|
||
Wellcome/CRC Institute and Department of Anatomy, University of Cambridge, Cambridge CB2 1QR, United Kingdom
| |
Abstract |
|---|
|
|
|---|
Mutations in kakapo were recovered in genetic screens designed to isolate genes required for integrin-mediated adhesion in Drosophila. We cloned the
gene and found that it encodes a large protein (>5,000
amino acids) that is highly similar to plectin and
BPAG1 over the first 1,000-amino acid region, and
contains within this region an
-actinin type actin-binding domain. A central region containing dystrophin-like
repeats is followed by a carboxy domain that is distinct
from plectin and dystrophin, having neither the intermediate filament-binding domain of plectin nor the
dystroglycan/syntrophin-binding domain of dystrophin. Instead, Kakapo has a carboxy terminus similar to
the growth arrest-specific protein Gas2. Kakapo is
strongly expressed late during embryogenesis at the
most prominent site of position-specific integrin adhesion, the muscle attachment sites. It is concentrated at
apical and basal surfaces of epidermal muscle attachment cells, at the termini of the prominent microtubule bundles, and is required in these cells for strong attachment to muscles. Kakapo is also expressed more widely
at a lower level where it is essential for epidermal cell
layer stability. These results suggest that the Kakapo
protein forms essential links among integrins, actin, and
microtubules.
| |
Introduction |
|---|
|
|
|---|
THE integrin family of cell surface receptors was
named for its proposed role in integrating the extracellular matrix and the cytoskeleton (Hynes, 1987
),
which remains one of the crucial functions of this diverse
set of receptors. However, the mechanisms by which integrins become connected to the cytoskeleton are not yet
clear despite the use of a variety of diverse experimental approaches to address this question.
One of the best-characterized subcellular sites of integrin function is the focal adhesion site, where integrins mediate adhesion to the extracellular matrix and the cytoskeleton becomes organized so that actin stress fibers
terminate at the focal adhesions (Burridge et al., 1988
;
Craig, 1996
). Two of the proteins that are concentrated at
focal adhesions
talin and
-actinin
have been shown
biochemically to interact directly with integrin cytoplasmic
tails (Horwitz et al., 1986
; Otey et al., 1990
), but it is not
known whether direct binding of these proteins to the integrins is essential for the integrin-cytoskeletal linkage
within the cell. By using anti-integrin antibodies coupled
to small beads to cluster integrins, Miyamoto and colleagues (1995a) were able to show that before integrins
bind to their extracellular ligands, two proteins are associated with the clustered integrins: focal adhesion kinase and tensin. After ligand binding, many additional proteins
colocalize with the integrins, including the cytoskeletal
proteins talin, vinculin, and actin filaments, as well as
many signaling molecules such as Src, Grb2, Csk, and Crk
(Miyamoto et al., 1995b
). A number of groups have succeeded in identifying proteins that can bind directly to integrin tails within the cell using two-hybrid screens in yeast
(Shattil et al., 1995
; Hannigan et al., 1996
; Kolanus et al.,
1996
). However, these molecules, such as cytohesin and integrin-linked kinase, do not appear to be components of
the cytoskeleton, but instead are more likely to function
during signaling. Thus, the direct link between integrins
and the cytoskeleton is not completely understood, partly
because so many proteins colocalize with integrins at focal
adhesions that it is difficult to determine which of the molecular connections are essential for this link. This problem is exacerbated by the fact that many of these proteins have multiple binding sites for other colocalized proteins
(e.g., Burridge et al., 1992
).
Colocalization of signaling molecules with integrins raises an alternative possibility: that the role of integrins in linking the extracellular matrix to the cytoskeleton is not a structural one but a signaling one, activating a signaling cascade that leads to linkage of the cytoskeleton to other transmembrane proteins. At present it seems most likely that the integrins perform both a structural and a signaling role, but it is not known what is the relative importance of the two activities at particular sites of integrin function.
Recent progress in identifying the genes associated with
hereditary forms of junctional epidermolysis bullosa, a
skin-blistering disease, has demonstrated the importance
of the
6
4 integrin in the adhesion of the epidermis to the
underlying dermis (for review see Uitto and Pulkkinen,
1996
). Two transmembrane proteins
the integrin
6
4
and bullous pemphigoid antigen 2 (BPAG2)1
bind to
laminin 5 and collagen type VII, and are linked to cytokeratin filaments by plectin (also called HD1) and BPAG1.
Plectin and HD1 have an intermediate filament-binding
domain at their carboxy termini that is similar to that
found in the desmosome component desmoplakin. Plectin
and some isoforms of BPAG1 also have an actin-binding domain at the NH2 terminus similar to the one found in
-actinin,
-spectrins, and dystrophin, suggesting that an
important function of this class of proteins is to provide
links among the different cytoskeletal filaments (Ruhrberg and Watt, 1997
). Mutations in the genes encoding
these proteins, or automimmune antisera against them,
cause skin blistering (reviewed in Ruhrberg and Watt,
1997
), and the cellular nature of the defect is consistent
with the position of the protein in the link between the extracellular matrix and the cytoskeleton. Thus, mutations in
the extracellular ligands or the
6
4 integrin subunits
cause detachment of the epidermis from the dermis,
whereas mutations in BPAG1 or plectin cause the basal
layer of the epidermal cells to break in half, with the basal
surface remaining attached via hemidesomosomes to the
dermis, and the apical surface remaining attached to the
rest of the epidermis by its desmosomal linkage (Guo et
al., 1995
; McLean et al., 1996
). These observations support
the model of integrins directly linking the extracellular
matrix to the cytoskeleton, although the fact that
4 has a
much longer cytoplasmic tail than the other
subunits may make this a specialized case.
To identify additional proteins that are required for integrin-mediated adhesion, genetic screens have recently
been performed in Drosophila for mutations with the
same phenotype as mutations in the genes encoding the
position-specific (PS) integrins (Prout et al., 1997
; Walsh
and Brown, 1998
). The PS integrins are most similar to the
vertebrate
1 family (reviewed in Brown, 1993
). These
screens used the FLP-FRT method (Golic, 1991
; Xu and
Rubin, 1993
) to generate clones of cells that are homozygous mutant for newly generated mutations. The screen is
based on the fact that clones of cells mutant for the PS integrin subunits cause a wing blister in the developing wing
because the mutant cells fail to adhere to the opposing
layer of wild-type cells in the wing bilayer (e.g., Brower
and Jaffe, 1989
). Systematic screens for mutations that
cause the same defect identified 17 new complementation
groups that are likely to encode essential components of
integrin-mediated adhesion. Here we show that this screen
has successfully identified proteins that are likely to link
integrins to the cytoskeleton. We have cloned the kakapo
locus and found that it encodes a large cytoskeletal protein
that is similar at the amino terminus to the hemidesmosome components plectin and BPAG1. In contrast to these
proteins, the Kakapo protein contains motifs from dystrophin and the growth arrest protein Gas2 at its carboxy terminus, instead of containing an intermediate filament-binding domain. The pattern of expression of Kakapo and
certain aspects of its embryonic phenotype demonstrate
that it is required for integrin-mediated adhesion in the
embryo as well as in the wing. Thus, members of the plectin (or plakin) family of cytoskeletal linker proteins are
not restricted to linking the unusual
6
4 integrin to intermediate filaments, but are more widely involved in integrin adhesion events.
| |
Materials and Methods |
|---|
|
|
|---|
Drosophila Strains
The kakapo alleles used in this study were 18 of the 19 kakapo alleles isolated by Walsh and Brown (1998; one has been lost), and the lethal P-element insertions l(2)k03010 (kakP1) and l(2)k03405 (kakP2; I. Kiss collection, Berkeley Drosophila Genome Project). We used two deficiencies for
kakDf(2R)MK1 (50B3-5 and 50D1-4; a kind gift from V. Hartenstein and
T. Volk and Df(2R)CX1 [Bloomington Drosophila Stock Center, Bloomington, IN]). Other P insertions that were tested and found not to be allelic to kak were l(2)248, l(2)3105, l(2)4845, l(2)5488, l(2)k08121,
l(2)k08708, l(2)k04204, l(2)10626, and C6-2-29 (Bloomington Stock Center and Berkeley Drosophila Genome Project). To demonstrate that the
kak mutations are associated with the P-element insertions in kakP1 and
kakP2, they were jumped out by crossing in
2-3 transposase, outcrossing, and screening for loss of the w+ marker, and then checked for viability
over Df(2R)CX1. Both insertions reverted to viability over the deficiency
at a high frequency (data not shown).
Isolation and Sequence Analysis of cDNA and Genomic Clones
Genomic DNA adjacent to the site of insertion of l(2)k03010 and
l(2)k03405 was isolated by cutting genomic DNA from heterozygous flies
with XbaI or EcoRI and ligating 10 µg of each in 1 ml to circularize the
DNA. The DNA was transformed into competent cells, and rescued plasmids were selected for by Ampicillin. This procedure yielded genomic
fragments that were used to screen a
genomic library (a kind gift of R. Blackman, University of Illinois, Urbana, IL) and 12-24 h embryonic and
imaginal disc plasmid cDNA libraries (Brown and Kafatos, 1988
). The site
of both P-element insertions map to the same nucleotide in the second intron of the kakapo gene (data not shown). The initial clones ended in intron sequence, so a 3' end fragment of the cDNA was used to walk toward
the 3' end of the gene. We were greatly assisted in our characterization of
the kakapo transcript by sharing data with D. Strumpf and T. Volk (see
accompanying paper), who were walking from the opposite end. The
cDNA clones were sequenced on both strands (Cambridge Biochemistry
Department facility) by synthesizing 25 specific primers (Genosys, Pampisford, UK), and were assembled using Sequencher (Gene Codes Corp.,
Ann Arbor, MI), MacVector, and AssemblyLign (Oxford Molecular
Group, Oxford, UK) into a contig of 17,420 bp for the form A transcript.
The sequences of the NH2-terminal portion of the two isoforms of kakapo
have accession numbers AJ011924 for form A and AJ011925 for form B. Database analysis was carried out using the BLAST server at Baylor College of Medicine (http://kiwi.bcm.tmc.edu:8088/). Alignments of related sequences were carried out using ClustalW and by eye in MacVector. Phylogenetic analysis of aligned sequences was carried out using the Dayhof
matrix and ProtDist in PHYLIP3.572 (J. Felsenstein, University of Washington, Seattle, WA). Accession numbers of the related sequences used
are: human plectin, Z54367; human BPAG1, I39160; mouse ACF7,
U67203; C. elegans Kakapo, Z93398; human dystrophin, A27605; human
utrophin, S28381; mouse utrophin, Y12229; Drosophila
-spectrin,
Q00963; human
-spectrin, B27016; Drosophila
H-spectrin, A37792;
Drosophila
-actinin, A35598; human
-actinin 1, P12814; human
-actinin 2, P35609; human filamin, P21333.
Antibody Production and Purification
To generate polyclonal antisera against the Kakapo (Kak) protein, residues 2-341 of Form A were expressed in bacteria as a fusion to maltose-binding protein using the pMALc-2 vector (New England Biolabs,
Hitchin, UK). In this fusion, residues 2-143 are unique to Form A, and
residues 144-341 are found in both forms of Kakapo protein. To generate
this fusion, the 5' end of a cDNA clone was amplified using Pwo high-fidelity polymerase (Boehringer, Lewes, UK) with the primers GCAGGCCTACATCGCATTCCTACT and CGCCTCGACAATGCTCTTAG. This
fragment was cut with StuI and BamHI, and was cloned into pMALc-2 cut
with XmnI and BamHI in the strain DH5
.
The fusion protein was purified from inclusion bodies as follows. Protein expression was induced in mid log cultures with 0.3 mM IPTG, and after several hours the cells were harvested by centrifugation. 2 g of induced cells were resuspended in 6 ml of lysis buffer (50 mM Tris-HCl pH 8, 1 mM EDTA, 100 mM NaCl) and protease inhibitor cocktail (Sigma Chemical Co., Poole, UK). Lysozyme was added to 0.3 mg/ml, and the cell suspension was incubated on ice for 20 min. Sodium deoxycholate was added to 1 mg/ml, and the suspension was stirred at 37°C until it became viscous. Then, 40 µg DNase was stirred in until the viscosity dropped. This lysate was centrifuged at 15 krpm for 10 min in a Sorvall SS-34 rotor, and the supernatant was discarded. The pellet was vigorously resuspended in 9 ml of lysis buffer containing 0.5% Triton X-100 and 10 mM EDTA, incubated at room temperature for 5 min, and centrifuged at 12 krpm for 10 min, and the supernatant was discarded. The pellet was gently resuspended in 3 ml of denaturing buffer (8 M Urea, 100 mM NaCl, 50 mM Tris-HCl, pH 8, 1 mM EDTA) and gently swirled at 30°C for 1 h. This suspension was centrifuged at 15 krpm for 15 min, and the supernatant was retained. This supernatant contained almost all the induced protein, and was quantitated by Coomassie staining at ~0.5 mg/ml.
Polyclonal antisera were raised against this protein in two rabbits by Eurogentec (Ougree, Belgium) using their standard protocol. To purify specific antibodies, 100 mg of fusion peptide was Western-blotted onto PVDF membrane, blocked with 0.2% Tween-20 in PBS (PBTw) for 1 h, and then 5 ml of the final bleed serum was added and rocked with the membrane for 2 h. Nonbound proteins were removed with several 10-min washes of PBTw followed by 30 min in 0.15 M NaCl and a final wash in PBS. Antibodies were eluted from the membrane strip by adding 360 µl of 0.1 M glycine-HCl, pH 2.6, for 10 min, and this solution was removed from the membrane and neutralized with 40 µl of 1 M Tris-HCl, pH 8.
Embryo lysates for Western blot analysis were made by homogenizing stage 15-17 embryos in PBS plus 8 M Urea, 0.2% Triton X-100, 0.2% Nonidet NP-40, and 0.2× protease inhibitor cocktail (Sigma Chemical Co.). Samples were run on a 4.2% separating gel with a 3.6% stacking gel in 0.2% SDS, 0.6% Tris, 2.88% glycine, and were then transferred to PVDF membrane in 0.3% SDS, 48 mM Tris, 29 mM glycine for 45 min at 100V. Rainbow markers (Amersham, Little Chalfont, UK) were used to indicate mobilities of 250 and 160 kD. The filter was dried, and then blocked in TBS plus 5% milk, 0.1% Tween-20 overnight at 4°C. Anti-Kakapo serum was diluted 1:500 in TBS plus 3% BSA, and was incubated with the filter for 24 h at 4°C before adding biotinylated anti-rabbit at 1:500 and detecting with the Vectastain reagents as recommended (Vector Labs, Burlingame, CA).
Embryo Immunostaining, Cuticle and Muscle Preparations
To get good staining with the anti-Kakapo antibody we found that we had
to fix the embryos with methanol rather than the more standard Formaldehyde fixation (see Fig. 5, e and f for comparison). Embryos were collected from 14 to 16 h after laying, dechorionated in bleach, and fixed in
glutaraldehyde-saturated heptane/methanol for 30 min essentially as described in Thomas and Kiehart (1994)
. After slow rehydration into PBS
plus 0.2% Tween-20 (PBTw), embryos were treated with PBS plus 5%
Triton X-100 for 1 h to assist in permeabilizing the cuticle. Subsequent incubations with antisera and washes were in PBTw. The primary antibodies used were: affinity-purified rabbit anti-Kak antisera (1:10); mouse
mAb DA1B6 anti-Fasciclin III (1:1; Brower et al., 1980
); guinea pig anti-Coracle (1:50; the kind gift of R. Fehon; Fehon et al., 1994
); mouse mAb
CF6G11 anti-
PS (1:100; Brower et al., 1984
); mouse mAb19 anti-groovin (1:1; the kind gift of T. Volk; Volk and VijayRaghavan, 1994
); mouse
mAb 22C10 (1:25; Fujita et al., 1982
); mouse mAb anti-moesin (1:1; the
kind gift of D. Kiehart); and mouse mAb anti-
Tubulin DM1A (1:50;
Sigma Chemical Co.). Secondary antibodies used were FITC-conjugated
goat anti-rabbit IgG and biotinylated horse anti-mouse IgG (Vector
Labs, Inc., Burlingame, CA), both at 1:200, and a streptavidin Texas red
conjugate at 1:200 (Amersham, Little Chalfont, UK). Confocal images of
embryos were obtained using a MRC1024 confocal microscope (Bio-Rad
Laboratories, Hemel Hempstead, UK).
|
Cuticles of mutant embryos were prepared by aging embryos for 36 h,
and then dechorionating on adhesive tape and dissolving soft tissues with
Hoyers:lactate as described in Wieschaus and Nüsslein-Volhard (1986)
.
Cuticles were photographed using an Axiophot microscope (Carl Zeiss,
Thornwood, NY) on Tech-Pan film (Eastman Kodak Co., Rochester,
NY), and were then scanned using a Nikon Coolscan film scanner (Instrument Group, Melville, NY). Embryonic muscles were visualized and photographed using a Nikon polarized light microscope on hand-devitellinized 20-24-h embryos, mounting them in water, and then flattening them
by removing excess water. All images were assembled using Photoshop
4.0 (Adobe Systems, Mountain View, CA), and labels and drawings were
added using FreeHand 5.0 (Macromedia, San Francisco, CA).
| |
Results |
|---|
|
|
|---|
Cloning kakapo
In a screen for mutations affecting processes requiring integrin adhesion, we previously isolated 19 alleles of an embryonic lethal locus that we called kopupu (Walsh and
Brown, 1998
). This number of alleles is much larger than
the number found in other genes on the same chromosome arm (2-9 alleles/gene), demonstrating that kakapo is
highly mutable, and therefore is likely to be a large gene.
Complementation testing revealed that our kopupu mutants are allelic to the previously named kakapo alleles
isolated in a similar screen (Prout et al., 1997
), so we now
refer to this gene as kakapo. The kakapo (kak) locus was
originally mapped to Df(2R)CX1 (Prout et al., 1997
;
Walsh and Brown, 1998
), and using overlapping deficiencies we further narrowed down the cytological interval
containing kak to 50B3-50D2, as it is still included within
Df(2R)MK1. We then tested lethal P-element insertion alleles that had been mapped to this cytological interval (see
Materials and Methods), and found that two
l(2)k03010
and l(2)k03405
that map to 50C9-10 are allelic to kak,
and thus we renamed them kakP1 and kakP2. The lethality
of both P-element lines can be reverted by jumping out the
P-element, as scored by loss of the w+ marker (data not
shown), demonstrating that the kak mutations are associated with insertion of the w+ P-element. We recovered the
genomic DNA flanking the site of insertion by plasmid
rescue, and found that both P-elements are inserted at exactly the same site.
Using the DNA flanking the P-element, five different
cDNA clones were recovered (Fig. 1 a). Two of the cDNAs
extend to putative 5' ends, since each contains multiple
stop codons before an ATG that initiates a long open
reading frame. The two cDNAs encode alternate NH2-terminal sequences of 143 amino acids (form A) and 32 amino acids (form B) before reaching shared sequences.
These two cDNAs represent alternative starts of transcription (data not shown), and the P-elements are inserted
into the intron that separates the alternate starts from the
shared exons, and therefore are likely to affect both mRNAs
by causing premature termination of the transcripts. All
five cDNAs have the same 3' end; however, when we completed the sequence of these clones, we noted that there is
a splice donor site just before the end of the open reading frame, and that there is no obvious polyadenylation site
close to the poly A tail (not shown). This result suggested
that these clones may be copies of incompletely spliced
mRNAs that initiate at a run of As in an intron, as previously found in this oligo dT primed library (Brown et al.,
1989
), and was confirmed by finding a run of As at the end
of these clones in the genomic DNA (not shown). We
therefore rescreened the libraries with the most 3' portion
of the open reading frame, and recovered one new clone (Fig. 1 a, top) that, when sequenced, was found to be open
throughout its length. At this point, when we had recovered cDNAs and genomic sequence that together encoded
a protein of 2,557 amino acids, we exchanged sequences
with D. Strumpf and T. Volk and discovered that we were
cloning the same gene, and that their cDNA sequence overlapped with ours and extended our cDNA sequence
3' (see Strumpf and Volk, 1998
). Together, the cDNA sequences overlap to give mRNAs of 17,420 nt encoding a
5,497-amino acid protein (form A) and 17,217 nt encoding
a 5,385-amino acid protein (form B; Fig. 1 a).
|
The Kakapo Protein is Homologous to Plectin and Dystonin at the NH2 Terminus, and to Dystrophin at the COOH Terminus
Database searches using the predicted protein sequence of
Kakapo revealed striking similarity to three distinct
classes of protein. The NH2-terminal region (residues 135-
1200) most closely resembles the plakin class of cytoskeletal cross-linker proteins including plectin, ACF7, and
BPAG1/dystonin (Ruhrberg and Watt, 1997
). These
widely expressed proteins have been implicated in cross-linking actin to intermediate filaments in hemidesmosomes, in stabilizing neuronal structures (Wiche et al.,
1991
; Bernier et al., 1996
; Yang et al., 1996
), and when defective, cause epidermal blistering, ataxia, and neurodegeneration (Guo et al., 1995
; McLean et al., 1996
; Andra
et al., 1997
; Dowling et al., 1997
). The area of strongest
similarity is with an actin-binding domain originally defined in
-actinin, but subsequently found in dystrophins
and spectrins as well as the plakin family (Dubreuil, 1991
).
Across this 240-amino acid region, Kakapo shares ~65%
amino acid identity with plectin and BPAG1 (Fig. 1 b).
The high level of conservation suggests that this domain in
Kak does bind to actin. We also identified in the database
a related sequence from C. elegans (CeKak; within cosmid
ZK1151) that closely resembles Kak in its actin-binding domain, and phylogenetic analysis of these related actin-binding domains unambiguously places Kak among the
plakins or plectin family rather than the spectrin or dystrophin groups (Fig. 1 c). The close similarity to plakins continues for the next 1,000 amino acids of Kak sharing ~26%
identity with plakins compared with 22% identity with
spectrins or dystrophins. This similarity outside the actin-binding domain is to a region in the plakins with no known
enzymatic function, but includes a predicted globular head region and much of the subsequent rod domain formed
from a coiled coil of alpha helices (Tang et al., 1996
). All
proteins so far described in the plakin family have a carboxy-terminal domain that binds intermediate filaments,
encoded by a single large final exon (Ruhrberg and Watt,
1997
). This does not appear to be the case for the Kak protein, which, after residue 1200, has no further sequence
similarity with plakins, and instead becomes similar to dystrophin (Fig. 1 a).
The central region of Kakapo (amino acids 1,200-4,950)
consists of 22 repeats of ~109 amino acids. These repeats
are most closely related to those found in the central rod
section of the dystrophin family (Koenig et al., 1988
), and
are part of the larger family of spectrin repeats (see
Strumpf and Volk, 1998
for further analysis). Dystrophin
also binds actin, and has been postulated to use the repeat
section as a flexible spacer between the cortical actin cytoskeleton and membrane-bound dystroglycan proteins in muscles (Koenig and Kunkel, 1990
).
The carboxy terminus of dystrophin contains a cluster of
widely conserved domains that bind calcium and mediate
interactions with a variety of membrane-bound and regulatory proteins. Kak contains a related but distinct COOH
terminus that retains a low level of similarity to the WW
domain and Ca++-binding EF hands in dystrophin (see
Strumpf and Volk, 1998
), but does not have the conserved
cysteines or final helices that characterize the dystrophin
protein interaction motifs (Brown and Lucy, 1997
). Instead, Kak has a region of similarity to Gas2, an actin-associated protein specifically expressed in growth-arrested cultured cells (Brancolini et al., 1992
). The region of similarity with Gas2 has not been assigned any specific function, but it is retained in Gas2 deletions or protease cleavage
products that give dramatic apoptosis-like rearrangements
of the actin cytoskeleton in cell culture (Brancolini et al.,
1995
). The joining together of segments of the kakapo
gene that are homologous to different types of protein
raised the concern that we had recovered a cDNA from
an aberrant transcript that joined exons from adjacent
genes. However, in addition to the cDNA we isolated joining the plectin and dystrophin domains, our colleagues isolated a second cDNA that also joins these two regions
(Strumpf and Volk, 1998
), connecting them at a different
position and demonstrating further alternative splicing of
this gene. We also recovered two additional cDNAs connecting the Gas2 domain to dystrophin region (data not
shown). Thus, we are confident that these diverse domains
are linked together in a single protein in Drosophila, and
like plectin, dystonin, and dystrophin, multiple isoforms
are produced (Brown and Lucy, 1997
; Ruhrberg and
Watt, 1997
).
In the Embryo, Kakapo Is Strongly Expressed in the Epidermis at Sites of PS Integrin-mediated Adhesion
Mutations in kakapo were isolated because they have the
same phenotype as mutations in the PS integrins: when
clones of cells lacking these gene products are produced in
the developing wing, those cells fail to adhere to the opposing wing layer during pupal development, causing a
blister in the adult wing. As a first step in determining
whether kakapo also has a role in PS integrin-mediated adhesion in the embryo, we wished to determine if they
are coexpressed in the embryo. We therefore raised antisera to a fusion protein containing the amino terminus of
Kakapo form A (see Materials and Methods). Using affinity-purified anti-Kakapo antisera, we stained embryos and
found that Kakapo is strongly expressed in specific epidermal cells (Fig. 2). These are specialized epidermal cells
that attach to the muscles, linking the muscles to the exoskeleton (cuticle; e.g., Prokop et al., 1998a
). Muscle attachment requires the function of the PS integrins, which are
strongly expressed at the ends of the muscles and in the
epidermal muscle attachment cells (see Brown, 1993
).
Thus, Kakapo is strongly expressed in the same embryonic
cells that express high levels of the PS integrins.
|
|
To demonstrate the specificity of our antibody, we
tested it on kak mutant embryos. Embryos homozygous
for the kakP2 allele show no staining with our affinity-purified anti-Kakapo antisera, demonstrating that these antibodies are specific for the gene product disrupted by the
P-element insertion (Fig. 3, top). We confirmed that antibodies could penetrate and label mutant embryos by double staining with mAb19 (Volk and VijayRaghavan, 1994
),
which still labeled the mutant embryos (Fig. 3, bottom). We next used our antibody to determine if the Kakapo
protein found in embryos is the size predicted from the
cDNA sequence (>600 kD). Western blot analysis of embryo protein shows that the anti-Kak antibody recognizes
primarily a single high-molecular weight band in wild-type
lysates that migrates much slower than the 250-kD marker
(Fig. 3 b). Minor amounts of shorter proteins can be seen that may be breakdown products or less-abundant alternative forms. In lysates from embryos heterozygous for
kakV168, a strong x-ray allele, we detected the wild-type
protein and a truncated form (Fig. 3 b), showing that the
detected protein is modified by a kakapo mutation. Thus,
the antiserum is specific for Kakapo gene products when
used for both immunofluorescence and Western blotting.
|
Further analysis of Kakapo expression reveals that the
protein is present at high levels in all of the epidermal
muscle attachment cells (Figs. 2 and 4 a): both those that
directly attach to the muscles and those that indirectly attach via the tendon matrix (Prokop et al., 1998a
). We first
detected strong Kakapo expression in these cells at mid-late stage 16, which is ~4 h after the muscles first start to
attach to the epidermis. During the last two stages of embryogenesis
16 and 17
attachment of the epidermal
cells to the muscles or the tendon matrix is elaborated by
expansion of the hemiadherens junctions, accumulation of
tendon matrix, and increased expression of
1 tubulin
(Buttgereit et al., 1991
; Prokop et al., 1998a
). We do not
detect any expression of Kakapo in the muscles (Figs. 2 c,
4 a, and 5), even though comparable hemiadherens junctions, characterized by membrane-proximal electron-dense plaques into which cytoskeletal elements insert, are
formed there and the adhesion is also integrin-dependent
(Prokop et al., 1998a
). This difference could indicate that
Kakapo has a function that is incompatible with muscle
contraction, such as forming stable anchoring structures.
Kakapo is strongly expressed in two internal structures as
well: the pharynx and the proventriculus (Figs. 2 c and 4, d-h). In the pharynx, Kakapo is strongly expressed in the
endodermal cell layers that attach to the pharyngeal muscles, as seen by comparing Kakapo in Fig. 4 d to a Nomarski image of these tissues stained for the muscles at a similar stage (Fig. 4 e). As with the epidermal cells that attach
to the somatic muscles (see below), Kakapo is found both
at the basal surface that contacts the mesoderm and at the
apical surface, while the PS integrins are localized just at
the basal surface (Leptin et al., 1989
). In the proventriculus, Kakapo is expressed in a ring of cells at the anterior
margin of the outer layer of this three-layered structure
(Fig. 4, f and g). Expression of the PS integrins is found
primarily at the interface between the outer endodermal layer of the proventriculus and the surrounding visceral
mesoderm (Fig. 4 h). Therefore, in this tissue, the integrins
are expressed in more cells than Kakapo. It is not clear
why strong expression of Kakapo might be needed at this
site, but one phenotype of integrin mutations is that the inner layers of the proventriculus become pulled out (Martin-Bermudo et al., 1997
), suggesting that some resistance
to mechanical stress is normally necessary to maintain the
integrity of the proventriculus structure. We can also detect modest Kakapo expression in the scolopale of the
chordotonal organs of the peripheral nervous system (Fig.
4 c). A function for the PS integrins in these cells has not
been observed to date, but, like muscle attachment cells, it
is a site of stabilized
1 microtubule based rigidity (Prokop
et al., 1998b
).
Kakapo Is Located at Both the Apical and Basal Surfaces of the Epidermal Muscle Attachment Cells
In the epidermal muscle-attachment cells, the PS integrins
are localized to the basal surface (Leptin et al., 1989
),
which contains large hemiadherens junctions (Prokop et al.,
1998a
). Microtubules extend from these basal junctions to
the apical hemiadherens junctions, which connect to the
exoskeleton (cuticle). The microtubules appear to be serving a similar structural role to that of keratin filaments in
the epidermal cells of vertebrates, as intermediate filaments have yet to be identified in Drosophila. When we
examined the subcellular localization of Kakapo in more
detail, we found that it is present at both apical and basal
surfaces of the muscle attachment cells (Fig. 5). Kakapo
can be seen to be positioned at the termini of the microtubule bundles extending from the apical to the basal surface
(Fig. 5 a), as well as faintly along their length. This subcellular pattern is distinct from other proteins that share the
-actinin type actin-binding domain, such as
H-spectrin (Thomas and Kiehart, 1994
), demonstrating that this domain does not by itself direct the intracellular localization
of proteins containing it. The apical domain of Kakapo expression overlaps with the apical localization of the protein 4.1 superfamily protein Coracle (Fig. 5 b). We found
reduced staining of Coracle on the lateral surface at this
stage compared with earlier stages previously described
(Fehon et al., 1994
). The 4.1 superfamily of proteins is
used to link transmembrane proteins to the cortical cytoskeleton, so the colocalization indicates that Kakapo is
found at the cell cortex.
We had difficulty staining for both the PS integrins and Kakapo because the two antibodies require different fixation conditions. However, in spite of this, it is clear that Kakapo expression is adjacent to PS integrin expression (Fig. 4 b, Fig. 5 c, methanol-fixed embryos; and Fig. 5 d, formaldehyde fixed), which consists of expression on the basal surface of the epidermis and at the termini of the attaching muscles. There is no significant expression of Kakapo in the muscles, but the basal expression of Kakapo in the epidermal muscle attachment cells is detected immediately next to, while not overlapping, the epidermal integrin localization (Fig. 4 b). Thus, Kakapo is not only present at the basal surface where the PS integrins are located, but also at the apical surface, where as yet no adhesion receptors have been described.
The localization of Kakapo to both ends of the microtubule bundles suggests that Kakapo could have a role in
connecting the microtubules to the cortical actin network
at the membrane, and may also directly or indirectly link
to transmembrane receptors such as the integrins. To test
its function in the epidermal muscle attachment cells, we
examined kakapo mutant embryos. In stage 16 embryos
we could not find any penetrant defects in muscle attachment in embryos homozygous for most kak alleles (data
not shown), although some stronger alleles produce severe
disruptions in embryonic morphogenesis (see below). However, in stage 17 embryos mutant for the weaker alleles,
we find that the muscles detach from the epidermis, but
they stay attached end to end (Fig. 6, a and b). In the living
embryo one can see that although muscle contraction occurs, it is no longer coupled to movement of the exoskeleton (data not shown). The cause of this defect is much
clearer in the EM analysis presented in the accompanying
paper (Prokop et al., 1998b
), which shows that the microtubule bundles are no longer attached to the basal membrane, and the epidermal cell rips in half in consequence.
This phenotype is highly reminiscent of the BPAG and
plectin phenotypes (Guo et al., 1995
; McLean et al., 1996
),
and is distinct from the PS integrin's mutant phenotype where each muscle detaches both from the epidermis and
from the other muscles (see Brown, 1993
). Thus, Kakapo
is required for epidermal attachment to muscles, but not
for muscle-muscle attachment, consistent with its expression pattern.
|
A General Function for Kakapo in Maintaining the Integrity of the Epithelial Cell Sheet
We have shown that Kakapo has a vital role in mediating
strong attachment in specific cells within the embryo that
require strong mechanical stability, but it may also have
more general functions that involve other cell surface
receptors in addition to the integrins. This possibility is
consistent with the reproducible low level of Kakapo expression we have observed in many cells (such as the epidermal cells shown in Fig. 5) that are not attached to muscles. We therefore examined embryos mutant for Kakapo
to see if we could identify more general defects that might
be a consequence of this loss of low-level Kakapo expression. Embryos mutant for kakapo display a wide range of
phenotypes, from almost normal development to severe
morphological abnormalities. This range of phenotypes is
also found in embryos deficient for the locus Df(2R)MK1/
Df(2R)MK1 or Df(2R)CX1/Df(2R)CX1 (data not shown), demonstrating that even the complete absence of the
kakapo gene does not result in a consistent zygotic phenotype. The variability of the phenotype may be due to a partial redundancy of function between Kakapo and another
protein, or variable contribution of maternal protein. We
favor the former possibility, since generating germ line
clones of one of the kakapo alleles did not enhance the
phenotype (Walsh and Brown, 1998
), and we have not
been able to detect Kakapo protein before gastrulation
(data not shown).
Consistent with the variability found in embryos deficient for kakapo, we find that our kakapo alleles also display diverse phenotypes. Most of the alleles isolated in our
screen are embryonic lethal as homozygotes, although the
two alleles examined previously develop normally through
stage 16 (Walsh and Brown, 1998
). As shown above, at the
end of embryogenesis (stage 17), the mutant embryos have
a phenotype where the epidermis detaches from the muscles (Fig. 6 b). By examining the phenotype of the different alleles, we found that some have much stronger phenotypes, indicative of a more general function. We examined
the epidermally secreted cuticle, which reflects the pattern
of the underlying epidermis, of embryos homozygous for
all our different x-ray-induced kakapo alleles and the insertion alleles kakP1 and kakP2. In the majority of the alleles (17), the homozygous mutant embryos have a normal
epidermal pattern, although ~30% of these embryos showed modest cuticular defects (not shown). It should be
mentioned that the screen for wing blister mutations may
have selected for a particular type of weak allele if more
severe alleles cause drastic wing defects. One x-ray allele,
kakV168, and the P-alleles kakP1 and kakP2, have a stronger
phenotype: in ~15% of the mutant embryos, germ band
retraction and head involution fail (Fig. 6, c and d). Approximately 40% of embryos mutant for these alleles have
normal-looking cuticles, demonstrating that this phenotype is also not fully penetrant.
Epidermal development was examined in more detail in the embryos homozygous for strong kakapo alleles using two markers for epidermal shape (Fig. 6, e-h). This examination revealed defects in the integrity of the epidermal cell layer; namely, breaks in the ventral epidermis in the middle abdominal segments of the fully germband-extended embryos (Fig. 6 e). These breaks appear to arise at the site of maximum strain during germ band retraction. Consistent with this observation, germband retraction is arrested in some embryos (Fig. 6, d and e). Other embryos successfully undergo germband retraction, but retain a hole in the epidermis at this position of maximum strain (see Fig. 6, g and h), which could account for the disruptions observed in the cuticular denticle belts. The homophilic adhesion molecule Fasiclin III is not present on the surface of the cells bordering the hole (Fig. 6 h). Such breaks in the epidermis are not observed in embryos mutant for the PS integrins, suggesting that this Kakapo function involves other cell adhesion molecules. We also observed morphogenetic defects in the internal tissues (data not shown), but because they occur in embryos with severe epidermal defects, it is not yet certain whether this indicates a function for Kakapo in these tissues, or whether the internal defects are a result of the epidermal disruption. The phenotypes in the embryonic epidermis indicate that the low-level general expression of Kakapo is significant, and that Kakapo may play a general role in mediating adhesion, possibly by mediating interactions between transmembrane proteins and the cytoskeleton.
| |
Discussion |
|---|
|
|
|---|
Identification of intracellular proteins that are required
for integrin functioning is essential for an understanding of
how integrins mediate adhesion. In this paper we have described the cloning and characterization of kakapo, a gene
that was identified in screens for wing blister mutants
(Prout et al., 1997
; Walsh and Brown, 1998
), and we show
that it encodes a cytoskeletal adaptor protein related to
plectin, BPAG1, and dystrophin. We have demonstrated that Kakapo is expressed in those epithelial cells where
stable adhesion is required in the developing embryo; it is
required to maintain epidermal adhesion to the muscles,
and more generally to maintain cohesion of the epidermal
cell layer. From the our characterization of the sequence,
pattern of expression, and phenotype of kakapo mutations, it appears that Kakapo has a similar function to plectin, and we propose a model in which Kakapo provides
links among cortical actin, microtubules, and transmembrane proteins such as integrins (Fig. 7).
|
The binding of Kakapo to actin is indicated by the presence of a highly conserved actin-binding domain at the
amino terminus of Kakapo. This domain is most similar to
the equivalent domain in plectin and BPAG1, compared
with the domains found in dystrophins,
-spectrins, and
-actinins. This higher sequence conservation may indicate some functional diversity within this domain that is
conserved in each subfamily, or it may simply represent
the evolutionary history of conservative amino acid replacements. What is clear is that this actin-binding domain
does not dictate the intracellular localization of the proteins containing it. For example, the apical and basal localization of Kakapo is distinct from the general cortical localization of both spectrin and the novel
H-spectrin of
Drosophila (Pesacreta et al., 1989
; Martinez-Arias, 1993
;
Thomas and Kiehart, 1994
).
Kakapo is closely related to plectin and BPAG1, two
vertebrate proteins that are required for the link between
the integrin
6
4 and intermediate filaments at hemidesmosomes (Ruhrberg and Watt, 1997
). However, this similarity does not extend through to the carboxy terminus of
these proteins, which contain an intermediate filament-binding domain shared with the desmosome component
desmoplakin. As Kakapo does not contain an intermediate filament-binding domain, and so far no intermediate
filaments have been identified in Drosophila, it is unlikely
to have an identical function to plectin and BPAG1 and
bind intermediate filaments. In Drosophila, stabilized microtubule arrays appear to be used in place of intermediate filaments to hold the cell rigid (Mogensen and Tucker,
1988
). This observation is particularly apparent in the
adult wing, where transalar parallel arrays of microtubules
and microfilaments connect the apical cuticle with the integrin-containing basal junctions (Mogensen and Tucker, 1988
; Fristrom et al., 1993
), and in the larval epidermal
cells that attach to the muscles (Prokop et al., 1998a
). The
fact that Kakapo function is required for cell adhesion in
both sets of epithelial cells where stabilized microtubules
are found strongly suggests that Kakapo binds to these microtubules rather than intermediate filaments. In contrast
to a number of well-conserved actin-binding domains,
many microtubule-binding proteins lack a shared microtubule-binding motif so that the lack of similarity between
kakapo and a known microtubule-binding protein does
not contradict our proposal that Kakapo binds to microtubules. It is also possible that Kakapo binds indirectly to
microtubules though an interaction with a microtubule-associated protein.
In hemidesmosomes there appears to be a direct molecular interaction between integrins and plectin, since sites
on the
4 cytoplasmic tail have been identified that directly bind to plectin (Niessen et al., 1997
). As the PS integrins have a more standard length of
subunit cytoplasmic tail (47 amino acids vs. the 1019 amino acids of
4), an
intervening linker protein may be required (indicated by
the grey sphere in Fig. 7) to connect the PS integrins to
Kakapo. We might expect this adaptor to be encoded by
one of the other loci identified in the screen, such as rhea,
which has a similar epidermal detachment phenotype
(Prout et al., 1997
). If this adaptor protein exists, it will be
of interest to see if it is similar in sequence to the cytoplasmic tail of
4.
Kakapo is not only similar in sequence to plectin and
BPAG1, it is also similar to dystrophin. However, the pattern of expression of Kakapo is more similar to the expression of BPAG1 than dystrophin, while plectin is expressed
almost ubiquitously. Like BPAG1, Kakapo is strongly expressed in epidermal cells, and neither are expressed in the
muscles, where dystrophin is strongly expressed. Furthermore, we have shown the subcellular localization of
Kakapo to be primarily at the site of the prominent hemiadherens junctions that are present both apically and basally in the epidermal muscle attachment site, as well as
some decoration of the intervening cytoskeleton. Basal hemiadherens junctions consist of extensive plaques of
electron-dense material where actin and microtubules
connect to the extracellular matrix, while at the smaller
apical junctions, microtubules are attached to the overlying cuticle (Prokop et al., 1998a
). This subcellular localization resembles that seen for BPAG1 and plectin, which
localize to the inner plaque of hemidesmosomes and decorate intermediate filaments (Wiche et al., 1984
; Guo et al.,
1995
; Svitkina et al., 1996
), and is quite distinct from the
general cortical staining of dystrophin in the muscles
(Brown and Lucy, 1997
). The staining we have observed is
not completely identical to that seen with an antibody
raised against the carboxy terminus of Kakapo, which
shows staining earlier in embryogenesis than our antibody
to the amino terminus, and looks more cortical (Strumpf and Volk, 1998
). The Kakapo gene extends over 70 kb,
and there may be additional isoforms of Kakapo yet to be
identified. This would be similar to the plectin and BPAG
genes that produce alternate isoforms, some of which lack
the actin-binding domain or rod sections (Yang et al.,
1996
; Elliott et al., 1997
).
Finally, the phenotype of Kakapo is more similar to
BPAG1 and plectin than to dystrophin. Mutations in
BPAG1 or plectin cause skin blistering due to rupture of
epidermal cells and neuromuscular defects (Guo et al.,
1995
; Smith et al., 1996
). The kakapo gene was identified
by screening for a related phenotype in Drosophila; mutant cells cause blisters in the adult wing (Prout et al., 1997
; Walsh and Brown, 1998
). In the embryo, kakapo mutations cause detachment of the epidermis from the muscles
similar to skin blisters, and the ultrastructural phenotype
is remarkably similar, where mechanical stress leads to
breaking of the cells into apical and basal halves (Guo et al.,
1995
; Prokop et al., 1998b
). In contrast, the muscles appear
to develop normally, and have normal sarcomeric structure (Fig. 6 and our unpublished results), in contrast to the
muscular degeneration that occurs in the absence of dystrophin (Brown and Lucy, 1997
). The striking similarity of
sequence, expression pattern, and mutant phenotype provide consistent evidence for the functional relationship of
Kak with vertebrate hemidesmosomal proteins. Consequently, we propose that Kak plays a homologous role to
the vertebrate plakin family in the Drosophila hemi-adherens junction, acting as an essential adaptor that distributes the extension stress generated by muscle contraction
from membrane-bound receptors into the cortical actin
and stabilized microtubule arrays.
The identification of a new cytoskeletal linker protein as
the product of a gene required for integrin-mediated adhesion events strengthens the view that integrins do play an
important structural role in mediating adhesion. Our current model for the interaction between Kakapo and the PS
integrins is that they are connected indirectly through a
protein that serves a similar function to the extended cytoplasmic domain of the
4 integrin subunit (as shown in Fig.
7). However, this result is clearly an incomplete description, because, unlike Kakapo, PS integrins are not essential for the linkage between the plasma membrane and
microtubules in the epidermal muscle attachment cells
(Prokop et al., 1998a
). The fact that Kakapo is required for
this microtubule-membrane linkage suggests that Kakapo
interacts, directly or indirectly, with more transmembrane
proteins than just the known integrins. This is also indicated by Kakapo localization at the apical surface, which
lacks the PS integrins. Whether these additional adhesion receptors include novel integrins or alternative classes of
receptor is an open question, but one that may be resolved
by cloning more of the loci identified in recent genetic
screens for adhesion defects (Prout et al., 1997
; Walsh and
Brown, 1998
).
The early phenotype we have documented where the integrity of the epidermal cell layer is impaired also indicates the diversity of Kakapo function, because this is not
a phenotype found in PS integrin mutants. In addition, the
observation that the differentiation of the epidermal muscle attachment cells is perturbed in kakapo mutant embryos (Strumpf and Volk, 1998
) suggests that Kakapo may be required to allow signaling events leading to cell differentiation. We do not think that the change in differentiation of the epidermal muscle attachment cells is sufficient
to account for the epidermal detachment phenotype of
Kakapo mutants, since although
1 tubulin expression is
reduced (Strumpf and Volk, 1998
), microtubule bundles are still present in those cells, but are detached from the
plasma membrane (Prokop et al., 1998b
), indicating that
Kakapo is essential for the link between the two. However, the role of Kakapo in epidermal differentiation combined with its role in determining the subcellular localization of transmembrane adhesion proteins in neurons
(Prokop et al., 1998b
) suggests that one important function of Kakapo is to organize receptors within the plasma
membrane. Thus, the Kakapo protein, which from its sequence homology and phenotype seems to be an important component of the cytoskeleton, may potentially affect
signaling through the role of the cytoskeleton in organizing membrane-bound receptors into functional signaling
complexes.
The kakapo gene is the first of the novel genes to be cloned from the screens for mutations required for integrin-mediated adhesion. The fact that kakapo encodes a cytoskeletal linker protein related to proteins that are also implicated in integrin-mediated adhesion demonstrates the success of the genetic screening approach. Therefore, the characterization of the remaining 16 loci isolated from these screens should substantially contribute to our understanding of the cellular machinery required for integrin adhesion.
| |
Footnotes |
|---|
Received for publication 24 April 1998 and in revised form 10 September 1998.
Address all correspondence to N.H. Brown, Wellcome/CRC Institute and
Department of Anatomy, University of Cambridge, Tennis Court Road,
Cambridge CB2 1QR, UK. Tel.: 44-1223-334128. Fax: 44-1223-334089. E-mail: nb117{at}mole.bio.cam.ac.uk
We are grateful to T. Volk, D. Strumpf, and A. Prokop for sharing unpublished data, to O. Dunin-Borkowski and M.D. Martín-Bermudo for the stained embryo preparations shown in Fig. 4, e and h, and to R. Fehon, D. Kiehart, A. Beaton, and T. Volk for fly strains and antibodies. We also thank J. Overton for technical assistance and M.D. Martín-Bermudo and S. Bray for helpful comments on the manuscript.
This work was supported by grants from the Wellcome Trust to N.H. Brown: a Senior Fellowship and Project Grant 050301.
| |
Abbreviations used in this paper |
|---|
BPAG2, bullous pemphigoid antigen 2; PS, position-specific.
| |
References |
|---|
|
|
|---|
| 1. |
Andra, K.,
H. Lassmann,
R. Bittner,
S. Shorny,
R. Fassler,
F. Propst, and
G. Wiche.
1997.
Targeted inactivation of plectin reveals essential function in
maintaining the integrity of skin, muscle, and heart cytoarchitecture.
Genes
Dev
11:
3143-3156
|
| 2. | Bernier, G., M. Mathieu, Y. Derepentigny, S.M. Vidal, and R. Kothary. 1996. Cloning and characterization of mouse ACF7, a novel member of the Dystonin subfamily of actin binding proteins. Genomics. 38: 19-29 [Medline]. |
| 3. | Brancolini, C., M. Benedetti, and C. Schneider. 1995. Microfilament reorganization during apoptosis: the role Of Gas2, a possible substrate for Ice like proteases. EMBO (Eur. Mol. Biol. Organ.) J 14: 5179-5190 [Medline]. |
| 4. |
Brancolini, C.,
S. Bottega, and
C. Schneider.
1992.
Gas2, a growth arrest specific protein, is a component of the microfilament network system.
J. Cell
Biol
117:
1251-1261
|
| 5. | Brower, D.L., and S.M. Jaffe. 1989. Requirement for integrins during Drosophila wing development. Nature. 342: 285-287 [Medline]. |
| 6. | Brower, D.L., R.J. Smith, and M. Wilcox. 1980. A monoclonal antibody specific for diploid epithelial cells in Drosophila. Nature. 285: 403-405 [Medline]. |
| 7. |
Brower, D.L.,
M. Wilcox,
M. Piovant,
R.J. Smith, and
L.A. Reger.
1984.
Related cell-surface antigens expressed with positional specificity in Drosophila
imaginal discs.
Proc. Natl. Acad. Sci. USA.
81:
7485-7489
|
| 8. | Brown, N.H.. 1993. Integrins hold Drosophila together. BioEssays. 15: 383-390 [Medline]. |
| 9. | Brown, N.H., and F.C. Kafatos. 1988. Functional cDNA libraries from Drosophila embryos. J. Mol. Biol 203: 425-437 [Medline]. |
| 10. |
Brown, N.H.,
D.L. King,
M. Wilcox, and
F.C. Kafatos.
1989.
Developmentally
regulated alternative splicing of Drosophila integrin PS2 transcripts.
Cell
59:
185-195
[Medline].
|
| 11. | Brown, S.C., and J.A. Lucy. 1997. Dystrophin: gene, protein, and cell biology. Cambridge University Press, Cambridge, UK. 338 pp. |
| 12. | Burridge, K., K. Fath, T. Kelly, G. Nuckolls, and C. Turner. 1988. Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton. Annu. Rev. Cell Biol 4: 487-525 . |
| 13. | Burridge, K., C.E. Turner, and L.H. Romer. 1992. Tyrosine phosphorylation of paxillin and pp125(Fak) accompanies cell adhesion to extracellular matrix: a role in cytoskeletal assembly. J. Cell Biol 119: 893-903 |