagonizes the dorsalizing effects of
-catenin (Fagotto
et al., 1996
). To determine if overexpression of
-catenin,
like C-cadherin, can affect the Wnt-signaling pathway, we
first determined whether coinjection of the COOH-terminal
N-catenin deletion constructs could affect signaling
induced by
-catenin injection into ventral blastomeres. In
these experiments, at levels of expression where
-catenin
normally caused axis duplication,
NcatNtermGFP, when coinjected with
-catenin, led to gastrulation defects indistinguishable from the phenotype when the former was injected alone. These experiments emphasize that it is difficult to observe formation of double axes if embryos die at
gastrulation.
We next examined effects of coinjection of the full-length
N-catenin chimera (GFP
Ncat) on Xwnt-8-activated signaling. 0.125 ng of Xwnt-8 mRNA was coinjected with increasing amounts of either GFP or GFP
Ncat mRNA into
a single ventral blastomere of four-cell embryos. When increasing amounts of GFP mRNA were coinjected, no inhibition of Xwnt-8-induced dorsalization was observed. At these concentrations, the embryos were severely dorsalized, radially symmetric with enlarged cement glands, and
completely lacking in all trunk features (Fig. 10 C). In contrast, coinjection of increasing amounts of GFP
Ncat mRNA
significantly decreased the degree of Xwnt-8-induced dorsalization. Embryos developed normal head features, and
in most cases simply had shortened, bent axes and reduced
trunks (Fig. 10 D). Ventral blastomeres coinjected with
0.125 ng of GFP mRNA and high levels of GFP
Ncat
mRNA developed normally (Fig. 10 B). These data are summarized in Table III, using the Dorsoanterior index (DAI)
developed by Kao and Elinson (1988)
. GFP mRNA did not
reduce the dorsalizing effects of Xwnt-8, and DAI scores
remained high, with all embryos more dorsalized than a
score of 8. In contrast, increasing amounts of GFP
Ncat
resulted in less dorsalized embryos, and when 3 ng of GFP
Ncat were coinjected with 0.125 ng Xwnt-8, the average
DAI was reduced to 6.3.
-catenin diminishes the dorsalizing
effects of Xwnt-8 and
-catenin. (A) Noninjected normal tadpoles. (B) Embryos expressing GFP + GFP
Ncat. (C) Embryos
expressing Xwnt-8 + GFP. (D) Xwnt-8 + GFP
Ncat. (E)
-catenin + GFP
NcatCterm. (F)
-catenin + GFP
Ncat. Embryos
coexpressing
-catenin with Xwnt-8 develop longer trunks and
are less dorsalized than embryos coexpressing GFP. Embryos
ventrally expressing GFP
Ncat + GFP develop normally (B).
GFP
Ncat antagonizes the induction of a secondary dorsoanterior axis by
-catenin (F). In B-D, embryos were coinjected with
0.125 ng of the first mRNA and 3 ng of the second. In E and F, 0.2 ng of
-catenin mRNA was coinjected with 3.0 ng of the
N-catenin constructs. One ventral blastomere was injected in each four-cell embryo. 1-mm glass beads hold the embryos upright.
|
Table III.
Full-Length |
Similar effects of GFP
Ncat were observed on
-catenin-induced axis duplication. When 0.02 ng of
-catenin
mRNA was coinjected with 3 ng of GFP mRNA, the duplicated axes and two heads are clearly visible (Fig. 10 E).
Coninjecting 3 ng of GFP
Ncat mRNA fully rescued these
embryos, and they were indistinguishable from normal uninjected embryos (Fig. 10 F). Data in Table III illustrate
that this effect was reproducible and that GFP
Ncat consistently rescued the axis-duplicating effects of
-catenin.
Thus, these data show that
-catenin can influence the
-catenin-stimulated Wnt-signaling pathway, presumably by binding and witholding free
-catenin from the signaling pool.
-Catenin Expression in Dorsal Blastomeres Results
in Ventralized Embryos
To test whether
-catenin can affect endogenous
-catenin
signaling, GFP
Ncat mRNA was injected into both dorsal
blastomeres of four-cell embryos. Fig. 11 shows that embryos injected into dorsal blastomeres with mRNA encoding GFP
NcatCterm, which does not bind to
-catenin,
developed normally. Embryos injected with the full-length
N-catenin construct often developed the ventral phenotype displayed here. Variability did occur, with some embryos more ventralized than others. But overall, the appearance of ventralized embryos suggests that
-catenin
could play a regulatory role in endogenous
-catenin signaling, and in the establishment of a Nieuwkoop center.
-catenin can antagonize the endogenous
induction of a dorsoanterior axis when expressed in dorsal blastomeres. 3.0 ng of either GFP
NcatCterm, which does not bind
to
-catenin, or GFP
Ncat, the full-length construct, were injected into both dorsal blastomeres of four-cell embryos. Embryos expressing GFP
Ncat often develop the ventralized phenotypes illustrated here (B and D), with no anterior head structures
present. Embryos expressing high levels of GFP
NcatCterm develop normally (A and C). Two stages are shown.
Siamois Expression Decreases with Increasing Levels of
GFP
Ncat in Xwnt-8-injected Animal Caps
Expression of the homeobox gene Siamois in the Nieuwkoop center of early Xenopus embryos is dependent on
-catenin signaling (Fagotto et al., 1997
). It is a target of
the Wnt-signaling pathway, and its overexpression in
ventral blastomeres also leads to dorsalized embryos with
duplicated axes (Carnac et al., 1996
; Lemaire et al., 1995
;
Brannon and Kimelman, 1996
; Fagotto et al., 1997
). We
have used Siamois as a marker in RNAse protection assays
to determine whether the phenotypes observed by coinjecting GFP
Ncat mRNA with Xwnt-8 mRNA could be
extended to the molecular level. When Xwnt-8 or
-catenin mRNAs were injected into the animal hemispheres of
two cell embryos, Siamois was ectopically induced in animal caps of stage 9-10 embryos (Carnac et al., 1996
; Fagotto et al., 1997
). Results of RNAse protection assays presented in Fig. 12 show that the full-length
N-catenin
construct, GFP
Ncat, inhibited the ectopic induction of
Siamois by
-catenin or Xwnt-8. mRNAs were injected
into the animal hemisphere of one cell at the two-cell stage,
and embryos were allowed to develop to stage 9, when animal cap explants were collected. Total RNA was made
from the explants when control embryos reached stage
10.5. 10 µg of total RNA was protected with a probe for
Siamois (pXSia BglII 350; Carnac et al., 1996
) or the ubiquitously expressed elongation factor 1
(EF1
) (Cornell
et al., 1995
). Results revealed that
-catenin coinjected with
GFP mRNA induced high levels of Siamois RNA, and coinjection of
NcatNtermGFP or GFP
Ncat decreased
these levels significantly (Fig. 12 A, lanes 2-4). GFP
Ncat
and
NcatNtermGFP did not induce Siamois on their own
(Fig. 12 A, lanes 5-6). Increasing levels of GFP mRNA
coinjected with Xwnt-8 did not affect Siamois expression,
but increasing levels of GFP
Ncat lowered levels of Siamois
expression significantly (Fig. 12 A, lanes 9-13). Again, GFP
Ncat did not induce Siamois by itself (Fig. 12 A, lane
14). In addition, coinjection of mRNA encoding GFP
Ncat
with Xwnt-8 reduces Siamois induction significantly compared to the coinjection of GFP
NcatCterm mRNA (which
results in embryos that develop normally) (Fig. 12 A, lanes
7 and 8, taken from a separate experiment). Whole embryos
(but not animal cap explants) of noninjected embryos expressed endogenous levels of Siamois (Fig. 12 A, lane 1).
The levels of EF1
remained constant when compared to
the corresponding decreases in Siamois expression.
-Catenin inhibits the induction of the homeobox-containing gene, Siamois, by full-length
-catenin or Xwnt-8 in animal caps. One cell of two-cell embryos was injected in the animal hemisphere, and animal cap explants were taken at stage 9 and allowed to
develop to stage 10.5, when total RNA was prepared. In lanes 2-6, coinjections were with 0.125 ng of the first mRNA and 3.0 ng of the
second. Lane 1, uninjected whole embryos; lane 2, full-length
-catenin + GFP; lane 3, full-length
-catenin +
NcatNtermGFP; lane 4,
full-length
-catenin + GFP
Ncat; lane 5, GFP +
NcatNtermGFP; lane 6, GFP + GFP
Ncat; lane 7, 0.125 ng Xwnt-8 + 3.0 ng GFP
NcatCterm; lane 8, 0.125 ng Xwnt-8 + 3.0 ng GFP
Ncat; lane 9, 0.125 ng Xwnt-8 + 1.5 ng GFP; lane 10, 0.125 ng Xwnt-8 + 3 ng GFP;
lane 11, 0.125 ng Xwnt-8 + 0.75 ng GFP
Ncat; lane 12, 0.125 ng Xwnt-8 + 1.5 ng GFP
Ncat; lane 13, 0.125 ng Xwnt-8 + 3 ng GFP
Ncat; 14, 0.125 ng GFP + 3 ng GFP
Ncat. The ubiquitously expressed elongation factor 1
(EF1
) was included as a loading control.
RNAse protection assays show that either full-length
N-catenin (GFP
Ncat) or the dominant-negative
N-catenin (
NcatNtermGFP)
decrease the levels of Siamois mRNA induced in animal caps by
-catenin or Xwnt-8. Moreoever, increasing concentrations of GFP
Ncat result in proportionate decreases in Siamois induction by Xwnt-8. (B)
-Catenin inhibits the endogenous expression of Siamois
when injected into dorsal blastomeres at the four-cell stage. Both dorsal blastomeres were injected with mRNA, and embryos were extracted for total RNA at stage 10.5. Lane 1, 1.5 ng GFP
Ncat; lane 2, 3.0 ng GFP
Ncat; lane 3, 3.0 ng GFP
NcatCterm; lane 4, uninjected embryos. Embryos injected with GFP
Ncat mRNA (which develop into ventralized embryos) express lower levels of Siamois than normal embryos or embryos injected with GFP
NcatCterm (which develop normally).
When high levels of GFP
Ncat mRNA (3.0 ng) were injected into the two dorsal blastomeres of four-cell embryos
(which causes the ventralized phenotype shown in Fig. 11),
endogenous levels of Siamois RNA taken from whole embryos decreased when compared to noninjected embryos
or embryos injected with GFP
NcatCterm (Fig. 12 B). Together, these results confirm that
-catenin can inhibit the
Wnt-signaling pathway and provide evidence that regulation of
-catenin levels in the developing embryo may be
crucial for normal morphogenesis.
The cadherin cell adhesion system has been widely studied
in the early development of Xenopus, but the role in this
process of
-catenin, a protein that forms a link between cadherins and the cytoskeleton, has only recently begun to be
examined. In the present study, we dissect the regions of
-catenin that are necessary for its proper function and find
that certain molecular mutants can cause severe developmental defects. We also find that
-catenin can influence a
signaling pathway in which there was no previous evidence
for its participation. Our data point to a model where
-catenin is primarily used as a linker protein between the
actin-based cytoskeleton and the cadherin-based intercellular adhesion system. The NH2 terminus of
-catenin is required for binding to
-catenin, and the COOH terminus
is most likely essential for binding to cytoskeletal components. Since
-catenin is also known to be a linker protein
in the same adhesion system but also has an important function in the Wnt-signaling pathway, our results further
suggest that sequestration of
-catenin by
-catenin removes
-catenin from the Wnt-accessible signaling pool.
By this means,
-catenin could modulate dorsoanterior axis
induction.
We have found, using deletion constructs, that the NH2-terminal 210 amino acid residues of
N-catenin are essential for the binding and sequestration of
-catenin. This information extends previous data analyses assayed in a yeast
two-hybrid system that illustrated that the NH2-terminal
606 amino acids are essential for this interaction (Jou et al.,
1995
).
Less is known regarding the functional interactions of
the COOH-terminal domain of
-catenin, except that it is
necessary for the proper function of the protein. Cosedimentation assays have indicated that the COOH-terminal
447 amino acids of
-catenin interact with F-actin (Rimm
et al., 1995
).
-catenin also appears to interact with
-actinin, although the precise domain needed for this interaction has not been determined (Knudsen et al., 1995
). Consistent with its postulated function as a mediator of linkage
to the cytoskeleton, a chimera of the E-cadherin extracellular and transmembrane domains fused to the
-catenin
COOH-terminal domain has been shown to promote efficient cadherin-dependent cell aggregation, bypassing the
normal requirements for the cytoplasmic domain of the
cadherin and
-catenin (Nagafuchi et al., 1994
). Moreover,
embryos homozygous for a gene-trap mutation, where the LacZ reporter gene replaced the COOH-terminal third of
-catenin, have been shown to be deficient in the formation of the trophoblast epithelium that did not develop
past the blastocyst stage (Torres et al., 1997
). The COOH-terminal deletion in
N-catenin used in the present paper
begins at amino acid residue 675, which is close to the
truncation at position 632 of the gene trap mutant (Torres et al., 1997
). The murine embryos homozygous for the
-catenin-
gal fusion protein did not develop a blastocoelic cavity; cultured blastocysts were shown to have altered cell adhesion, but heterozygous animals developed
normally (Torres et al., 1997
). Our data show that overexpressing the two
-catenin mutants lacking the COOH terminus disrupts function in a similar fashion, severely reducing cell adhesion with no blastocoel forming in embryos.
In addition, our results illustrate that this type of mutation,
when overexpressed, can disrupt endogenous
-catenin
function. The data of Torres et al. (1997)
suggest that at a
1:1 ratio, as would be found in animals heterozygous for
the gene-trap fusion protein, the mutant protein is not at a
high enough concentration to disrupt endogenous
-catenin. We have not been able to calculate the levels of mutant dominant-negative
N-catenin relative to endogenous
Xenopus embryonic
-catenin, but it is probable that the
levels of protein translated from synthetic mRNA injected
into the embryos exceed endogenous levels. The fact that
these defects can be rescued by full-length
N-catenin
(GFP
Ncat) indicates the relative amounts of normal and
mutant proteins determine whether there is a phenotype.
In accordance with our model, GFP
NcatCterm, since it
does not bind
-catenin (or presumably plakoglobin), does
not cause a visible phenotype. Nor does the full-length
N-catenin construct (GFP
Ncat) induce an adhesion phenotype since it, according to the model, can substitute and
fully function for endogenous
-catenin because of its retention of both functional
-catenin and cytoskeletal binding domains. The fact that the expression of GFP
NcatNterm results in an identical phenotype to that induced by
NcatNtermGFP demonstrates that it is the deletion of the
COOH-terminal domain, and not the addition of GFP, that
causes these defects. These results suggest that associations with
-catenin (and plakoglobin) are limiting in linking
cadherins to the cytoskeleton. The failure of overexpression
of GFP
NcatCterm to cause a detectable phenotype suggests that sites for cytoskeletal association are not limiting.
The mechanism by which the
-catenin mutant
Arm
rescues the phenotype caused by the dominant-negative
-catenin constructs is not entirely clear. It has previously
been shown that th