|
||
-Tubulin




* Department of Molecular Biology,
Department of Surgery, and ¶ Department of Neurosurgery, Graduate School of Medical
Science, Kyushu University, Fukuoka 812-82, Japan; § Laboratory of Cellular and Molecular Biology, The Institute of Physical
and Chemical Research (RIKEN) 2-1 Hirosawa, Wako, Saitama 351-01, Japan; ** Inheritance and Variation Group,
PRESTO, Japan Science and Technology Corporation, Kyoto 619-0237, Japan; and
Department of Biophysics, Faculty of
Science, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan
| |
Abstract |
|---|
|
|
|---|
A novel human protein with a molecular
mass of 55 kD, designated RanBPM, was isolated with
the two-hybrid method using Ran as a bait. Mouse and
hamster RanBPM possessed a polypeptide identical to
the human one. Furthermore, Saccharomyces cerevisiae
was found to have a gene, YGL227w, the COOH-terminal half of which is 30% identical to RanBPM. Anti-RanBPM antibodies revealed that RanBPM was localized within the centrosome throughout the cell cycle. Overexpression of RanBPM produced multiple spots
which were colocalized with
-tubulin and acted as
ectopic microtubule nucleation sites, resulting in a reorganization of microtubule network. RanBPM cosedimented with the centrosomal fractions by sucrose-
density gradient centrifugation. The formation of
microtubule asters was inhibited not only by anti-
RanBPM antibodies, but also by nonhydrolyzable
GTP-Ran. Indeed, RanBPM specifically interacted
with GTP-Ran in two-hybrid assay. The central part of
asters stained by anti-RanBPM antibodies or by the
mAb to
-tubulin was faded by the addition of GTP
S-Ran, but not by the addition of anti-RanBPM anti-
bodies. These results provide evidence that the Ran-binding protein, RanBPM, is involved in microtubule
nucleation, thereby suggesting that Ran regulates the
centrosome through RanBPM.
-tubulin;
Ran;
RanBPM;
YGL227w
| |
Introduction |
|---|
|
|
|---|
RAN is a Ras-like nuclear small GTPase (Bischoff and
Ponstingl, 1991a
). The hydrolysis of GTP-Ran is
enhanced by the RanGTPase-activating protein,
RanGAP1/Rna1p (Bischoff et al., 1994
, 1995
) and the nucleotide exchange on Ran is carried out by RCC1 (Bischoff and Ponstingl, 1991b
). RanGAP is located within the
cytoplasm (Matunis et al., 1996
; Mahajan et al., 1997
),
whereas RCC1 is localized on the chromatin (Bischoff and
Ponstingl, 1991a
; Ohtsubo et al., 1989
). Therefore, GTP-Ran created by the aid of RCC1 in the nucleus must be
transferred to the cytoplasm in order to hydrolyze the
GTP of Ran, although there still exists the possibility that
RanGAP proteins are present within the nucleus (Cheng
et al., 1995
; Traglia et al., 1996
). The notion that Ran shuttles between the nucleus and the cytoplasm is consistent
with the finding that Ran functions as a carrier for nucleus/
cytosol exchange of macromolecules (for review see
Moore and Blobel, 1994
; Melchior and Gerace, 1995
, 1998
;
Görlich and Mattaj, 1996
; Nigg, 1997
; Görlich, 1998
;
Wonzniak et al., 1998
).
In addition to nucleocytoplasmic transport, Ran is
thought to be involved in ribosomal RNA processing
(Mitchell et al., 1997
), and cell cycle regulation (for review
see Dasso, 1993
; Seki et al., 1996
). The tsBN2 cell line, a
temperature-sensitive (ts)1 rcc1 mutant of the hamster
BHK21 cell line, shows either G1 arrest or premature
chromatin condensation, depending on the phase of the
cell cycle at which cultures start to be incubated at the nonpermissive temperature (Nishimoto et al., 1978
; Nishitani et al., 1991
). A ts mutant of the Schizosaccharomyces
pombe RCC1 homologue, pim1-D1, is arrested with condensed chromatin at the nonpermissive temperature
(Sazer and Nurse, 1994
). On the other hand, a ts mutant of
the Saccharomyces cerevisiae RCC1 homologue PRP20,
srm1-1, which was isolated as a mutant involved in the mating signal transduction pathway (Clark and Sprague,
1989
) is arrested in the G1 phase at the nonpermissive
temperature, whereas other prp20 alleles have a defect in
mRNA export and do not demonstrate the cell cycle-specific arrest (Aebi et al., 1990
; Kadowaki et al., 1993
). It is a
matter of debate as to how to explain the cell cycle defects
of rcc1/pim1-D1/srm1-1.
To clarify the downstream events of RanGTPase cycle,
a series of Ran-binding proteins has been identified
(Sazer, 1996
; Avis and Clarke, 1996
). The family of proteins possessing the RanBP1 domain (Dingwall et al.,
1995
), and the importin
family (Görlich et al., 1997
) are
currently well known. Both RanBP1 (Coutavas et al.,
1993
) and its yeast homologue, Yrb1p, which are functionally exchangeable (Noguchi et al., 1997
), are located
within the cytoplasm (Schlenstedt et al., 1995
; Richards et
al., 1996
). RanBP2 which possesses four RanBP1 domains
is located on the cytoplasmic filament of the nuclear pore
complexes (Melchior et al., 1995
; Wu et al., 1995
; Yokoyama et al., 1995
). Yrb2p, yet another member of the S.
cerevisiae RanBP1 family (Noguchi et al., 1997
; Taura et
al., 1997
), and its human homologue RanBP3 (Mueller et
al., 1998
), are localized within the nucleus. Recently,
Yrb2p was shown to be required for nuclear protein export (Taura et al., 1998
) (Noguchi, E., Y. Saitoh, S. Sazer,
and T. Nishimoto, manuscript in preparation). The importin
family (Görlich et al., 1997
) could be divided into importins and exportins (for review see Ullman et al., 1997
; Weis, 1998
). The former is required for nuclear protein import and the latter for nuclear protein export. Ntf2/p10, which
binds to GDP-Ran, is the other Ran-binding protein required
for nuclear protein import (Paschal and Gerace, 1995
;
Corbett and Silver, 1996
; Nehrbass and Blobel, 1996
).
On the other hand, Dis3p which binds to GTP- and
GDP-bound Ran (Noguchi et al., 1996
; Shiomi et al.,
1998
), does not seem to be involved in nuclear pore transport function. Dis3p was originally isolated as a cold-sensitive mutation involved in mitotic progression (Ohkura et
al., 1988
; Kinoshita et al., 1991
). The finding that Dis3p exists in an oligomeric form (Kinoshita et al., 1991
; Noguchi et al., 1996
) is consistent with the recent report that Dis3p corresponds to Rrp44p, which comprises the exosomes
that are required for the 3' processing of the 5.8S rRNA
(Mitchell et al., 1997
). Indeed, S. cerevisiae Dis3p is localized within the nucleolus (Shiomi et al., 1998
). In this
study, we found another Ran-binding protein, designated
as RanBPM. Surprisingly, RanBPM was localized within
the centrosome throughout the cell cycle.
The centrosome organizes microtubules during both the
interphase and mitosis (for review see Kalt and Schliwa,
1993
). It consists of a pair of centrioles (Lange and Gull,
1995
), surrounded by a complex collection of proteins
known as the pericentriolar material (PCM) (Kellogg et al.,
1994
). The criterion for the classification as a centrosomal
component is basically its localization within the central
body. The
-tubulin (Oakley and Oakley, 1989
) is one of
the important centrosomal residents which is conserved
through evolution (Kalt and Schliwa, 1993
; Kellogg et al.,
1994
; Stearns and Winey, 1997
). Several proteins interacting directly or indirectly with the
-tubulin-like Tub4p of
S. cerevisiae have been identified to comprise the spindle
pole body (SPB), the functional equivalent of the centrosome in S. cerevisiae (Rout and Kilmartin, 1990
; Osborne et al., 1994
; Geissler et al., 1996
; Kilmartin and Goh, 1996
; Bullitt et al., 1997
; Knop et al., 1997
; Knop and
Schiebel, 1998
). The SPB of S. cerevisiae is a multilayered
cylinder embedded in the nuclear enveloped (Bullitt et al.,
1997
) and the Tub4p locates at both cytoplasmic and nuclear sides (Knop and Schiebel, 1998
). In animal cells, two
centrioles in the centrosome is suggested to be surrounded
by an intricate lattice structure containing pericentrin
(Dictenberg et al., 1998
). The
-tubulin is localized in the
cytoplasm as the form of the
-tubulin ring complex
(
-TuRC) which is recruited to the centrosome scaffolds
and acts as an active microtubule-nucleating unit (Stearns
and Kirschner, 1994
; Zheng et al., 1995
; Moritz et al.,
1995a
,b). Thus, the centrosome is comprised of the materials, such as
-TuRC, which can be removed by salt, and
the salt-stripped scaffolds possessing a lattice structure.
The salt-stripped centrosome scaffolds recovers microtubule organizing potential when treated with high-speed oocyte
extracts (Schnackenberg et al., 1998
). Moritz et al. (1998)
suggested that a factor in addition to the
-TuRC is necessary for reassembly of the functional centrosomes. Such a
factor could induce an ectopic microtubule nucleation like
-tubulin (Shu and Joshi, 1995
). Our results showed that
RanBPM can induce an ectopic microtubule nucleation when overexpressed. The centrosome controls cell reproduction which is fundamental to the life. Such activity depends upon precise control of its own duplication (Kalt
and Schliwa, 1993
). The questions as to how many proteins
comprise the centrosome and how the centrosome regulates cell division and its own duplication remain a mystery. Our present results suggest that RanBPM is a novel
centrosomal protein and that Ran regulates the centrosomal function through RanBPM.
| |
Materials and Methods |
|---|
|
|
|---|
Cells and Cell Culture
The HeLa cell line is derived from human uterine cervical carcinoma, and
MRC5 is a primary human cell culture. COS7 cells expressing the SV-40
early gene are derived from a green monkey cell line CV1 (Gluzman,
1981
). CHO-k1 cells are derived from the Chinese hamster. Cells were
cultured in Dulbecco's modified Eagle's medium (DME) (NIPRO Hymedium; Sigma Chemical Co., St. Louis, MO) supplemented with 10% fetal
bovine serum (Sigma Chemical Co.) in a humidified atmosphere containing 10% CO2.
Cells on glass coverslips cultured in dishes (35-mm-diam) were transfected with 1 µg of plasmid DNA using the Lipofectamine protocol (GIBCO BRL, Gaithersburg, MD). The efficiency of transfection was usually ~5%.
Construction of RanBPM Plasmids
1.5 kb of human RanBPM-ORF carried in the plasmid containing RanBPM cDNA cloned was amplified by PCR using as the 5' primer: 5' AAGGTCGACACATGAATAGACTACCAGGTTGG 3', and as the 3' primer: 5' CGCAAGCTTTTCAAATCAGCAGAGCTAGTC 3'. The resultant DNA fragment was digested with the restriction enzymes SalI and HindIII, and inserted into the Sal1/HindIII sites of pET28, resulting in pET28-RanBPM, which express RanBPM tagged with T7 at the NH2 terminus.
pcDEB-T7-RanBPM: 1.7 kb of T7-RanBPM was excised from pET28-
RanBPM with the restriction enzymes XbaI and HindIII, then inserted
into the XbaI and HindIII sites of the pcDEB vector (Hayakawa et al.,
1990
) which had been digested with XbaI and HindIII enzymes, resulting
in pcDEB-T7-RanBPM.
pAS404-RanBPM: 1.5 kb of RanBPM containing the open reading
frame (ORF) was amplified by PCR using as the primers, 5' AGGGTCGACCATGAATAGACTACCAGGTTGG 3', and 5' CGCAAGCTTTTCAAATCAGCAGAGCTAGTC 3', digested with the HincII enzyme,
and then inserted into the Sma1 site of the pAS404 vector derived from
pAS1 (Durfee et al., 1993
).
pACTII-RanG19V/pACTII-RanT24N: 1.3 kb of the fragments containing Ran were excised with the restriction enzymes NcoI and BamHI from pET8c-RanG19V and pET8c-RanT24N (Dasso et al., 1994
), and inserted into the NcoI and BamHI sites of pACTII (Durfee et al., 1993
).
5' Rapid Amplification of cDNA Ends
To amplify the 5' end of RanBPM cDNA, three kinds of the primers consisting of the RanBPM nucleotides 186-212, 219-245, or 907-936 were prepared based on the nucleotide sequence of RanBPM (GenBank/ EMBL/DDBJ accession number AB008515). Using these primers, human cDNAs were amplified either from mRNA-isolated HeLa cells by AmpliFINDER RACE kit (Clontech, Palo Alto, CA) and then by TaKaRa EX Taq (TaKaRa, Otsu City, Shiga, Japan) or from Human Burkitt Lymphoma cDNA library with Marathon-Ready cDNA kit (Clontech) and then by TaKaRa LA Taq (TaKaRa).
Northern Analysis
RNA filters were prepared as described previously (Yokoyama et al.,
1995
) and prehybridized with 100 µg/ml of salmon sperm DNA at 42°C for
2 h in buffer containing 0.5% SDS, 50% formamide, 5× SSPE (0.15 M
NaCl, 10 mM NaH2PO4, pH 7.4, 1 mM EDTA), 5× Denhardt's solution,
and then incubated with 32P-labeled cDNA for 24-48 h. After hybridization, the filters were washed in the following manner: twice in 2× SSPE
plus 0.5% SDS for 30 min at room temperature, twice in 0.1× SSPE plus
0.5% SDS for 30 min at 70°C , and then once in 2× SSPE at room temperature. Finally, filters were dried and subjected to autoradiography.
Preparation of Anti-RanBPM
The antibodies to RanBPM, against the peptide FDIEDYMREWRTKIQ
were prepared in the rabbit as described (Nakashima et al., 1993
) and then
affinity purified by using antigenic peptide-coupled Sepharose columns.
Indirect Immunofluorescence Microscopy
Cells on coverslips were washed for 15 s at 37°C with microtubule stabilization buffer (0.1 M Pipes, pH 6.9, 1 mM EGTA, 4 M glycerol, and 1 mM
GTP) as described (Shu and Joshi, 1995
), incubated for 1 min at 37°C in
the same buffer containing 0.5% Triton X-100, rinsed with microtubule
stabilization buffer, and then plunged into methanol at
20°C for 5 min.
After fixation, cells were rehydrated in PBS and doubly stained with the
primary antibodies; the mAb to T7-tag (Novagen, Madison, WI),
-tubulin (N356; Amersham Pharmacia Biotech, Piscataway, NJ) or
-tubulin (T6557; Sigma Chemical Co.), and with rabbit affinity-purified anti-
-tubulin antibodies (Masuda et al., 1996) or RanBPM. After staining, the
antibodies were diluted with PBS-T (PBS containing 0.1% Tween 20) for
1 h at room temperature. After rinsing with PBS-T, cells were stained for
45 min at room temperature with the secondary antibodies, fluorescein
isothioyanate (FITC)-conjugated goat anti-mouse IgG (AMI3408; Biosource) or anti-rabbit IgG (ALI3408; Biosource, Camarillo, CA), Texas
red-conjugated goat anti-rabbit IgG (55675; Cappel, Malvern, PA), or
anti-mouse IgG (N2031; Amersham). Cells were finally stained with
Hoechst 33342 and then mounted on Vectashield (Vector, Burlingame, CA).
Microscopy and Image Analysis
Zeiss Axio Photo (Carl Zeiss Inc., Thornwood, NY) was used with the standard microscopic method. Digital imaging of stained cells was obtained using the laser-scanning microscope, Zeiss LSM 310 (Carl Zeiss Inc.) or Olympus LSM-GB200 system (Tokyo, Japan), and printed by pictrography 3000 (Fujix Tokyo, Japan) through Adobe PhotoshopTM 3.0J (Adobe Systems Inc., San Jose, CA).
Isolation of Centrosomes
Isolation of centrosomes from HeLa cells and CHO cells was carried out
in accordance with previous method (Bornens et al., 1987
) but with some
minor modifications. Cultured HeLa or CHO cells were incubated with 10 µg/ml nocodazole and 5 µg/ml cytochalasin B for 2 h, rinsed with isolation
buffer (1 mM Tris, pH 8, 0.5 mM EGTA, 0.1%
-mercaptoethanol), and
then lysed by swaying the dishes in isolation buffer containing 0.5% NP-40, at 4°C for 10 min. Next, a one-fiftieth volume of PE buffer (0.5 M
Pipes, pH 7.2, 0.1 M EGTA) was added to the extract which was then subjected to the discontinuous sucrose density gradient set in an SRP28-SA tube (Hitachi, Tokyo, Japan) with 3.5 ml of 60% sucrose (wt/wt), 3.5 ml of
40% sucrose (wt/wt) prepared in 20 mM Pipes, pH 6.8, 0.5 mM MgCl2, 1 mM
EGTA and 0.1%
-mercaptoethanol, and run at 14,500 rpm for 1 h. Fractions were collected from the bottom and analyzed for microtubule nucleation ability as follows, according to Mitchison and Kirschner (1984)
.
1 µl of each fraction was incubated with 12.5 µl of tubulin solution (40 mM tubulin of porcine brain, 80 mM Pipes, pH 6.8, 1 mM MgCl2, 1 mM EGTA and 1 mM GTP) at 37°C for 10 min. Microtubules were fixed by adding glutaraldehyde, sedimented onto poly-L-lysine-coated coverslips, and then subjected to immunofluorescence. Using Zeiss Axio Photo (Carl Zeiss Inc.), the aster possessing more than 10 microtubules was counted. We counted the total number of the asters formed on a coverslip three times. The mean value and the standard deviation (SD) of the obtained numbers are shown in the text.
Preparation of Ran and Its Derivatives
E. coli-produced wild-type and mutated Ran proteins were prepared as
described (Dasso et al., 1994
).
Immunoblotting Analysis
Cells were lysed in buffer containing 62.5 mM Tris-HCl, pH 6.8, 100 mM
dithiothreitol, 2% (wt/vol) SDS, and 10% glycerol. Cellular proteins were
electrophoresed in an SDS-12% polyacrylamide slab gel, transferred to a
polyvinylene difluoride (PVDF) membrane and probed with antibodies as
described previously (Nakashima et al., 1993
).
| |
Results |
|---|
|
|
|---|
Isolation and Identification of RanBPM
The human cDNA clone B8 was isolated by the two-hybrid method using human Ran as a bait (Yokoyama et
al., 1995
). Northern analysis using the B8 clone as a probe
revealed the presence of a 3.1-kb mRNA in human HeLa
cells (Fig. 1 A). Subsequently, the human cDNA library
was screened using the cDNA clone B8 as the probe. Finally, the cDNA clone of 2.8 kb, whose nucleotide sequence has been deposited as GenBank/EMBL/DDBJ accession number AB008515, was isolated. Since there was
no stop codon at the site upstream from the first methionine, we repeatedly carried out 5' RACE using as primers
the nucleotides localized either near the 5' end or the middle of the RanBPM cDNA. But there was no cDNA
clones extended from the 5' end of RanBPM cDNA. We
concluded the ORF of RanBPM (Fig. 1 B) to consist of
500 amino acid residues, encoding a protein with a calculated molecular mass of 55,079 Da.
|
To identify the protein encoded by the isolated cDNA clone, the antibody was prepared against the peptide of the putative ORF highlighted in Fig. 1 B, shaded box. The obtained serum was purified by the affinity column to the peptide used as the antigen. Total cell extracts were prepared from cultures of human HeLa and MRC5 cell lines, and then subjected to immunoblotting analysis using the affinity-purified antibodies. In both cell extracts, a major band of protein with a molecular mass of 55 kD that is consistent with the molecular mass calculated based on the putative ORF, was specifically recognized (Fig. 1 C). The higher bands of 57 kD which were also specifically recognized by the antibodies (Fig. 1 C, compare lanes 1 with 3), could in fact be modified forms of the protein encoded by the putative ORF or other proteins cross-reactive to the antibodies. Although the absence of in-frame termination codons upstream allows for the possibility of a small extension at the NH2 terminus, we concluded that the putative ORF encodes a predicted protein of 55 kD, designated as RanBPM.
RanBPM Is Well Conserved through Evolution
By homology search, several mouse cDNA fragments, the accession numbers of which are shown in Fig. 1 B, were found to encode a section of RanBPM. The amino acid sequences deduced from these mouse cDNA fragments are 100% identical to those deduced from human RanBPM, indicating that RanBPM is well conserved among mammalians. To confirm this issue, the library of hamster cDNA was screened for RanBPM cDNA. The isolated cDNA fragment encoded a polypeptide that is identical to human RanBPM (Fig. 1 B, dotted arrows).
By BLAST search, we found that the COOH-terminal
half of the S. cerevisiae ORF; YGL227w, is highly homologous to the human RanBPM. Percent amino acid identity
of RanBPM with YGL227w is 29.8% and the probability
that such sequence similarity is realized by chance is less
than 10
13, when calculated as described (Toh et al., 1983
).
In particular, the amino acid sequence of RanBPM (1-78)
is homologous to the SPRY domain found in several proteins, although its function remains unknown (Schultz and
Bork, 1997
).
Cellular Localization of RanBPM
Immunoblotting analysis using the affinity-purified anti-RanBPM antibodies showed that whereas several protein
bands were recognized in the extracts of HeLa cells, only a
single band of 55 kD was recognized in the extracts of
MRC5 cells. To determine the cellular localization of RanBPM, cultures of MRC5 cells were doubly stained with the
affinity-purified anti-RanBPM antibodies (red) and the
mAb to
-tubulin (green) (Fig. 2 A). When both staining patterns overlapped, the microtubule was found to be nucleated from the matrix which was stained with the affinity-purified anti-RanBPM antibodies. These results suggested that the protein encoded by the B8 clone was
localized within the centrosome, and thereby RanBPM
stands for Ran-binding protein in MTOC.
|
To confirm that RanBPM was localized in the centrosome, cultures of MRC5 cells were doubly stained by
the affinity-purified anti-RanBPM antibodies (red) and by
the mAb to
-tubulin (green) (Fig. 2 B). When superimposed, the color changed to yellow, thereby revealing that
RanBPM was colocalized with
-tubulin, one of the important centrosomal residents (Oakley and Oakley, 1989
;
Kalt and Schliwa, 1993
; Kellogg et al., 1994
). To confirm
that the
-tubulin stained in MRC5 cells was located
within the centrosome, cells were double stained by the affinity-purified
-tubulin antibodies (red) (Masuda et al.,
1996) and the mAb to
-tubulin (green) (Fig. 2 C). When
superimposed, the affinity-purified
-tubulin antibodies stained the central matrix of the microtubule network, as
expected. In mitotic HeLa cells, the area corresponding to
the centrosome was also stained by the affinity-purified
anti-RanBPM antibodies (data not shown).
Based on these staining results, we concluded that RanBPM was localized within the centrosome throughout the
cell cycle, similar to
-tubulin.
Overexpression of Human RanBPM cDNA Causes Ectopic Nucleation of Microtubules In Vivo
To determine the biological function of RanBPM, we
overexpressed RanBPM cDNA in COS cells and examined its effect on the microtubule network. T7-fused RanBPM cDNA carried on the pcDEB vector was introduced
into COS cells as described in Materials and Methods. 36 h
later, transfected cells were fixed and doubly stained by the affinity-purified anti-RanBPM antibodies (red) and by
the mAb to
-tubulin (green). In contrast to cells transfected with the vector alone (Fig. 3 A, panel c), a normal
radial network of microtubules was broken in cells transfected with T7-RanBPM cDNA (the representative figures are shown in Fig. 3 A, panels a and b). When transfected cells were doubly stained by the mAb to the T7-tag
(green) and the affinity purified anti-
-tubulin antibodies
(red), RanBPM and
-tubulin were found to be distributed as spots throughout the cytoplasm (Fig. 3 B). Both staining
spots were colocalized when superimposed (Fig. 3 B, superimposition), indicating that there is some type of interaction between
-tubulin and RanBPM. We thought that
upon overexpression of T7-RanBPM,
-tubulin was recruited onto RanBPM, resulting in reorganization of the
microtubule network similar to the case of overexpressed
-tubulin (Shu and Joshi, 1995
). To confirm this issue, we
monitored the recovery of microtubules after complete
disassembly induced by lowering the temperature to 0°C
as described (Joshi et al., 1992
; Shu and Joshi, 1995
). RanBPM cDNA or, as a control, the vector alone, was transfected into COS cells. To avoid rapid cell death, we transfected a smaller amount of RanBPM cDNA per cell (10 ng/dish), compared with the experiment described above
(1 µg/dish). Under this condition, the average number of
RanBPM-staining spots was ~3-5 per cell. 24 h later,
transfected cells were placed on ice for 1 h. Cells were then
incubated in fresh medium at 30°C for varying time periods ranging from 0 to 5 min, lysed to remove free tubulin
and then fixed to visualize the initiation of microtubule assembly sites in the green channel and RanBPM in the red
channel by double immunofluorescence microscopy (Fig.
4). In cells transfected by the vector alone, after return to
30°C, short microtubules emerged from a single RanBPM-stained spot and became progressively elongated as previously reported (Shu and Joshi, 1995
). In contrast to cells
transfected by the vector alone, multiple RanBPM-stained spots appeared in cells transfected with T7-tagged RanBPM cDNA (Fig. 4). After incubation at 30°C for 1 min,
-tubulin gathered around multiple RanBPM-stained
spots. Subsequently, short microtubules emerged from the
multiple RanBPM-stained spots, although the microtubules were shorter than the microtubules that emerged
from the centrosome of the untransfected cells. The number of ectopically nucleated microtubules was the same as
the number of RanBPM-stained spots. Thus, we concluded that overexpressed T7-tagged RanBPM caused ectopic nucleation of the microtubule assembly in vivo.
|
|
RanBPM Is Localized within the Central Part of the Microtubule Asters
We then determined the relationship between RanBPM
and microtubule nucleation, using the isolated centrosome. To achieve this, the centrosome extracts were prepared from HeLa cells by sucrose-density gradient centrifugation as described (Mitchison and Kirschner, 1984
;
Bornes et al., 1987). Fractions containing the centrosomes were determined by microtubule nucleation ability (Fig. 5
A). Immunoblotting analysis revealed that both RanBPM
and
-tubulin were cosedimented with the centrosome
fractions (Fig. 5 B). The protein bands higher than 55 kD
which were fractionated into the top fractions were recognized by the affinity-purified anti-RanBPM antibodies.
The major band of these corresponds to the band of 57 kD
recognized in the total extract of HeLa cells (Fig. 1 C). We
do not know whether they are modified forms of RanBPM
or proteins cross-reactive to the affinity-purified anti-RanBPM antibodies as mentioned above. These proteins were
concentrated into the top fractions, suggesting that they
were localized in the cytoplasm. Similarly, a majority of
-tubulin was fractionated into the top fraction, being consistent with the previous report that the majority of
-tubulin is localized in the cytoplasm (Stearns and Kirschner, 1994
).
|
To determine the localization of RanBPM in the microtubule asters assembled in vitro, the asters were doubly
stained by the mAb to
-tubulin (green) and by the affinity-purified anti-RanBPM antibodies (red). As expected
from the in vivo results, RanBPM was localized at the central part of the microtubule asters (Fig. 6) where
-tubulin
was also localized (see Fig. 9). These results are consistent
with the notion that RanBPM is one of the centrosomal components which is involved in microtubule nucleation.
To address this issue, the centrosome fractions were preincubated with the affinity-purified anti-RanBPM antibodies, and then assayed for aster formation. Although the
preimmune IgG had no effect on aster formation, the
number of microtubules nucleated by the centrosome was
greatly reduced by addition of anti-RanBPM antibodies
(Fig. 7). In a control reaction mixture containing the preimmune IgG or the buffer alone, the total number of asters formed on a coverslip was 1442 (SD = 27.0) and 1489 (SD = 51.1), respectively. In contrast, it was 151 (SD = 10.1) in the presence of anti-RanBPM antibodies. Thus,
the aster-forming ability of the centrosome factions was reduced to about 10% of the buffer alone by the addition
of the affinity-purified anti-RanBPM antibodies. Under
the same conditions, the polymerization of microtubules
without centrosome fractions was not inhibited by the affinity-purified anti-RanBPM antibodies (data not shown),
this being consistent with the result showing that the
length of the microtubules was not reduced by the addition of anti-RanBPM antibodies (Fig. 7).
|
|
|
Nonhydrolyzable GTP-Ran Inhibits Microtubule Nucleation
Human RanBPM cDNA was isolated by the two-hybrid
method using human Ran as a bait (Yokoyama et al.,
1995
). To confirm whether or not RanBPM interacts specifically with GTP-Ran, mutant forms of Ran, G19V-Ran,
and T24N-Ran were prepared as described (Dasso et al.,
1994
; Kornbluth et al., 1994
). The amino acid residues 19 and 24 of Ran were conserved between ras and Ran. By
analogy of ras, G19V-Ran is thought to be locked in
an activated state through inability to hydrolyze GTP
(McGrath et al., 1984
) and T24N-Ran is thought to remain
predominantly in a GDP-bound form since the corresponding mutation in rasH have a profoundly decreased affinity for GTP in vitro (Feig and Cooper, 1988
). Indeed,
G19V-Ran and T24N-Ran preferentially binds to GTP
and GDP, respectively (Kornbluth et al., 1994
; Lounsbury et al., 1996
).
The cDNA of G19V-Ran and T24N-Ran, both of which
were fused in frame with the GAL4-activation domain of
pACT (Durfee et al., 1993
), were introduced into cultures
of the strain Y190 [pAS404-RanBPM]. Transformants
were selected in synthetic medium lacking leucine and
tryptophan, and plated on synthetic medium either lacking histidine, tryptophan, and leucine but containing 10 mM of
3-aminotriazole (+) or lacking tryptophan, leucine and
3-aminotriazole (
). In the presence of 3-aminotriazole,
the strain Y190 [pAS404-RanBPM, pACT-G19VRan]
papillated, whereas the strain Y190 [pAS404-RanBPM, pACT-T24NRan] did not (Fig. 8). This result indicates
that RanBPM specifically interacts with GTP-Ran.
|
Based on the above results, we then determined the effects of Ran on microtubule aster formation. The centrosome fractions were preincubated either with GTP-,
GTP
S-, or GDP-bound Ran, or with G19V-Ran, and
were then assayed for aster formation by the addition of
tubulin. The total number of asters formed on a coverslip
was 702 (SD = 69.2) without the Ran preparation. By addition of either GTP
S-Ran or G19V, it was reduced to 53 (SD = 7.5) and 56 (SD = 5.2), respectively. On the other
hand, in the presence of GTP-Ran or GDP-Ran, the total
number of asters was 650 (SD = 26.0) and 592 (SD = 3.7),
respectively. Thus, the ability of the centrosome to nucleate microtubules was significantly reduced by addition of
GTP
S-bound Ran and G19V-Ran as shown in Fig. 9. By
immunoblotting analysis, we found that the centrosome fractions contained a considerable amount of RanGAP1,
but no RCC1 (data not shown). Therefore, GTP
S-bound
Ran, which can not be hydrolyzed, should remain stable in
the reaction mixture.
In the presence of GTP
S-Ran, the central part of the
microtubule asters which was stained by both the affinity-purified anti-RanBPM antibodies and the mAb to
-tubulin significantly faded, compared with the case of buffer
alone (Fig. 9). However, the length of the microtubules
was not reduced, and the nonhydrolyzable GTP-Ran seemed to inhibit the nucleation of microtubule assembly,
similar to the anti-RanBPM antibodies. Indeed, the microtubule elongation was not inhibited by GTP
S-Ran or
G19V-Ran in the absence of the centrosome factions (data
not shown). It is notable that the central part of the microtubule asters did not fade when the anti-RanBPM antibodies were added (Fig. 7). The mechanism for inhibiting
microtubule-aster formation, therefore, seemed to be different between the anti-RanBPM antibodies and the nonhydrolyzable GTP-Ran.
| |
Discussion |
|---|
|
|
|---|
RanBPM was most frequently isolated by two-hybrid
screening of the human cDNA library using human Ran as
a bait (Yokoyama et al., 1995
). 38 out of a total of 80 clones isolated encode RanBPM. In the same screening,
several fragments of RanBP2 cDNA which encode one of
four Ran-binding domains of RanBP2 were isolated, revealing that our screening of Ran-binding proteins was
functional. In this context, it is highly likely that RanBPM
is yet another Ran-binding protein, although RanBPM has
no Ran-binding domain similar to either that of RanBP1
(Coutavas et al., 1993
) or that of importin
(Görlich et al.,
1997
).
The colocalization of RanBPM with
-tubulin indicates
that RanBPM is localized within the centrosome. The
-TuRC purified from Xenopus egg extracts contains at
least seven different proteins (Zheng et al., 1995
). The
proteins homologous to S. cerevisiae SPB components
Spc97p and Spc98p have been identified in the
-TuRC and are localized in the centrosome (Martin et al., 1998
;
Murphy et al., 1998
; Tassin et al., 1998
). Recently, Wigge
et al. (1998)
prepared a highly enriched spindle pole preparation and identified a total of 12 known and 11 novel
components of the SPB. Among these, there was found
no protein homologous to RanBPM, although we found
a possible RanBPM homologue of S. cerevisiae ORF;
YGL227w by Blast search. It remains to be investigated
whether RanBPM directly interacts with
-tubulin. However, as we discuss below, we demonstrated a functional
interaction between RanBPM and
-tubulin.
Overexpression of the cloned RanBPM cDNA causes
both a reorganization of the microtubule network and an
ectopic microtubule nucleation. These results indicate that
the cloned RanBPM cDNA has the biological activity of
nucleating the microtubule assembly in vivo. The finding
that overexpressed RanBPM cDNA causes ectopic microtubule nucleation is quite similar to the case of
-tubulin reported previously (Shu and Joshi, 1995
). Of great interest is that newly formed RanBPM spots were costained
with the mAb to
-tubulin. Although the mechanism for
the ectopic microtubule nucleation has not been clarified,
it may be possible that the overexpression of RanBPM activates
-TuRC or recruits
-tubulin to the centrosome
scaffolds, resulting in microtubule nucleation.
The in vitro microtubule nucleation is inhibited not only
by the addition of anti-RanBPM antibodies, but also by
the addition of nonhydrolyzable GTP-Ran. The central
part of the microtubule asters stained either by the mAb
to
-tubulin or by anti-RanBPM antibodies fades in the
presence of nonhydrolyzable GTP
S-Ran or a dominant
GTP-bound mutant of Ran, G19V-Ran (Kornbluth et al.,
1994
; Lounsbury et al., 1996
). This is in contrast to the finding that upon addition of the anti-RanBPM antibodies, the central part of microtubule asters does not change
in size. The anti-RanBPM antibodies may structurally
hinder the microtubule assembly at the nucleation site. In
contrast, it is unclear how the nonhydrolyzable GTP-Ran
inhibits the nucleation of microtubule assembly. Recently,
it has been reported that the higher-order organization of
microtubule-nucleating sites is represented by a centrosomal lattice containing pericentrin and
-tubulin (Dictenberg et al., 1998
). Therefore, one of possibilities is that the
dynamic stability of the centrosomal lattice is regulated by
Ran through RanBPM. The tight binding of nonhydrolyzable GTP-Ran to RanBPM may make the centrosomal
lattice unstable, resulting in a shrinking of the central part.
However, it could be also possible that GTP
S-Ran inhibits the aster formation independently from RanBPM. It is a very interesting question how Ran regulates the centrosome function.
| |
Footnotes |
|---|
Address correspondence to T. Nishimoto, Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582, Japan. Tel.: (81) 92-642-6175. Fax: (81) 92-642-6183. E-mail: tnishi{at}molbiol.med.kyushu-u.ac.jp
Received for publication 14 July 1998 and in revised form 8 September 1998.
We thank E. Noguchi (Kyushu University, Fukuoka, Japan) for plasmid pAS404. The English used in this manuscript was revised by K. Miller (Royal English Language Centre, Fukuoka, Japan).
This work was supported by Grants-in-Aid for Specially Promoted Research from the Ministry of Education, Science, and Culture of Japan to T. Nishimoto (08102008) and by the Human Frontier Science Program.
| |
Abbreviations used in this paper |
|---|
-TuRC,
-tubulin ring complex;
ORF, open reading frame; PCM, pericentriolar material;
RACE, rapid
amplification of cDNA ends;
SPB, spindle pole body;
ts, temperature sensitive.
| |
References |
|---|
|
|
|---|
| 1. | Aebi, M., M.W. Clark, U. Vijayraghavan, and J. Abelson. 1990. A yeast mutant, PRP20, altered in mRNA metabolism and maintenance of the nuclear structure, is defective in a gene homologous to the human gene RCC1 which is involved in the control of chromosome condensation. Mol. Gen. Genet. 224: 72-80 [Medline]. |
| 2. | Avis, J.M., and P. Clarke. 1996. Ran, a GTPase involved in nuclear processes: its regulators and effectors. J. Cell Sci. 109: 2423-2427 [Abstract]. |
| 3. |
Bischoff, F.R., and
H. Ponstingl.
1991a.
Mitotic regulator protein RCC1 is complexed with a nuclear ras-related polypeptide.
Proc. Natl. Acad. Sci. USA.
88:
10830-10834
|
| 4. | Bischoff, F.R., and H. Ponstingl. 1991b. Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1. Nature 354: 80-82 [Medline]. |
| 5. |
Bischoff, F.R.,
C. Klebe,
J. Kretschmer,
A. Wittinghofer, and
H. Ponstingl.
1994.
RanGAP1 induces GTPase activity of nuclear Ras-related Ran.
Proc.
Natl. Acad. Sci. USA.
91:
2587-2591
|
| 6. |
Bischoff, F.R.,
H. Krebber,
T. Kempf,
I. Hermes, and
H. Ponstingl.
1995.
Human RanGTPase-activating protein RanGAP1 is a homologue of yeast
Rna1p involved in mRNA processing and transport.
Proc. Natl. Acad. Sci.
USA.
92:
1749-1753
|
| 7. | Bornens, M., M. Paintrand, J. Berges, M.C. Marty, and E. Karsenti. 1987. Structural and chemical characterization of isolated centrosomes. Cell Motil. Cytoskel. 8: 238-249 [Medline]. |
| 8. | Bullitt, E., M.P. Rout, J.V. Kilmartin, and C.W. Akey. 1997. The yeast spindle pole body is assembled around a central crystal of Spc42p. Cell. 89: 1077-1086 [Medline]. |
| 9. |
Cheng, Y.,
J.E. Dahlberg, and
E. Lund.
1995.
Diverse effects of the guanine nucleotide exchange factor RCC1 on RNA transport.
Science.
267:
1807-1810
|
| 10. |
Clark, K.L., and
G.F. Sprague Jr..
1989.
Yeast pheromone response pathway:
characterization of a suppressor that restores mating to receptorless mutants.
Mol. Cell. Biol.
9:
2682-2694
|
| 11. |
Corbett, A.H., and
P.A. Silver.
1996.
The NTF2 gene encodes an essential,
highly conserved protein that functions in nuclear transport in vivo.
J. Biol.
Chem.
271:
18477-18484
|
| 12. | Coutavas, E., M. Ren, J.D. Oppenheim, P. D'Eustachio, and M.G. Rush. 1993. Characterization of proteins that interact with the cell-cycle regulatory protein Ran/TC4. Nature. 366: 585-587 [Medline]. |
| 13. | Dasso, M.. 1993. RCC1 in the cell cycle: the regulator of chromosome condensation takes on new roles. Trends Biochem. Sci. 18: 96-101 [Medline]. |
| 14. | Dasso, M., T. Seki, Y. Azuma, T. Ohba, and T. Nishimoto. 1994. A mutant form of the Ran/TC4 protein disrupts nuclear function in Xenopus laevis egg extracts by inhibiting the RCC1 protein, a regulator of chromosome condensation. EMBO (Eur. Mol. Biol. Organ.) J. 13: 5732-5744 [Medline]. |
| 15. |
Dictenberg, J.,
W. Zimmerman,
C.A. Sparks,
A. Young,
C. Vidair,
Y. Zheng,
W. Carrington,
F.S. Fay, and
S.J. Doxsey.
1998.
Pericentrin and -tubulin
form a protein complex and are organized into a novel lattice at the centrosome.
J. Cell Biol
141:
163-174
|
| 16. |
Dingwall, C.D.,
S. Kandels-Lewis, and
B. Seraphin.
1995.
A family of Ran binding proteins that includes nucleoporins.
Proc. Natl. Acad. Sci. USA.
92:
7525-7529
|
| 17. |
Durfee, T.,
K. Becherer,
P.-L. Chen,
S.-H. Yeh,
Y. Yang,
A.E. Kilburn,
W.-H. Lee, and
S.J. Elledge.
1993.
The retinoblastoma protein associated with the
protein phosphatase type 1 catalytic subunit.
Genes Dev.
7:
555-569
|
| 18. |
Feig, L.A., and
G.M. Cooper.
1988.
Inhibition of NIH3T3 cell proliferation by a
mutant ras protein with preferential affinity for GDP.
Mol. Cell Biol.
8:
3235-3243
|
| 19. |
Geissler, S.,
G. Pereira,
A. Spang,
M. Knop,
S. Soues,
J. Kilmartin, and
E. Schiebel.
1996.
The spindle pole body component Spc98p interacts with the
-tubulin-like Tub4p of Saccharomyces cerevisiae at the sites of microtubule
attachment.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
3899-3911
[Medline].
|
| 20. | Gluzman, Y.. 1981. SV40-transformed simian cells support the replication of early SV40 mutant. Cell. 23: 175-182 [Medline]. |
| 21. | Görlich, D.. 1998. Transport into and out of the cell nucleus. EMBO (Eur. Mol. Biol. Organ.) J 17: 2721-2727 [Medline]. |
| 22. | Görlich, D., and I.W. Mattaj. 1996. Nucleocytoplasmic transport. Science. 271: 1513-1518 [Abstract]. |
| 23. |
Görlich, D.,
M. Dabrowski,
F.R. Bischoff,
U. Kutay,
P. Bork,
E. Hartmann,
S. Prehn, and
E. Izaurralde.
1997.
A novel class of RanGTP binding proteins.
J.
Cell Biol.
138:
65-80
|
| 24. | Harper, J.W., G.R. Adami, N. Wei, K. Keyomarsi, and S.J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell. 75: 805-816 [Medline]. |
| 25. | Hayakawa, H., G. Koike, and M. Sekiguchi. 1990. Expression and cloning of complementary DNA for a human enzyme that repairs O6-methylguanine in DNA. J. Mol. Biol. 213: 739-747 [Medline]. |
| 26. |
Joshi, H.C.,
M.J. Palacios,
L. McNamara, and
D.W. Cleveland.
1992.
-Tubulin
is a centrosomal protein required for cell cycle-dependent microtubule nucleation.
Nature.
356:
80-83
[Medline].
|
| 27. | Kadowaki, T., D. Goldfarb, L.M. Spitz, A.M. Tartakoff, and M. Ohno. 1993. Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2929-2937 [Medline]. |
| 28. | Kalt, A., and M. Schliwa. 1993. Molecular components of the centrosome. Trends Cell Biol. 3: 118-128 . [Medline] |
| 29. | Kellogg, D.R., M. Moritz, and B.M. Alberts. 1994. The centrosome and cellular organization. Annu. Rev. Biochem. 63: 639-674 [Medline]. |
| 30. | Kilmartin, J.V., and P-Y. Goh. 1996. Spc110p: assembly properties and role in the connection of nuclear microtubules to the yeast spindle pole body. EMBO (Eur. Mol. Biol. Organ.) J 17: 4592-4602 . |
| 31. |
Kinoshita, N.,
M. Goebl, and
M. Yanagida.
1991.
The fission yeast dis3+ gene
encodes a 110 kDa essential protein implicated in mitotic control.
Mol. Cell
Biol.
11:
5839-5847
|
| 32. | Knop, M., G. Pereire, S. Geissler, K. Grein, and E. Schiebel. 1997. The spindle pole body component Spc97p interacts with the g-tubulin of Saccharomyces cerevisiae and functions in microtubule organization and spindle pole body duplication. EMBO (Eur. Mol. Biol. Organ.) J. 16: 1550-1564 [Medline]. |
| 33. |
Knop, M., and
E. Schiebel.
1998.
Receptors determine the cellular localization
of a -tubulin complex and thereby the site of microtubule formation.
EMBO (Eur. Mol. Biol. Organ.) J
17:
3952-3967
[Medline].
|
| 34. |
Kornbluth, S.,
M. Dasso, and
J. Newport.
1994.
Evidence for a dual role for
TC4 protein in regulating nuclear structure and cell cycle progression.
J. Cell
Biol.
125:
705-719
|
| 35. |
Lange, B.M.H., and
K. Gull.
1995.
A molecular marker for centriole maturation
in the mammalian cell cycle.
J. Cell Biol.
130:
919-927
|
| 36. |
Lounsbury, K.M.,
S.A. Richards,
K.L. Carey, and
I.G. Macara.
1996.
Mutations
within the Ran/TC4 GTPase. Effects on regulatory factor interactions and
subcellular localization.
J. Biol. Chem.
271:
32834-32841
|
| 37. | Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell. 88: 97-107 [Medline]. |
| 38. |
Martin, O.C.,
R.N. Gunawardane,
A. Iwamatsu, and
Y. Zheng.
1998.
Xgrip 109:
A -tubulin-associated protein with an essential role in -tubulin ring complex ( TuRC) assembly and centrosome function.
J. Cell Biol.
141:
675-687
|
| 39. |
Masuda, H., and
T. Shibata.
1996.
Role of -tubulin in mitosis-specific microtubule nucleation from the Schizosaccharomyces pombe spindle pole body.
J.
Cell Sci.
109:
165-177
[Abstract].
|
| 40. |
Matunis, M.J.,
E. Coutavas, and
G. Blobel.
1996.
A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein
RanGAP between the cytosol and the nuclear pore complex.
J. Cell Biol.
135:
1457-1470
|
| 41. | McGrath, J.P., D.J. Capon, D.V. Goeddel, and A.D. Levinson. 1984. Comparative biochemical properties of normal and activated human ras p21 protein. Nature. 310: 644-649 [Medline]. |
| 42. | Melchior, F., and L. Gerace. 1995. Mechanisms of nuclear protein import. Curr. Opin. Cell Biol. 7: 310-318 [Medline]. |
| 43. | Melchior, F., and L. Gerace. 1998. Two-way trafficking with Ran. Trends Cell Biol. 8: 175-179 . [Medline] |
| 44. |
Melchior, F.,
T. Guan,
N. Yokoyama,
T. Nishimoto, and
L. Gerace.
1995.
GTP
hydrolysis by Ran occurs at the nuclear pore complex in an early step of protein import.
J. Cell Biol.
131:
571-581
|
| 45. | Mitchell, P., E. Petfalski, A. Shevchenko, M. Mann, and D. Tollervey. 1997. The exosome: a conserved eucaryotic RNA processing complex containing multiple 3'-5' exoribonucleases. Cell. 91: 457-466 [Medline]. |