|
||



* Forschungsinstitut für Molekulare Pharmakologie, D-10315 Berlin;
Institut für Biologische Informationsverarbeitung,
Forschungszentrum Jülich, D-52425 Jülich; and § Anatomisches Institut, Universitätskrankenhaus Eppendorf, D-20246 Hamburg
| |
Abstract |
|---|
|
|
|---|
Cyclic nucleotide-gated (CNG) channels are
key elements of cGMP- and cAMP-signaling pathways
in vertebrate photoreceptor cells and in olfactory sensory neurons, respectively. These channels form heterooligomeric complexes composed of at least two distinct subunits (
and
). The
subunit of cone
photoreceptors is also present in mammalian sperm.
Here we identify one short and several long less abundant transcripts of
subunits in testis. The
and
subunits are expressed in a characteristic temporal and spatial pattern in sperm and precursor cells. In mature
sperm, the
subunit is observed along the entire flagellum, whereas the short
subunit is restricted to the
principal piece of the flagellum. These findings suggest
that different forms of CNG channels coexist in the flagellum. Confocal microscopy in conjunction with the
Ca2+ indicator Fluo-3 shows that the CNG channels
serve as a Ca2+ entry pathway that responds more sensitively to cGMP than to cAMP. Assuming that CNG
channel subtypes differ in their Ca2+ permeability, dissimilar localization of
and
subunits may give rise to
a pattern of Ca2+ microdomains along the flagellum,
thereby providing the structural basis for control of
flagellar bending waves.
| |
Introduction |
|---|
|
|
|---|
GAMETES use chemoattractive factors to increase the
probability of sperm-egg interaction (for review
see Ward and Kopf, 1993
). Sperm chemoattraction is well-established in species with external fertilization. In sea urchin, the best-studied species, several lines of
evidence suggest that cyclic nucleotides and Ca2+ control
sperm chemoattraction (Garbers, 1989
). Peptides secreted from sea urchin eggs bind to membrane receptors of
sperm, thereby increasing the intracellular concentrations
of cyclic nucleotides and Ca2+ (Hansbrough and Garbers,
1981
; Schackmann and Chock, 1986
). A rise of the intracellular Ca2+ concentration ([Ca2+]i) has been proposed to
alter sperm motility (Ward et al., 1985
; Cook et al., 1994
).
However, the control mechanism(s) of swimming behavior, the site(s) of Ca2+ entry into sperm, and the molecular
identity of the Ca2+ conductance remain unknown.
In contrast to species with external fertilization, evidence is sparse for chemoattraction of sperm in mammals.
Studies in mammals are complicated by the process of
capacitation (Cohen-Dayag et al., 1995
). Furthermore,
sperm migration within the female genital tract may be
controlled not only by factors secreted by the egg, but also
by factors in the follicular fluid (Ralt et al., 1991
; Cohen-Dayag et al., 1995
) or the oviduct (for review see Harper,
1994
). Whether chemoattraction of mammalian sperm is
mediated by signaling pathways involving cyclic nucleotides and Ca2+ is not known.
Recently, a cyclic nucleotide-gated (CNG)1 channel was
identified in mammalian sperm (Weyand et al., 1994
).
CNG channels are directly opened by either cAMP or
cGMP, and are permeable to Ca2+ ions (for review see
Kaupp, 1995
; Finn et al., 1996
). By virtue of their high
Ca2+ permeability (Frings et al., 1995
), CNG channels are
prime candidates for mediating Ca2+ entry into sperm that
is controlled by cyclic nucleotides. CNG channels form
heterooligomeric complexes composed of homologous
and
subunits (for review see Kaupp, 1995
; Finn et al.,
1996
). When heterologously expressed, the
subunits
form functional channels on their own, whereas
subunits
alone are not functionally active. Coexpression of
and
subunits results in channel species that differ from homooligomeric channels in several properties such as ligand
sensitivity, ligand selectivity, and interaction with Ca2+ ions
(Chen et al., 1993
; Bradley et al., 1994
; Liman and Buck, 1994
; Körschen et al., 1995
; Gordon et al., 1996
; Sautter et al., 1998
; Bönigk, Sesti, Bradley, Ronnett, Müller, Kaupp,
and Frings, manuscript submitted for publication). The
homooligomeric
subunit cloned from bovine testis responds roughly 200-fold more sensitive to cGMP than to
cAMP (Weyand et al., 1994
), suggesting that the channel
represents the target of a cGMP-signaling pathway.
In sperm from both vertebrates and invertebrates, several cellular processes (e.g., acrosomal exocytosis) are regulated by cyclic nucleotides and [Ca2+]i (Santos-Sacchi and
Gordon, 1980
; Arnoult et al., 1996
; Rotem et al., 1998
).
Therefore, CNG channels may subserve several functions including chemoattraction and exocytosis.
We set out to study the physiological role(s) of CNG
channels in sperm by determining their molecular composition and their expression pattern. Our experiments provide evidence for a short and several long less abundant
transcripts of
subunits in testis. The short
subunit variant is expressed in sperm. In mature sperm,
and
subunits have different but overlapping spatial distributions along the flagellum. We show that activation of flagellar
CNG channels increases [Ca2+]i of sperm. The CNG channel-mediated Ca2+ influx is more sensitive to cGMP than
to cAMP. The localization on the flagellum strengthens
the idea that Ca2+ entry through CNG channels controls
sperm motility. The distinct regional expression of channel
subtypes along the flagellum might produce a spatiotemporal profile of Ca2+ concentrations that may underlie
complex flagellar beating patterns.
| |
Materials and Methods |
|---|
|
|
|---|
We will use a nomenclature for CNG channels that describes the subunit
type (
,
) and the channel subfamily (1, 2, 3). In vertebrates, three distinct genes encoding
subunits have been identified. The respective gene
products have been originally identified either in rod (1) or in cone (2)
photoreceptors, or in olfactory sensory neurons (3); alternatively spliced
variants are indicated by small letters. A preceding p (for plasmid) indicates the respective cDNA sequence.
Preparation of RNA and Construction of cDNA Library
Bovine testicular tissue and retinae were frozen immediately in liquid nitrogen at the abattoir. Poly(A)+ RNA was isolated using the guanidinium
isothiocyanate method (Chirgwin et al., 1979
), followed by a cesium-trifluoroacetic acid gradient and oligo(dT)-cellulose chromatography (Aviv
and Leder, 1972
). First-strand cDNA was synthesized with M-MLV
reverse transcriptase (Life Technologies, Eggenstein, Germany) using
oligo(dT)17 or random hexamers as primer. Primers were removed by filtration on a Centricon-100 spin column (Amicon Corp., Easton, TX). A
random-primed cDNA library was constructed from bovine testis
poly(A)+ RNA in
ZAP II vector (Stratagene, La Jolla, CA).
Isolation and Characterization of cDNA Clones
Degenerate primers corresponding to amino acid (aa) sequences KYMAFFE (aa 882-888) and QMIFD (aa 1083-1087) of the CNG channel
subunit from bovine rods (CNC
1a; Körschen et al., 1995
) were used to amplify a fragment from bovine testis first-strand cDNA. The PCR fragment
was used to screen an oligo(dT)-primed testis cDNA library (Weyand et al.,
1994
). The longest clone thus isolated contained nucleotides 1319-3061 of
the final clone pCNC
1c (see Results, Fig. 2 a). The sequence was identical to the corresponding sequence of CNC
1a (Körschen et al., 1995
).
Subsequently, a random-primed cDNA library was screened with a cDNA
probe of CNC
1a (corresponding to nucleotides 1193-1798 of pCNC
1c).
The longest clone thus isolated carried nucleotides 1138-2916 of
pCNC
1c. The combined sequence of the partial clones (pCNC
P) did
not harbor the complete coding region (see Fig. 1 a). Because cDNA sequences were identical with the corresponding sequences of CNC
1a, the
5' end of testis
cDNA was probed by PCR using primers derived from
the CNC
1a sequence (for positions of primers, see Fig. 1 a). cDNA from
bovine retina was used as control for amplification. The initial primer set consisted of primer 1 (GGATGGATTCCAGGCGG; inverse complement of nucleotides 1305-1321 of pCNC
1c) as the 3' primer and primer 2 (TGCTCTGCTGCAAGTTCAAA; nucleotides 860-879) or primer 3 (GAACTGCAGGTGGAAGAC; nucleotides 370-387) as 5' primers. A
set of nested primers consisted of primer 4 (GGCGTTTGAACTTGCAGC; inverse complement of nucleotides 866-883) as 3' primer, and
primer 5 (AGCTCATCGACCCTGACG; nucleotides 728-745), primer 6 (GCAACCTCGACAGCCAGC; nucleotides 631-648), or primer 7 (CTCAAGATGCTGTCACCG; nucleotides 547-564) as 5' primers. For blot
hybridization, PCR fragments were hybridized under high-stringency conditions (5× SSC, 5× Denhardt's, 0.1 mg/ml denatured herring testis DNA,
0.1% SDS, 65°C) with 32P-labeled DNA probes (~106 cpm/ml). Filters
were washed with 1× SSC, 0.1% SDS at 65°C (2 × 30 min).
|
|
The PCR analysis demonstrated that short and long
transcripts are
expressed in testis. The 5' ends of the long
cDNAs were isolated by
modification of the rapid amplification of cDNA ends (RACE) technique
(Frohman et al., 1988
). Random-primed cDNA was (dA)-tailed. PCR was
carried out with the gene-specific primer R (CTTGGGGCTCTCCTCATCGG, inverse complement of nucleotides 752-771 of pCNC
1c; for
the location of primer R, see Fig. 1 a), the hybrid adapter primer GACTCGAGTCGACATCGA(T)17, and the adapter primer GACTCGAGTCGACATCGA. To enrich the desired PCR product, a second PCR was
carried out on the first PCR product using a nested gene-specific primer
(TTCCTGAGGCTCCCTGTGG; inverse complement of nucleotides 494-512 of pCNC
1c), and the adapter primer. PCR fragments >150 bp
were cloned into pBluescript SK-vector. Colonies were hybridized with a
DNA probe amplified with two primers (GAACTGCAGGTGGAAGAC, nucleotides 370-387 of pCNC
1c; TTCCTGAGGCTCCCTGTGG, inverse complement of nucleotides 494-512) using cDNA of
CNC
1a as template. We obtained several clones with three distinct 5'
ends: pCNC
1c (seven clones), pCNC
1d (two clones), and pCNC
1e
(three clones).
Attempts to clone the 5' end of the short
cDNA (CNC
1f) by screening
cDNA libraries were not successful. The PCR analysis, however, indicated
that the short
cDNA begins in the segment flanked by primers 5 and 6.
Northern Blot Analysis
A blot with poly(A)+ RNA from bovine testis (6 µg) and retina (10 µg) was hybridized under high-stringency conditions (50% formamide, 5× SSC, 5× Denhardt's, 0.1 mg/ml denatured herring testis DNA, 0.1% SDS, 65°C) with 32P-labeled riboprobes. Filters were washed with 1× SSC, 0.1% SDS at 65°C (2 × 30 min).
Polyclonal Antibodies Against CNG Channel Subunits
Polyclonal antibody FPc 21K is directed against the NH2-terminal domain
(aa 574-763) of the
' part of CNC
1a (Körschen et al., 1995
), whereas
polyclonal antibody PPc 32K is directed against an epitope (aa 1292-1334)
close to the COOH terminus of CNC
1a. Polyclonal antibody PPc 23 was
raised against the COOH-terminal domain (aa 593-706) of the
subunit
of the bovine cone CNG channel (CNC
2; Weyand et al., 1994
). Polyclonal antibodies were purified from rabbit serum by affinity chromatography on a column consisting of the respective antigen (3-5 mg) coupled
to activated CH-Sepharose 4B (Pharmacia Biotech, Inc., Piscataway, NJ).
The antibody was eluted with 0.1 M glycine HCl, pH 2.5, immediately
neutralized with 1/8 vol 1 M Tris HCl, pH 8.0, and dialyzed against PBS.
Purified antibodies were concentrated using a Centricon-100 spin column (Amicon Corp.) and stored at -80°C in the presence of 50% glycerol, 0.2 mg/ml BSA, 0.1% NaN3. The specificity of the antibodies in immunohistochemistry was tested on cryosections of bovine retina.
Western Blot Analysis
For transient expression, cDNAs for the short testis
subunit (CNC
1f)
and one of the long
subunits (CNC
1c) were cloned into pcDNAI vector (Invitrogen Corp., Carlsbad, CA). COS-1 cells were transfected by a
modified calcium phosphate coprecipitation method (Chen and Okayama,
1987
). Transfected COS-1 cells, bovine sperm, and testicular tissue were
homogenized in 10 mM Hepes, pH 7.5 (NaOH), 10 mM NaCl, 1 mM
DTT, 0.1 mM EGTA, 5 µg/ml aprotinin, 5 µg/ml leupeptin, 1 µg/ml pepstatin, 500 µg/ml PEFABLOC, and 10 mM benzamidine (buffer A). The
suspension was centrifuged at 100,000 g for 20 min (4°C). The membrane
pellet was resuspended in buffer A containing 500 mM NaCl, washed by
centrifugation, resuspended in buffer A containing 100 mM NaCl, and
0.8% N-dodecylmaltoside, and left on ice for 15 min. Insoluble material
was separated from solubilized membrane proteins by centrifugation
(8,000 g, 10 min, 4°C). Membranes of bovine rod outer segments were
washed two times with buffer A. Membrane proteins were separated by
SDS-PAGE, transferred to Immobilon-P membrane (Millipore Corp.,
Bedford, MA), and sequentially probed with primary antibodies and secondary HRP-coupled goat anti-rabbit antibody for enhanced chemiluminescence detection (Amersham Corp., Arlington Heights, IL).
Immunocytochemistry
Testicular and epididymal tissue.
Tissue blocks of bovine testes and epididymes were fixed in Bouin's fluid for 24 h at 20°C. Subsequently, blocks
were embedded in paraffin; 6-µm sections were cut and mounted on
chrome-gelatine precoated slides. Immunoreactivity was tested using a
combination of the peroxidase-antiperoxidase (PAP) technique and the
avidin-biotin-peroxidase complex (ABC) method (Middendorff et al.,
1996
). Sections were incubated for 24 h at 4°C with the primary antibodies
PPc 23 (0.3-3 µg/ml), FPc 21K (1-10 µg/ml), or PPc 32K (0.06-0.9 µg/ml)
diluted in PBS, 0.2% BSA, 0.25% Triton X-100, 0.1% NaN3. Peroxidase
activity was visualized by the nickel glucose oxidase technique (Záborsky and Léránth, 1985) with DAB as chromogen.
Sperm. Cauda epididymal sperm and ejaculated sperm were fixed on glass slides for 10 min with 4% paraformaldehyde, PBS, and were then washed twice with PBS. Cells were preincubated with PBS, 0.1% BSA, 1% Triton X-100, and 0.1% Tween-20 (30 min), and were then incubated overnight at 4°C with the primary antibody diluted in preincubation solution (PPc 23: 1-3 µg/ml; FPc 21K: 1-10 µg/ml; PPc 32K: 0.3-0.6 µg/ml). Cells were washed three times and incubated for 3 h with secondary goat anti-rabbit antibody coupled to a carboxymethylindocyanine dye (CY3) diluted 1:1,000 (1.5 µg/ml) in PBS, 2% FCS, 0.1% BSA, 1% Triton X-100, 0.1% Tween-20. After washing three times, cells were coverslipped in Moviol and examined by fluorescence microscopy.
Controls. Experiments were performed in the absence of primary (and in the case of tissue sections also of secondary or tertiary) antibodies. For control of specificity, primary antibodies were preadsorbed with an 80-fold molar excess of the respective immunogenic or an unrelated antigen.
Ca2+ Imaging Experiments
Pretreatment of sperm.
Cryoconserved ejaculated bovine sperm were
thawed (45 s, 37°C), diluted 10-fold with 200 mM Tris, 55 mM glucose, 65 mM citric acid monohydrate, pH 7.2 (NaOH), and washed twice by centrifugation (830 g, 4 min, room temperature). Sperm were resuspended in
buffer B (140 mM NaCl, 4.6 mM KCl, 2 mM CaCl2, 10 mM glucose, 10 mM
Hepes, pH 7.4 (NaOH), checked for motility (~60% progressive motile
cells), and then loaded in the dark for 30 min with the cell-permeant acetomethoxy ester of Fluo-3 (4.4 × 10
6 M in the presence of 0.01% Pluronic F-127; Molecular Probes, Inc., Eugene, OR). Sperm were centrifuged, washed (buffer B; 830 g, 4 min, room temperature), resuspended in
buffer B, and then put on coverslips. After 5 min, buffer B was carefully aspirated, and sperm were incubated (10 min) with the respective incubation solution containing the membrane-permeable caged cyclic nucleotide analogue (see below). Incubation solutions were: buffer B, buffer B with additives (see Results), or buffer B with 500 µM EGTA instead of 2 mM CaCl2.
Ca2+ imaging. Ca2+-dependent changes in fluorescence intensity of Fluo-3 were detected with a confocal laser scanning microscope LSM 410 invert (Zeiss GmbH, Jena, Germany) using an oil immersion lens (100/ 1.3). Fluo-3 was excited with an argon-krypton laser (488 nm; Melles Griot, Carlsbad, CA). Fluorescence was measured at wavelengths >515 nm. For beam-splitting, a dichroic mirror FT 510 and a cutoff filter LP 515 in front of the detector unit were used.
For flash photolysis experiments, lyophilized 4,5-dimethoxy-2-nitrobenzyl (DMNB) 8-pCPT-cGMP (axial isomer), (7-methoxy-coumarin-4-yl)methyl (MCM) 8-Br-cGMP (axial isomer), and MCM 8-Br-cAMP (axial isomer) were dissolved in DMSO and then diluted in the respective incubation solution to the desired final concentration. The final DMSO concentration (maximally 2%) had no detectable effect on the fluorescence intensity of sperm. Synthesis and photochemical properties of the caged compounds will be described elsewhere. Due to its limited solubility in aqueous solutions, DMNB 8-pCPT-cGMP was used at concentrations
50 µM.
DMNB 8-pCPT-cGMP was photolyzed with a continuous argon-ion laser (364 nm; Spectra-Physics, Darmstadt, Germany) that allowed local
UV irradiation of sperm. Therefore, UV-induced bleaching of Fluo-3 is
restricted to the illuminated region, and thus does not compromise determination of the Ca2+-induced increase of fluorescence in nonilluminated
regions. Either the proximal or the distal part of the flagellum was irradiated eight times by 8-ms UV flashes at intervals of 1 s. The change in fluorescence of Fluo-3 was measured 1 s after the last UV flash in various regions of the sperm (see legend to Fig. 7).
|
F, determined from measurements of 12 different sperm, was subtracted from the increase
in fluorescence measured in the presence of the caged compounds.
| |
Results |
|---|
|
|
|---|
One Short and Several Long
Subunit Transcripts are
Expressed in Testis
One short and three long cDNAs encoding
subunits of
CNG channels have been identified (see Materials and
Methods). The three cDNAs (pCNC
1c [3095 bp],
pCNC
1d [3102 bp], and pCNC
1e [3302 bp]) encoding
the long
subunits differ only in their 5'ends (see Fig. 1 a
and Fig. 2). A cRNA probe (for location of probe A, see
Fig. 1 a) specific for the 5' terminal region of the long
subunit cDNAs, hybridized to a transcript of ~3.3 kb in
testis poly(A)+ RNA (Fig. 1 b, lane T, left), and to ~7.4 kb
and ~4.4 kb transcripts in retinal poly(A)+ RNA (Fig. 1 b,
lane R, left). The retinal ~7.4-kb transcript codes for the
subunit of the CNG channel from rod photoreceptors (CNC
1a), and the ~4.4-kb transcript for a glutamic acid-
rich protein (GARP; Körschen et al., 1995
). The length of
the cDNAs (3095-3302 bp) is consistent with the idea that
the long
subunits are encoded by the ~3.3-kb transcript(s). For pCNC
1c and pCNC
1e, the translational
initiation sites were assigned to the first ATG triplet
downstream of a nonsense codon in the same reading frame. pCNC
1e harbors a second ATG triplet downstream
of the first triplet (see Fig. 2 c). In contrast to the first ATG
triplet, the second ATG triplet is flanked by a reasonably
well-conserved Kozak sequence (GCATCATGG), and
therefore represents a better translational initiation site than
the first triplet. Clone pCNC
1d does not contain a nonsense codon upstream of a putative translational initiation
site; therefore, the initiation site is not certain. The deduced
aa sequence of CNC
1c consists of 938 aa with a calculated molecular mass of ~104.5; pCNC
1e either encodes a polypeptide of 952 aa (~105.9 kD), or if the second ATG triplet
is used, a polypeptide of 941 aa (~104.8 kD). Biel et al.
(1996)
have identified a
subunit (CNG4c) from bovine testis by cloning cDNA that differs from CNC
1c by four aa
exchanges and an additional residue.
A cRNA probe derived from the
' part of the rod
subunit (for location of probe B see Fig. 1 a) in addition to
the ~3.3 kb transcript recognized a transcript of ~2.4 kb
in testis poly (A)+ RNA (Fig. 1 b, lane T, right) and, as expected, the ~7.4-kb transcript in retinal poly(A)+ RNA
(Fig. 1 b, lane R, right). The hybridization signal resulting from the ~2.4-kb transcript was much stronger than that
from the ~3.3-kb transcript, suggesting that at least two
transcripts of different size and abundance are expressed
in testis.
The 5' end of the ~2.4-kb transcript was obtained by
PCR. We used a set of primer pairs specific for the NH2-terminal region of the
' part of CNC
1a to amplify 5'-
located sequences (for positions of primers, see Materials
and Methods and Fig. 1 a). Using primer pairs 1/2 and 1/3,
fragments were amplified from testis cDNA that matched
in size and sequence the corresponding fragments amplified from retinal cDNA. Amplification with primer pair 1/2
was significantly stronger than with primer pair 1/3 (data
not shown). This result indicated that the 5' end of an abundant testis transcript is located between primers 2 and
3, and that a larger transcript is much less abundant as
demonstrated above by the Northern blot (Fig. 1 b, lane T,
right). Further PCR experiments with nested primer pairs
4/5, 4/6, and 4/7 (Fig. 1 c) indicated that the short abundant
transcript begins in the segment flanked by primers 5 and
6. The size of the cDNA ranging from this segment to the
poly(dA) tail of the partial clone pCNC
P (~2.4 kbp)
agrees well with the size of the short ~2.4-kb transcript, which suggests that the segment flanked by primers 5 and
6 is part of the 5' nontranslated region of the ~2.4-kb transcript. However, this segment is part of the open reading
frame in the cDNAs of the long testis
subunits. Perhaps
the ~2.4-kb transcript is produced by use of an alternative
promotor, as has been recently proposed for a short
transcript from human retina (Ardell et al., 1996
).
The cloned cDNA of the short
subunit variant
(CNC
1f) is similar to a cDNA isolated from a human retina library (hrCNC2a; Chen et al., 1993
; Ardell et al.,
1996
). Coexpression of hrCNC2a with the
subunit from
human rod photoreceptors gives rise to functional heterooligomeric channels (Chen et al., 1993
). We therefore assigned the translational initiation site of the short
subunit from testis to the corresponding triplet in hrCNC2a
(see second boxed ATG in Fig. 2 a). The deduced amino acid
sequence predicts a relative molecular mass of ~74.3.
The relationship between the
subunits from rod photoreceptor (CNC
1a) and testis (CNC
1c-f) is illustrated
in Fig. 1 a and Fig. 2. CNC
1a consists of a GARP part
and a
' part (Körschen et al., 1995
). While the
' part is
conserved, only a small COOH-terminal region of the
GARP part is left in the long variants CNC
1c-e. The
GARP part and some of the NH2-terminal region of the
'
part (Fig. 1 a) are missing in CNC
1f. The different NH2-terminal ends of CNC
1c-e are highlighted in Fig. 2.
Expression of
and
Subunits in Sperm and
Precursor Cells
The low expression level of the large transcripts in testis
raises the question as to what extent CNC
1c-e are expressed in sperm or precursor cells. Translation into the
respective polypeptides was examined by Western blot
analysis using two different antibodies (Fig. 3). Antibody
FPc 21K was raised against that NH2-terminal region of
the long
variants that is lacking in the short
form. This
antibody should only recognize the long
subunits. Antibody PPc 32K was directed against an epitope in the common COOH-terminal region, and therefore should recognize all forms of
subunits. FPc 21K proved to be
considerably more sensitive to
polypeptides than PPc
32K; in membranes of rod outer segments, FPc 21K stained the 240 kD
subunit and a less abundant ~105 kD isoform
(see legend to Fig. 3) more intensely than did PPc 32K, although FPc 21K was used at lower concentrations (Fig. 3,
compare ROS lanes). FPc 21K also recognized the heterologously expressed long
subunit, CNC
1c, much better
than did PPc 32K (Fig. 3, compare 
lanes). The heterologously expressed short testis
subunit (CNC
1f) is not
recognized by FPc 21K (Fig. 3, left, lane
s).
|
Western blot analysis of membrane proteins of cauda
epididymal sperm and testis did not provide evidence for a
polypeptide recognized by FPc 21K (Fig. 3, left, lanes S
and T). This failure to detect the long
subunits may either reflect a low expression level, as suggested by the
Northern blot (Fig. 1 b), or expression in a small subset of
testicular cells (see below).
In testicular membranes, the common antibody PPc 32K
recognized a weak band of ~130 kD (Fig. 3, right, lane T)
that was not detected by the more sensitive antibody FPc
21K. Therefore, we interpret the labeling as an unspecific
cross-reaction of PPc 32K. In contrast, in membranes of
cauda epididymal sperm (Fig. 3, right, lane S) and ejaculated sperm (not shown), antibody PPc 32K intensely labeled a polypeptide of ~80 kD. The Mr is similar both to
the calculated Mr and the apparent Mr of the heterologously expressed CNC
1f (Fig. 3, right, lane
s). The occurrence of two CNC
1f bands of ~76 and ~92 kD in
transfected COS-1 cells may reflect heterogeneity due to
posttranslational modifications. These results suggest, but
do not prove, that the prominent ~2.4 kb transcript (see
Fig. 1 b) encodes the short form of the
subunit.
The expression pattern of
and
subunits was examined
by immunohistochemistry on testicular sections (Fig. 4) and
epididymal sections (Fig. 5) using both the
subunit-
specific antibody PPc 23 and the
subunit-specific antibodies FPc 21K and PPc 32K. PPc 23 and PPc 32K stained sperm
and precursor cells. The staining pattern for both antibodies
varied among individual seminiferous tubules depending on
the stage of spermatogenesis (Fig. 4, a and b). Antibody PPc
23 stained flagella of sperm (arrowheads) and granules of
late spermatids (arrows, Fig. 4, a and c). Spermatogonia, spermatocytes, early spermatids, Sertoli cells, and intertubular cells were not labeled. The
subunit immunoreactivity
obtained by PPc 32K was already detectable in spermatocytes (Fig. 4, b and d, open arrows). PPc 32K stained late
spermatids (Fig. 4, b and d, arrows) and sperm flagella (Fig.
4 b, arrowhead) intensely. Spermatogonia, Sertoli cells, and
intertubular cells were not labeled. These results suggest that
subunits are expressed earlier in development than are
subunits. The more sensitive antibody FPc 21K did not label
testicular or epididymal sections (not shown). These results
together with the Western blot analysis demonstrate that the
expression level of the long
variants is in fact very low, and
that the short
subunit is the sole physiologically relevant
variant in spermatogenic cells.
|
|
Both PPc 23 (anti-
; Fig. 5, a and c) and PPc 32K (anti-
;
Fig. 5, b and d) intensely stained sperm inside the epididymal ducts. At a higher magnification, long threadlike
structures were resolved that most likely represent flagella
(Fig. 5 c). The specificity of the testicular and epididymal
staining was ascertained by preincubating the primary antibody with either the respective immunogenic or with an
unrelated antigen (not shown), as well as by omitting the
primary antibody (Fig. 4 e and Fig. 5 e). Under these control conditions, no specific staining was detected.
Spatial Distribution of
and
Subunits in
Mature Sperm
The staining patterns of epididymal sperm obtained by
anti-
and anti-
antibodies differed from each other (Fig.
5, c and d), suggesting that the surface distribution of
and
subunits is different. To test this hypothesis, the spatial expression pattern of subunits was studied by immunofluorescence microscopy on isolated sperm. The
subunit-specific antibody (PPc 23) stained almost the entire
flagellum of both cauda epididymal sperm (data not
shown) and ejaculated sperm (Fig. 6, a and c), whereas the
subunit-specific antibody (PPc 32K) stained the proximal part of the principal piece, but not the midpiece and
the distal part of the flagellum (Fig. 6, b and d). Neither
PPc 23 nor the PPc 32K stained the head. As expected
from the Western blot analysis (Fig. 3), FPc 21K did not
stain sperm, even at concentrations that were 15× higher
than those of PPc 32K (not shown). The differential expression pattern of
and
subunits along the flagellum
was confirmed using the PAP/ABC method (not shown).
Primary antibodies preincubated with the respective immunogenic antigen gave no staining (Fig. 6, e and f), as
well as the secondary antibody alone (not shown). From
these results we conclude that the
subunit is distributed along the entire flagellum, whereas the
subunit is restricted to the principal piece, suggesting that homo- and
heterooligomeric forms of the CNG channel coexist in mature sperm.
|
CNG Channel-mediated Ca2+ Influx Into Sperm
Owing to their substantial Ca2+ permeability, CNG channels are prime candidates for mediating Ca2+ entry into sperm. We investigated Ca2+ entry into sperm using confocal laser scanning microscopy (CLSM) in conjunction with the Ca2+ indicator Fluo-3 and novel caged cyclic nucleotides. The combination of high-resolution CLSM with fast and selective liberation of cyclic nucleotide analogues made it possible to demonstrate for the first time CNG channel-mediated Ca2+ influx into sperm.
Sperm loaded with Fluo-3 did not fluoresce uniformly at
rest (Fig. 7 A). The Fluo-3 fluorescence was stronger in the
acrosomal region and in some local areas of the midpiece
where mitochondria are located. This finding suggests that
the basal [Ca2+]i is higher in the acrosomal vesicle and in
mitochondria than in other cell compartments, consistent
with the idea that these organelles serve as intracellular
Ca2+ stores (Irvine and Aitken, 1986
; Meizel and Turner,
1993
).
Photolysis of both 4,5-dimethoxy-2-nitrobenzyl (DMNB)
8-Br-cGMP (Hagen et al., 1996
) and DMNB 8-pCPT-cGMP by UV light evoked a Ca2+ influx into sperm in
88% of the cells (n = 209/237). Because 8-pCPT-derivatives of cyclic nucleotides cross membranes more readily
than do 8-Br-derivatives (Butt et al., 1992
), DMNB
8-pCPT-cGMP was used to investigate the Ca2+ influx in
more detail by illuminating either the proximal or the distal region of the principal piece (see Materials and Methods and Fig. 7). In the absence of caged 8-pCPT-cGMP, no
change in fluorescence was observed in response to a UV
flash (Fig. 8, UV). This control experiment showed that
the increase of [Ca2+]i did not arise from UV-induced
damage of the plasma membrane, but was due to liberation of 8-pCPT-cGMP from the caged compound. In the
presence of 2 mM extracellular Ca2+, photoreleased
8-pCPT-cGMP evoked an increase of [Ca2+]i in the acrosomal (A) and postacrosomal (PA) region of the head, in the
midpiece (MP), and in the principal piece (PP) of the flagellum (Fig. 8, Ca2+). No increase of [Ca2+]i was detected
when the extracellular solution contained no Ca2+ and 500 µM EGTA (Fig. 8, 0 Ca2+). These results demonstrate that
the [Ca2+]i increase was caused by Ca2+ influx from outside
rather than by a release from intracellular Ca2+ stores.
|
A characteristic property of CNG channels is their blockage by extracellular Mg2+ (Weyand et al., 1994
; Frings et al.,
1995
). The 8-pCPT-cGMP-induced Ca2+ influx into sperm
is almost entirely suppressed by 15 mM extracellular Mg2+ (Fig. 8, Mg2+). Such a [Mg2+] is not expected to block
Ca2+ currents through voltage-activated Ca2+ channels
(McDonald et al., 1994
). Furthermore, sperm preincubated with high concentrations of blockers for voltage-activated
Ca2+ channels (25 µM D-cis-diltiazem; 2.5 µM verapamil)
did respond with an increase of [Ca2+]i to UV light (Fig. 8,
Dil, Ver). High concentration (1 µM) of staurosporine, an
inhibitor of cyclic nucleotide-dependent kinases, did not
suppress the 8-pCPT-cGMP-induced increase of [Ca2+]i
(Fig. 8, Sta). These results rule out the possibility that 8-pCPT-cGMP activates a Ca2+ conductance indirectly by
means of a protein kinase G-mediated phosphorylation. In
conclusion, we interpret these results to indicate that the
Ca2+ influx is due to activation of CNG channels.
Ca2+ Influx Into Sperm is More Sensitive to cGMP Than to cAMP
Although the heterologously expressed
subunit from
testis is ~200-fold more sensitive to cGMP than to cAMP,
in the native channel consisting of
and
subunits, the
ligand selectivity may be changed. Therefore, we investigated whether cGMP and cAMP differ in their efficacy to
evoke a Ca2+ influx into sperm. We used two novel caged
compounds
MCM 8-Br-cGMP and MCM 8-Br-cAMP
that differ only marginally in their aqueous solubilities
(
100 µM) and their photolytic quantum yields (Hagen et
al., manuscript in preparation). Therefore, differences between these compounds in their efficacy to evoke a Ca2+
influx must be attributed to a difference in their apparent
ligand affinity for the CNG channel.
Fig. 9 shows the increase of fluorescence intensity in
sperm at various concentrations of either MCM 8-Br-cGMP
or MCM 8-Br-cAMP. Over a large concentration range of
MCM 8-Br-cAMP (10
6-10
4 M), a small progressive increase of [Ca2+]i was detected after liberating 8-Br-cAMP.
In contrast, photolysis of MCM 8-Br-cGMP induced much
larger increases of [Ca2+]i than did MCM 8-Br-cAMP at
the respective concentrations. For example, at 100 µM,
photolysis of MCM 8-Br-cGMP produced a six- to sevenfold increase of fluorescence intensity in the principal piece (PP), whereas photolysis of MCM 8-Br-cAMP increased the fluorescence intensity only ~1.8-fold. Although these experiments do not allow an estimate of the
apparent ligand sensitivity of the native channel, the
higher efficacy of 8-Br-cGMP to increase [Ca2+]i compared with 8-Br-cAMP agrees well with the high selectivity of the heterologously expressed
subunit for cGMP
compared with cAMP. These findings suggest that native
CNG channels represent the target of a cGMP-signaling
pathway that controls Ca2+ entry into sperm.
|
| |
Discussion |
|---|
|
|
|---|
We have provided evidence that CNG channels are located on the flagellum and serve as a Ca2+ entry pathway
in sperm. The dissimilar expression of
and
subunits
along the flagellum suggests that homo- and heterooligomeric channels coexist in vivo. The physiological implications of these findings are addressed in the following discussion.
Testicular
Subunits
A short (~2.4 kb) and several long (~3.3 kb) less abundant transcripts of the
subunit are expressed in testis.
Western blotting and immunocytochemistry failed to detect long
subunits in sperm as well as in testicular precursor cells; therefore, these subunit species must be expressed at a rather low level if at all.
The 80-kD
subunit (CNC
1f) expressed in sperm is
probably encoded by the ~2.4-kb transcript. Although we
were unable to identify unequivocally the 5' nontranslated
region of the ~2.4-kb transcript, both the short
clone
and a similar
clone isolated from a human retinal library
(Chen et al., 1993
; Ardell et al., 1996
) produce functional
polypeptides in a cell line (Chen et al., 1993
; J. Weiner and
F. Müller, unpublished data). Whether the ~2.4-kb transcript is generated by use of an alternative promotor as recently proposed for the short
transcript from human retina (Ardell et al., 1996
), is not known. However, genes that
are expressed in testis and other tissues often give rise to
testis-specific transcripts that are generated by using testis-specific promotors, altered polyadenylation, and alternative exon splicing (Erikson, 1990).
CNC
1f is lacking the entire GARP part and a significant NH2-terminal portion of the
' part of the rod
subunit (CNC
1a). An unconventional CaM-binding site that
exists in this NH2-terminal region of CNC
1a (see Fig. 1 a)
controls ligand sensitivity (Grunwald et al., 1998
; Weitz
et al., 1998
). The decrease of the apparent ligand sensitivity by Ca2+/CaM in rod photoreceptors has been proposed
to represent a feedback mechanism that terminates the
light response and participates in the recovery process after stimulation (for review see Molday, 1996
). The NH2-terminal CaM-binding site is absent in CNC
1f. Therefore, potential modulation of the sperm CNG channel by
Ca2+/CaM cannot occur through the
subunit. The sperm
subunit contains in its NH2-terminal region a segment
that is highly homologous to a conventional CaM-binding
site that is also present in the
subunit of olfactory CNG
channels. However, no modulation by Ca2+/CaM was observed for human and bovine CNC
2 channels (Yu et al., 1996
; Bönigk et al., 1996
; for another review see Biel et al., 1996
). Gordon and coworkers (1995) provided some evidence that an unknown Ca2+-dependent factor, in addition
to or instead of CaM, may control CNG channel activity in
rod photoreceptors. An unknown factor may also control
activtity of the sperm CNG channel. Expression of
CNC
1f in sperm may be physiologically important.
Sperm contain sizeable amounts of CaM, and Ca2+/CaM-dependent activation of axonemal proteins play a crucial role in regulating motility (for review see Tash, 1990
).
Lack of CaM-binding sites in CNC
1f may reflect a specific cellular adjustment to preclude a Ca2+/CaM-dependent regulation of CNG channel activity in sperm, and perhaps expression of a short
form ensures that the
channel is specifically modulated by its cognate modulatory factor.
Physiological Implications of Differential Distribution of cGMP-gated Channel Forms
A significant finding of this study concerns the cGMP-specific Ca2+ influx into sperm through CNG channels. Numerous studies have emphasized the importance of cAMP
as an internal messenger in vertebrate sperm, whereas
cGMP has been considered an orphan molecule. For example, a rise in cAMP has been proposed to promote
phosphorylation of flagellar proteins by protein kinase
A, thereby regulating sperm motility (Tash, 1990
). The
cGMP levels in vertebrate sperm are low (Gray et al.,
1976
), and neither a membrane-bound nor a soluble guanylyl cyclase have been convincingly identified. The presence of a CNG channel that is considerably more sensitive to cGMP than to cAMP strongly argues for a physiological
function of cGMP as signaling molecule in vertebrate
sperm. Furthermore, exclusive localization of the CNG
channel in the flagellum favors a role in the regulation of
motility rather than in the control of acrosomal exocytosis.
However, high concentrations of cGMP (or cAMP) may
evoke an elevation of [Ca2+]i that is propagated to the
head. This increase of [Ca2+]i could eventually induce
acrosomal exocytosis.
The sperm surface is divided into distinct domains, each
characterized by a specific protein inventary (Myles et al.,
1981
; Cowan and Myles, 1993
). The segmental distribution
of
and
subunits along the flagellum nicely fits the idea
of a sectorial organization of the flagellum. In particular,
the areas of subunit expression coincide with the segmentation of flagellum based on morphological criteria. While
the midpiece and the distal part of the principal piece
harbor only the
polypeptide, the proximal part of the
principal piece harbors
and
polypetides. These results
suggest that CNG channels coexist as homo- and heterooligomers in vivo, although we can not rigorously preclude
that additional as yet unknown subunits participate in the
formation of heterooligomeric complexes.
The dissimilar distribution of
and
polypeptides
along the flagellum may have important physiological implications. The pore region located between transmembrane segments S5 and S6 of all
subunits comprises a
negatively charged glutamate or aspartate residue that is
crucially important for ionic selectivity, gating, and channel blockage by extracellular Ca2+(Root and MacKinnon,
1993
; Eismann et al., 1994
; Sesti et al., 1995
). This residue
is replaced by a glycine residue in the pore region of
subunits. As expected, both Ca2+ blockage and ionic selectivity of heterooligomeric rod channels (consisting of
and
subunits) are different from those of homooligomeric
subunits (Körschen et al., 1995
). Similarly, the homooligomeric
subunit cloned from testis (CNC
2) and heterooligomeric channels (CNC
2 + CNC
1c) differ markedly
in their blockage by extracellular Ca2+ (J. Weiner and R. Seifert, unpublished results). It is plausible that the
subunit also modifies Ca2+ permeability, although that has not
yet been experimentally demonstrated. If so, a regional
expression of CNG channel subtypes with different Ca2+
permeability is expected to create Ca2+ microdomains.
Tuning [Ca2+]i along the flagellum may provide a molecular basis for regulating sperm motility. In fact, the behavioral response of sperm induced by chemoattractive factors depends on external Ca2+, as has been shown for a
variety of invertebrates (for review see Cosson, 1990
).
Moreover, oscillating changes in [Ca2+]i occur in hamster
sperm during hyperactive motility (Suarez et al., 1993
).
This study provides the first evidence that motility of sperm may be regulated by Ca2+ entry through CNG channels. It will be crucially important for future work to examine whether uneven distribution of CNG channel subtypes in fact gives rise to a spatiotemporal pattern of flagellar [Ca2+]. Moreover, it needs to be shown that this pattern provides the molecular basis for modulating sperm swimming behavior.
| |
Footnotes |
|---|
Received for publication 30 December 1996 and in revised form 5 June 1998.
Burkhard Wiesner and Jocelyn Weiner contributed equally to this work.We thank Drs. A. Baumann, W. Bönigk, J.E. Brown, E. Eismann, S. Frings, and H.G. Körschen for critical reading of the manuscript, H.G. Körschen for the gift of antibodies, and S. Gotzes for testing antibodies on retinal sections. We thank M. Bruns, B. Gentsch, M. Jetten, J. Lossmann, and B. Oczko for technical assistance, and A. Eckert for preparing the manuscript. We express our gratitude to Dr. K.-H. Wrobel (Regensburg) and Dr. M. Davidoff (Hamburg) for helpful comments on the immunohistochemistry of bovine testis, and we acknowledge a gift of ejaculated bull sperm by Dr. A. Görlach (Kleve).
This work was supported by grants from the Deutsche Forschungsgemeinschaft to I. Weyand and V. Hagen and the Ministerium für Wissenschaft und Forschung des Landes Nordrhein-Westfalen to U.B. Kaupp.
| |
Abbreviations used in this paper |
|---|
aa, amino acid residue; CNC, cyclic nucleotide-gated channel; CNG, cyclic nucleotide-gated; DMNB, 4,5-dimethoxy-2-nitrobenzyl; GARP, glutamic acid-rich protein; MCM, (7-methoxy-coumarin-4-yl)methyl.
| |
References |
|---|
|
|
|---|
| 1. |
Ardell, M.D.,
I. Aragon,
L. Oliveira,
G.E. Porche,
E. Burke, and
S.J. Pittler.
1996.
The subunit of human rod photoreceptor cGMP-gated cation channel is generated from a complex transcription unit.
FEBS Lett
389:
213-218
[Medline].
|
| 2. |
Arnoult, C.,
Y. Zeng, and
H.M. Florman.
1996.
ZP3-dependent activation of
sperm cation channels regulates acrosomal secretion during mammalian fertilization.
J.Cell Biol
134:
637-645
|
| 3. |
Aviv, H., and
P. Leder.
1972.
Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose.
Proc. Natl.
Acad. Sci. USA.
69:
1408-1412
|
| 4. |
Biel, M.,
X. Zong,
A. Ludwig,
A. Sautter, and
F. Hofmann.
1996.
Molecular
cloning and expression of a modulatory subunit of the cyclic nucleotide-gated cation channel.
J. Biol. Chem
271:
6349-6355
|
| 5. |
Bönigk, W.,
F. Müller,
R. Middendorff,
I. Weyand, and
U.B. Kaupp.
1996.
Two
alternatively spliced forms of the cGMP-gated channel -subunit from cone
photoreceptor are expressed in the chick pineal organ.
J. Neurosci
16:
7458-7468
|
| 6. | Bradley, J., J. Li, N. Davidson, H.A. Lester, and K. Zinn. 1994. Heteromeric olfactory cyclic nucleotide-gated channels: A new subunit that confers increased sensitivity to cAMP. |