|
||
and hVPS34
Phosphatidylinositol 3'-Kinases in Vesicular Trafficking,
Regulation of the Actin Cytoskeleton, and Mitogenesis
Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461
| |
Abstract |
|---|
|
|
|---|
We have examined the roles of the p85/
p110
and hVPS34 phosphatidylinositol (PI) 3'-kinases
in cellular signaling using inhibitory isoform-specific
antibodies. We raised anti-hVPS34 and anti-p110
antibodies that specifically inhibit recombinant hVPS34
and p110
, respectively, in vitro. We used the antibodies to study cellular processes that are sensitive to low-dose wortmannin. The antibodies had distinct effects
on the actin cytoskeleton; microinjection of anti-p110
antibodies blocked insulin-stimulated ruffling, whereas
anti-hVPS34 antibodies had no effect. The antibodies
also had different effects on vesicular trafficking. Microinjection of inhibitory anti-hVPS34 antibodies, but
not anti-p110
antibodies, blocked the transit of internalized PDGF receptors to a perinuclear compartment,
and disrupted the localization of the early endosomal protein EEA1. Microinjection of anti-p110
antibodies, and to a lesser extent anti-hVPS34 antibodies, reduced the rate of transferrin recycling in CHO cells.
Surprisingly, both antibodies inhibited insulin-stimulated DNA synthesis by 80%. Injection of cells with antisense oligonucleotides derived from the hVPS34 sequence also blocked insulin-stimulated DNA synthesis,
whereas scrambled oligonucleotides had no effect. Interestingly, the requirement for p110
and hVPS34 occurred at different times during the G1-S transition.
Our data suggest that different PI 3'-kinases play distinct regulatory roles in the cell, and document an unexpected role for hVPS34 during insulin-stimulated mitogenesis.
| |
Introduction |
|---|
|
|
|---|
PHOSPHATIDYLINOSITOL (PI)1 3'-kinases are lipid kinases implicated in a wide range of cellular phenomena (Fruman et al., 1998
). PI 3'-kinases have
been grouped into three classes based on their use of different phosphoinositide substrates (Vanhaesebroeck et al.,
1997
). Class I enzymes use PI, PI[4]P, and PI[4,5]P2 as substrates, producing PI[3]P, PI[3,4]P2, and PI[3,4,5]P3. They
include the well-studied p85/p110 PI 3'-kinases, which are
activated by receptor tyrosine kinases, and the PI3K-
,
which is activated by 
-subunits from trimeric G proteins
(Kapeller and Cantley, 1994
; Stoyanov et al., 1995
; Stephens et al., 1997
). Class II enzymes are larger in size
(170-210 kD) and contain a COOH-terminal C2 domain
(MacDougall et al., 1995
; Molz et al., 1996
; Virbasius et al.,
1996
; Domin et al., 1997
). These enzymes use both PI and
PI[4]P as substrates, but will not produce PIP3 from
PI[4,5]P2. Class III enzymes include the Saccharomyces
cerevisiae enzyme VPS34 and its homologues in Schizosaccharomyces pombe, Dictyostelium discoideum, Drosophila, and humans (Herman and Emr, 1990
; MacDougall et
al., 1995
; Volinia et al., 1995
; Takegawa et al., 1995
; Zhou
et al., 1995
; Linassier et al., 1997
). VPS34 and its homologues are limited to production of PI[3]P from PI. In
yeast, VPS34 associates in vivo with a myristylated serine
kinase, VPS15 (Stack et al., 1993
), and this association is
critical for VPS34 function (Stack et al., 1993
). The human homologue of VPS15, p150, is also a myristylated protein
kinase that binds to hVPS34 in vivo and increases its lipid
kinase activity twofold in vitro (Panaretou et al., 1997
).
The lipid products of the PI 3'-kinases are not substrates
for known phospholipases and appear to function as second messengers (Serunian et al., 1989
). PI[3,4,5]P3 may directly activate its effector enzymes, such as calcium-independent protein kinase C isoforms (Toker et al., 1994
,
1995
). Alternatively, production of 3-phosphoinositides in
cellular membranes may recruit signaling molecules that
contain specialized lipid-binding domains (Lemmon et al.,
1996
). Examples include the serine kinase Akt/PKB and its upstream activator the 3-phosphoinositide-dependent
kinase-1, which contain Pleckstrin homology domains that
bind PI[3,4]P2 and PI[3,4,5]P3 (for review see Toker and
Cantley, 1997
), and the endosomal protein EEA1, which
contains a zinc finger domain that binds to PI[3]P (Stenmark et al., 1996
; Patki et al., 1997
).
The functions of the different PI 3'-kinases in mammalian cells have been studied using tools that vary significantly in their specificity. Mutant p85 molecules or SH2
domains from p85 produce dominant-negative phenotypes
in microinjected or transfected cells (Jhun et al., 1994
;
Hara et al., 1995
), and mutagenesis of p85 binding sites in
receptor tyrosine kinases blocks p85/p110 activation (for
review see Cantley et al., 1991
). However, these approaches do not distinguish between different p110 isoforms which should all bind p85. Less-specific approaches
include overexpression of the p110
PI 3'-kinase, which
produces PI[3]P, PI[3,4]P2, and PI[3,4,5]P3 and can feed
into pathways normally regulated by class I, II, or III enzymes. Similarly, treatment of cells with wortmannin inhibits both the mammalian class I and class III enzymes at
low nanomolar doses (Vanhaesebroeck et al., 1997
). (Unlike the mammalian enzyme, the yeast VPS34 is relatively
insensitive to wortmannin [Schu et al., 1993
].) The use of
wortmannin is further complicated by the fact that inhibition of mammalian class II PI 3'-kinases requires high
nanomolar to micromolar concentrations (Domin et al.,
1997
). These doses also inhibit PI 4-kinases, and could
affect cellular levels of PI[4,5]P2 (Meyers and Cantley,
1997
).
The p85/p110 PI 3'-kinases have been implicated in mitogenic signaling, regulation of the actin cytoskeleton, resistance to apoptosis, and trafficking of the Glut 4 glucose
transporter (Fruman et al., 1998
). In contrast, little is
known about the function of class III PI 3'-kinases in
mammalian cells. In S. cerevisiae and S. pombe, VPS34-null strains show disruption of vacuolar sorting at permissive and nonpermissive temperatures, and reduced growth at elevated temperatures (Herman and Emr, 1990
; Takegawa et al., 1995
). The authors suggest that the combined
stress of high temperature plus abnormal vacuolar function may inhibit growth at high temperature. Alternatively, they suggest that some vacuolar function might be required for high temperature growth (Takegawa et
al., 1995
). In D. discoideum, reduced expression of the
DdPIK5 homologue leads to reduced growth on bacterial
lawns but not in suspension culture (Zhou et al., 1995
),
suggesting a lysosomal defect that causes a reduced ability
to utilize bacteria as food. On the other hand, a complete
gene knockout of the D. discoideum VPS34 homologue is
lethal, implying that VPS34 may be essential for growth.
Our approach has been to study the intracellular function of distinct PI 3'-kinase by developing isoform-specific
inhibitory anti-PI 3'-kinase antibodies. We have focused
on the role of p110
and hVPS34, which are wortmannin-sensitive class I and III enzymes, in a number of wortmannin-sensitive responses. We find that insulin-stimulated reorganization of filamentous actin is inhibited by microinjection of antibodies to p110
but not hVPS34. In contrast, antibodies to both enzymes inhibit vesicular trafficking: anti-hVPS34 antibodies interfere with the sorting of
endocytosed PDGF receptors, disrupt the localization of
the early endosomal protein EEA1, and modestly inhibit
transferrin recycling, whereas anti-p110
antibodies strongly inhibit transferrin recycling. Surprisingly, antibodies to
hVPS34 as well as p110
inhibit insulin-stimulated DNA
synthesis. However, the requirement for p110
and
hVPS34 occur at different times during the G1-S transition. These studies represent a first step in the assignment
of distinct PI 3'-kinases to the regulation of distinct cellular events.
| |
Materials and Methods |
|---|
|
|
|---|
Cells
Growth of GRC-LR+73 cells, an insulin-responsive derivative of CHO
cells, has been previously described (Pollard and Stanners, 1979
; McIlroy
et al., 1997
). Hep G2 cells expressing the wild-type PDGF receptor (Valius and Kazlauskas, 1993
) were generously provided by A. Kazlauskas
(Harvard University, Cambridge, MA) and were grown in DME containing 10% fetal bovine serum. Trvb-1 cells, a CHO cell line expressing the
human transferrin receptor (McGraw et al., 1987
), were generously provided by T. McGraw (Cornell University School of Medicine, New York,
NY) and were grown in
-MEM containing 10% fetal bovine serum.
Antibodies
Anti-hVPS34 antibodies were raised in New Zealand white rabbits against
a peptide corresponding to residues 871-887 of the human VPS34 sequence, AVVEQIHKRAQYWRK (Volinia et al., 1995
). Antibodies were
purified using an affinity column made from the same peptide coupled to
CNBr Sepharose (Pharmacia Biotech, Piscataway, NJ). Antibodies for micronjection were dialyzed into phosphate-buffered saline and concentrated to 3 mg/ml. Antibodies to p110
have been previously described
(McIlroy et al., 1997
). Anti-EEA1 antibodies were purchased from Transduction Laboratories (Lexington, KY).
Antisense Oligonucleotides
Phosphorothioate oligonucleotides were synthesized (Genelink, Thornwood, NY) so as to be anticomplimentary to sequences from hVPS34. AS1: TCCCCCCATCGCACCGTCTGC (based on nucleotides 36-56 in the hVPS34 GenBank/EMBL/DDBJ sequence Z46973). AS2: AAACTTCTCTGCTTCCCCCAT (based on nucleotides 48-68); AS3: TCTGATCCATCTGC-TTCTACA (based on nucleotides 491-511).
Production of Recombinant p110
and hVPS34
Sf-9 cells were infected with recombinant baculovirus for bovine p110
(cDNA provided by M. Waterfield, Ludwig Institute for Cancer Research, London, UK), hVPS34 (virus provided M. Waterfield) or p110
(virus provided by A. Morris, State University of New York at Stony
Brook, Stony Brook, NY). After 2 d in culture, the cells were washed in
ice-cold PBS and lysed by freeze-thawing in 10 mM Tris, pH 7.4, 150 mM
NaCl, 1 mM EDTA, 100 µg/ml aprotinin, 1 µg/ml leupeptin, and 350 µg/
ml PMSF. After removal of particulate material by centrifugation at
12,000 g, the lysates were assayed directly for PI 3'-kinase activity as described below.
In Vitro PI 3'-Kinase Assays
Sf-9 lysates containing recombinant p110
, p110
, or hVPS34 were incubated in the absence or presence of antibodies as described in the text. PI
3'-kinase activity was then assayed using sonicated bovine liver phosphatidylinositol (200 µg/ml), ATP (45 µM), and 10 mM MgCl2 or MnCl2 as previously described (Rordorf-Nikolic et al., 1995
). Where indicated, p110
or hVPS34 was first immunoprecipitated from Sf-9 or CHO detergent lysates with anti-p110
or anti-hVPS34 antibodies. The protein A pellets
were washed and assayed as described by Ruderman et al. (1990)
. In some
cases, the enzymes were first eluted from the antibody by incubation for
30 min at 30°C in the presence of 100 µM hVPS34-derived peptide (Field
et al., 1988
).
[35S]Methionine
Cells were incubated for 5 h in cysteine/methionine-free medium containing 1 mCi/ml [35S]cysteine/methionine (Easy-tag, New England Nuclear,
Boston, MA). The cells were then washed with phosphate-buffered saline, lysed in under non-denaturing (Yu et al., 1998
) or denaturing (Martys et al.,
1996
) conditions, and then proteins were immunoprecipitated with anti-hVPS34 or anti-p110
antibodies and absorbed to protein A-Sepharose
beads. The beads were washed five times in RIPA buffer, followed by an
additional four washes in RIPA containing 1 M NaCl. After a final wash
in PBS, the proteins were eluted, separated by SDS-PAGE, and then visualized by autoradiography.
Microinjection
Cells were grown on polylysine-coated glass coverslips. GRC-LR+73 cells were transferred to medium containing 1% fetal bovine serum for 48 h before injection. HepG2/PDGF-R cells were incubated in serum-free medium overnight before injection. Microinjections were conducted using an Eppendorf semiautomated microinjection system and needles pulled on a Sutter p-87 micropipette puller. Antibodies (2-4 mg/ml) or oligonucleotides (10 µM) were mixed with nonspecific rabbit IgG in PBS, pH 7.4, to a final antibody concentration of 3 mg/ml. Cells were allowed to recover for 2 h before further manipulation.
Actin Reorganization
GRC-LR+73 cells were injected with control or anti-PI 3'-kinase antibodies as indicated. After a 2-h recovery period, the cells were stimulated
with insulin for 7 min, fixed with 3.7% formaldehyde, and stained with
FITC anti-rabbit antibodies (to detect injected cells) or rhodamine-phalloidin (Molecular Probes, Eugene, OR), to visualize the actin cytoskeleton (Segall et al., 1996
).
EEA1 Staining
Cells were injected with control IgG or anti-PI 3'-kinase antibodies, allowed to recover for 2 h, and then fixed with 3.7% formaldehyde for 20 min on ice. The cells were permeabilized with methanol on dry ice, blocked with 10% goat serum, and stained with FITC anti-rabbit IgG (to detect injected cells) or anti-EEA1 antibodies (Transduction Laboratories). EEA1 staining was visualized using the Renaissance signal amplification kit (New England Nuclear Life Science Products, Boston, MA), according to the manufacturer's instructions.
Transferrin Recycling
Trvb-1 cells were injected with control or anti-PI 3'-kinase antibodies as
indicated, and allowed to recover for 2 h. The cells were loaded with Cy3-transferrin for 2 h, washed, and then fixed immediately or after an additional hour in transferrin-free medium as previously described (Martys et al.,
1996
). The cells were permeabilized with saponin as described (McGraw
et al., 1987
) and stained with FITC anti-rabbit antibodies to visualize injected cells.
PDGF Receptor Trafficking
PDGF receptor internalization was measured as described by Joly et al.
(1994)
. HepG2/PDGF-R cells were incubated in serum-free medium overnight. The cells were injected with control or anti-PI 3'-kinase antibodies
and allowed to recover for 2 h. The cells were then incubated for 70 min
on ice with monoclonal anti-PDGF receptor antibody (20 µg/ml final; Calbiochem-Novabiochem, La Jolla, CA) and recombinant human PDGF-BB (20 ng/ml; Calbiochem-Novabiochem). The cells were either fixed immediately or rapidly warmed by immersion in medium at 37°C for 10 min
before fixation. The cells were stained with FITC anti-rabbit antibodies to
visualize injected cells, or Cy3-anti-mouse antibodies to visualize PDGF
receptors.
BrdU Incorporation
After injection, cells were kept in medium containing 1% FBS or stimulated with 100 nM insulin as indicated. When indicated, the cells were injected at various times after insulin stimulation. 16 h after the onset of insulin stimulation, the cells were incubated with 100 µM BrdU for 2 h and
fixed in 3.7% formaldehyde. Nuclear DNA was denatured by treating the
cells with 4 N HCl for 3 min, and the cells were permeabilized in methanol
at
20°C and stained with rhodamine-conjugated anti-BrdU antibody to
measure DNA synthesis, and FITC-conjugated anti-rabbit IgG to determine microinjected cells. The percentage of microinjected cells that was
positive for BrdU staining was determined. Data from each experiment
reflects the counting of ~100 injected cells per condition. The mean and SEM values were generated by pooling percentages from different experiments, where n = the number of separate experiments.
| |
Results |
|---|
|
|
|---|
Characterization of Anti-p110
and
Anti-hVPS34 Antibodies
We have previously described antibodies to residues 1054-
1068 of p110
, which inhibit p110
in vitro and in microinjected cells (McIlroy et al., 1997
). We also raised antibodies against residues 871-887 at the COOH terminus of the
human VPS34 primary sequence. To test the specificity of
the antibodies, we labeled three different cell lines for 5 h
with a mixture of [35S]methionine and [35S]cysteine. The
lines were: a CHO-derived line selected for tight quiescence during serum withdrawal (Pollard and Stanners,
1979
) (GRC-LR+73), a CHO line expressing the human
transferrin receptor (McGraw et al., 1987
) (Trvb-1), and a
HepG2 line expressing the human PDGF receptor (Valius
and Kazlauskas, 1993
). We then lysed the cells under nondenaturing and denaturing conditions, and performed immunoprecipitations with control IgG or the anti-PI kinase
antibodies. The anti-p110
antibodies were ineffective under denaturing conditions, but under nondenaturing conditions precipitated a single 110-kD band from all three
cell lines (Fig. 1, left). The p85 regulatory subunit of p85/
p110 PI 3'-kinase was not observed in these experiments, presumably because p110
has significantly more cysteine
and methionine residues (70, versus 16 for p85) and turns
over more rapidly than p85 (Yu et al., 1998
). The anti-hVPS34 antibodies was effective under denaturing conditions and precipitated a major specific 100-kD band from
all three cell lines (Fig. 1, right). Additional bands minor
were observed but were also present after immunoprecipitation with control IgG, and therefore reflect nonspecific
interactions.
|
We further characterized the new anti-hVPS34 antibodies. They could immunoprecipitate recombinant human
hVPS34 from Sf-9 lysates (Fig. 2 A). The antibody also
precipitate a PI 3'-kinase activity from CHO lysates; this
activity was manganese dependent, consistent with the ion
specificity of hVPS34 (Fig. 2 B) (Volinia et al., 1995
). Although we could measure PI kinase activity in the anti-hVPS34 immunoprecipitates, the antibody was in fact inhibitory toward hVPS34. Fig. 2 C shows that the activity of
immunoprecipitated recombinant hVPS34 was increased
when eluted from antibody-protein A beads by incubation
with the antigen peptide. Inhibition of hVPS34 could be
directly measured in a soluble in vitro assay with recombinant hVPS34. hVPS34 activity was inhibited 75% by anti-hVPS34 antibodies, but was unaffected by a previously described antibody that binds and inhibits the p110
PI 3'-kinase (Fig. 2 D, left). Importantly, the anti-hVPS34-1
antibody had no effect on the activity of recombinant
p110
(Fig. 2 D, right). In contrast, anti-p110
antibody
inhibited p110
by 80%. Neither antibody inhibited the
activity of recombinant p110
(data not shown). Inhibition of hVPS34 by the anti-hVPS34 antibody was dose dependent (Fig. 2 E).
|
Role of p110
and hVPS34 in Insulin-stimulated
Membrane Ruffling
We used the isoform-specific antibodies to examine the
roles of p110
and hVPS34 in the regulation of the actin
cytoskeleton. GRC-LR+73 cells were microinjected with
control IgG or anti-PI kinase antibody, incubated in the
absence or presence of 100 nM insulin for 7 min, and then
fixed. Cells were stained with FITC-labeled anti-rabbit
antibodies to identify microinjected cells (Fig. 3, left), or
rhodamine-phalloidin, to visualize filamentous actin (Fig.
3, right; asterisks, injected cells). In quiescent cells injected
with control IgG, rhodamine-phalloidin-stained cells appeared flat with prominent stress fibers (Fig. 3, A and B). Quiescent cells injected with anti-hVPS34 antibodies (Fig.
3, E and F) or anti-p110
antibodies (Fig. 3, I and J) were
similar to the IgG-injected cells in appearance. When IgG-injected cells were stimulated with insulin for 7 min, prominent actin-rich projections appeared at the periphery of
the cells (Fig. 3, C and D). These projections appear somewhat blurry, as they extend out of the plane of focus used
to visualize the stress fibers. In cells injected with anti-hVPS34 antibodies, insulin-stimulation of actin-rich projections was also apparent (Fig. 3, G and H). However, injection of cells with antibodies against p110
completely
blocked the insulin-stimulated appearance of actin-rich
projections (Fig. 3, K and L). These data implicate p110
,
rather than hVPS34, as critical for insulin-stimulated rearrangement of the actin cytoskeleton.
|
Role of p110
and hVPS34 in Early Endosomal Events
Recent data from Corvera, Stenmark, and their colleagues
have shown that the early endosomal protein EEA1 is displaced from endosomes by wortmannin and binds specifically to vesicles containing PI[3]P (Patki et al., 1997
, 1998
;
Gaullier et al., 1998
). Although the production of PI(3)P
in the endosomal membrane could be the result of any
of the known PI 3'-kinases, the exclusive production of
PI(3)P by hVPS34 would make it a likely candidate. We
therefore tested the effects of the inhibitory antibodies on
the localization of EEA1. In control Trvb-1 cells or cells
injected with rabbit IgG (Fig. 4 A), EEA1 is located in
large vesicular structures scattered throughout the cytoplasm. Injection of Trvb-1 cells with anti-p110
antibodies
(Fig. 4 B) had little effect on EEA1. In contrast, in cells injected with anti-hVPS34 antibodies, EEA1 was no longer
associated with small vesicles but concentrated in large
perinuclear structures (Fig. 4 C). This change in the subcellular localization of EEA1 was similar to that seen in
Trvb-1 cells treated with 100 nM wortmannin (Fig. 4, D
and E). These data suggest that hVPS34 is required for the
localization of EEA1, presumably by producing PI(3)P in
the early endosomal membrane.
|
We also examined the postendocytic sorting of internalized PDGF receptors to a perinuclear compartment, which
is blocked by wortmannin (Joly et al., 1995
). HepG2 cells
expressing the wild-type PDGF receptor were incubated
at 4°C with mouse anti-PDGF receptor antibodies and 20 ng/ml PDGF, then rapidly warmed to 37°C for 10 min to
initiate endocytosis. After fixation, injected cells were visualized with FITC-labeled anti-rabbit antibodies (Fig. 5,
left) and PDGF receptors were visualized with Cy3-labeled
anti-mouse antibodies (Fig. 5, right; asterisks, injected
cells). In cells that were fixed before the 10 min incubation
37°C, anti-PDGF receptor staining was entirely in the
plasma membrane and was unaffected by injection with
control or anti-PI 3'-kinase antibodies (data not shown).
In cells that were warmed to 37°C for 10 min, internalized receptors accumulated in small peripheral vesicles as well
as a prominent ring of larger perinuclear vesicles (Fig. 5
B). This perinuclear accumulation of PDGF receptors
was not affected by injection with control IgG (Fig. 5, A
and B) or anti-p110
antibodies (Fig. 5, C and D). In both
cases, the distribution of PDGF receptors in injected cells
is the same as that seen in noninjected cells in the same
field. In contrast, injection of cells with inhibitory anti-hVPS34 antibodies almost completely blocked the perinuclear accumulation of internalized PDGF receptors
(Fig. 5, E and F). The staining in these cells was similar to
that seen in cells treated with 100 nM wortmannin (data
not shown).
|
The effects of inhibitory anti-hVPS34 antibodies on the sorting of PDGF receptors was more clearly seen in cells fixed after 5 min at 37°C (Fig. 6). In control cells or cells injected with rabbit IgG (Fig. 6 A), PDGF receptors could be seen in small vesicles scattered throughout the cytoplasm, as well as large vesicles near the nucleus. Injection of anti-hVPS34 antibodies (Fig. 6 B) does not block internalization of PDGF receptors, but the internalized receptors are located in smaller vesicles that are primarily located at the cell periphery. These data would be consistent with a role for hVPS34 in the fusion and/or maturation of early endosomal vesicles.
|
Role of p110
and hVPS34 in Transferrin Recycling
We next examined the recycling of endocytosed transferrin, which is significantly slowed in cells treated with 100 nM
wortmannin (Martys et al., 1996
; Spiro et al., 1996
). Trvb-1
cells were injected with control IgG or anti-PI kinase antibodies, labeled for 2 h with Cy3-transferrin, and washed
into transferrin-free medium. We visualized the injected
cells with FITC-labeled anti-rabbit IgG (Fig. 7, left) and
compared their content of Cy3 transferrin (Fig. 7, right).
None of the antibodies affected the steady state labeling of
CHO cells, observed after the 2-h incubation with Cy3-transferrin (Fig. 7, A, C, and E); the internalized transferrin accumulated in a diffuse perinuclear compartment as
previously described (McGraw et al., 1987
; Martys et al.,
1996
). After 60 min in transferrin-free medium, most of
the internalized Cy3-transferrin had effluxed from cells injected with control IgG (Fig. 7 B). Cells injected with anti-hVPS34 antibodies showed a slightly higher level of residual Cy3-transferrin after 60 min (Fig. 7 D). In contrast,
cells injected with anti-p110
antibodies showed a persistent labeling with Cy3 after the 60-min incubation in transferrin-free medium (Fig. 7 F), reflecting a delay in the efflux of internalized Cy3-transferrin. These data are similar
to those obtained from cells treated with 100 nM wortmannin (Martys et al., 1996
), and suggest that p110
is the
primary wortmannin-sensitive PI 3'-kinase involved in
regulation of transferrin recycling.
|
A 60-min chase in transferrin-free medium was chosen
to maximize the differences between cells injected with
anti-PI 3'-kinase antibodies versus control IgG. Under
these conditions, hVPS34 antibodies had only a slight effect. However, when we examined the cells after a 30-min
chase in transferrin-free medium, it was clear that hVPS34
antibodies did reduce the rate of transferrin recycling (Fig.
7 G). To summarize, these data show that both anti-p110
and anti-hVPS34 antibodies inhibit recycling. Inhibition of
p110
had a greater effect on recycling than inhibition of hVPS34.
Role of p110
and hVPS34 in Insulin-stimulated
Mitogenic Signaling
Roche et al. (1994)
and ourselves have previously shown
that inhibitory antibodies to p110
block mitogen-stimulated DNA synthesis. To compare the role of p110
and
hVPS34 in mitogenic signaling, GRC-LR+73 cells were
injected with control IgG or anti-PI 3'-kinase antibodies,
stimulated with insulin for 16 h and labeled with BrdU.
Surprisingly, injection of anti-hVPS34 as well as anti-p110
antibodies inhibited insulin-stimulated DNA synthesis by 70% (Fig. 8).
|
To confirm the unexpected requirement for hVPS34 in mitogenic signaling, we designed three antisense phosphorothioate oligonucleotides derived from NH2-terminal or internal nucleotide sequences from hVPS34 (Materials and Methods). We initially tested these oligonucleotides in HeLa cells, as they were derived from a human sequence and were more likely to work in a human line. HeLa cells were difficult to render quiescent; after 2 d without serum the cells were still 28% BrdU positive, and insulin stimulation caused only a twofold increase in BrdU labeling to 58%. Nonetheless, this increase was completely blocked by injection of anti-hVPS34 antibody, and was reduced by 60-100% by injection of antisense oligonucleotides (data not shown).
We repeated the experiments in GRC-LR+73 cells,
which are more easily acquiesced (Pollard and Stanners,
1979
). Insulin stimulated DNA synthesis by more than
10-fold. Injection of AS1 and AS2 inhibited this insulin-stimulated DNA synthesis by 80 and 90%, respectively, as compared with a 70% inhibition achieved with anti-hVPS34 antibodies (Fig. 9 A). AS3 was less effective, inhibiting DNA synthesis by ~50% (Fig. 9 A). To test the
specificity of these effects, we synthesized scrambled versions of the more effective AS1 and AS2 oligonucleotides.
These were only slightly inhibitory in comparison to the
effects seen with the unscrambled oligonucleotides; AS1 and AS2 inhibited DNA synthesis by 87 and 91%, as opposed to 35 and 13% inhibition for their scrambled counterparts (Fig. 9 B). These antisense experiments provide a
confirmation of the antibody injection data, using entirely
distinct reagents.
|
To better define the requirement for hVPS34 in the insulin-stimulated G1-S transition, we injected cells with
anti-p110
or anti-hVPS34 antibodies before stimulating
the cells or at various times after insulin stimulation. Consistent with Roche et al. (1994)
, we find that p110
is required throughout the first 6 h of insulin stimulation (Fig.
10). By 9 h of insulin stimulation, the cells become largely
independent of p110
. Interestingly, the temporal requirement for hVPS34 was different than that for p110
. Although injection of anti-hVPS34 antibodies into cells after
3 h of insulin stimulation inhibited DNA synthesis by over 85%, injection at 6 h inhibited by only 50%, and injection
at 9 h inhibited by only 20%. These data suggest that both
hVPS34 and p110
are required for the insulin-stimulated
G1-S transition. However, the requirement for hVPS34 is
limited to an earlier period within G1 than the requirement for p110
.
|
| |
Discussion |
|---|
|
|
|---|
These data provide new insights into the role of different
classes of PI 3'-kinase in distinct cellular events. We have
examined a number of cellular responses that have been
previously shown to be inhibited by low doses of the PI 3'-kinase inhibitor wortmannin. Our studies have focused on
the wortmannin-sensitive class I (p110
) and class III
(hVPS34) PI 3'-kinases. The class II PI 3'-kinase are significantly less sensitive to wortmannin and are unlikely to
be involved in responses that are inhibited by 50-100 nM
wortmannin (Vanhaesebroeck et al., 1997
).
p110
can catalyze the production of PI[3]P, PI[3,4]P2,
and PI[3,4,5]P3, whereas hVPS34 is limited to the production of PI[3]P (Vanhaesebroeck et al., 1997
). Previous
studies have shown that cellular levels of PI[3,4]P2 and
PI[3,4,5]P3 increase in mitogen-stimulated cells, whereas
levels of PI[3]P remain unchanged (Auger et al., 1989
;
Kapeller et al., 1991
). Furthermore, the yeast VPS34 plays a role in the regulation of biosynthetic vacuolar sorting
(Schu et al., 1993
). Thus, our expectations before beginning these studies was that p110
would be involved in mitogen-stimulated responses such as rearrangement of the
cytoskeleton and DNA synthesis, whereas hVPS34 would
be involved in activities such as endocytic sorting. In fact,
the situation is more complex. Both hVPS34 and p110
are involved in vesicular trafficking and mitogenic signaling, albeit at different steps. In contrast, insulin-stimulated
actin rearrangement requires p110
, but does not require
hVPS34.
PI 3'-Kinases and the Organization of the Actin Cytoskeleton
Previous studies have shown that microinjection of
p85
(a mutant p85 that lacks p110 binding sites) inhibits insulin-stimulated membrane ruffling in KB cells (Kotani et al.,
1994
). Furthermore, Martin et al. (1996b)
have shown that
microinjection of an activated p110
construct is sufficient
to induce ruffling and stress fiber breakdown in 3T3-L1
adipocytes or rat-1 fibroblasts, whereas SH2 domains from
p85 were inhibitory. Our finding that p110
is required for
insulin-stimulated actin rearrangement is not surprising, but serves as a useful control for the specificity of the antibodies with regard to inhibition of p110
- and hVPS34-dependent responses in intact cells.
PI 3'-Kinases in Early Endosomal Function
Inhibition of hVPS34, but not p110
, has pronounced effects on two early endosomal events: the targeting of
EEA1 to the early endosome, and the postendocytic sorting of the PDGF receptor. These data suggest that the
early endosome is a major site of hVPS34 action. Our finding that hVPS34 is responsible for the targeting of EEA1
is consistent with several recent studies showing that the
FYVE finger of EEA1 binds specifically to the product of
hVPS34, PI(3)P (Gaullier et al., 1998
; Patki et al., 1998
). Moreover, expression of EEA1 in S. cerevisiae leads to
a VPS34-dependent accumulation in intracellular membranes (Burd and Emr, 1998
). EEA1 in turn is required
for homotypic fusion of early endosomes, and may function by recruitment of rab5 to the endosomal membrane (Mills et al., 1998
; Simonsen et al., 1998
). Thus, the
hVPS34-dependent recruitment of EEA1 plays a critical
role in early endosomal function. It remains to be seen
how hVPS34 itself is targeted to the endosomal membrane, perhaps via binding to the myristylated p150 (Panaretou et al., 1997
). We also cannot yet explain the perinuclear
localization of EEA1 in cells injected with anti-hVPS34
antibodies or treated with wortmannin. It is possible that
this reflects the continued activity of a class II PI 3'-kinase,
which would not be inhibited by either our antibodies or
100 nM wortmannin.
Inhibitory antibodies to hVPS34 also disrupt the postendocytic trafficking of the PDGF receptor, consistent with
the ability of low-dose wortmannin to block PDGF receptor targeting and degradation (Joly et al., 1995
). Although
this could be due to an early endosomal defect, we cannot
rule out additional sites of action at the late endosome or
lysosome. The the involvement of hVPS34 in PDGF receptor trafficking may be analogous to the role of yeast
VPS34 in vacuolar targeting (Herman et al., 1992
), and is
consistent with data from numerous laboratories showing
that wortmannin inhibits both early and late endosomal
fusion events and lysosomal delivery (for review see De
Camilli et al., 1996
).
Although our data suggest that p110
is not involved in
early endosomal function, it should be noted that CHO
cells contain both p110
and p110
. p110
also couples to
p85 and should be similarly regulated by insulin or PDGF
(Hu et al., 1993
). Thus, it is possible that p85/p110
complexes play a role in the regulation of PDGF receptor
sorting or EEA1 localization that augments the role of
hVPS34. Such a requirement would be consistent with the finding that mutation of the p85 binding sites in the PDGF
receptor mimic the effects of wortmannin on receptor
sorting (Joly et al., 1994
). The testing of anti-p110
antibodies is ongoing in the laboratory and will help to resolve
this question.
PI 3'-Kinases in Transferrin Recycling
The recycling of transferrin receptors in Trvb-1 cells was
significantly slowed by treatment of cells with wortmannin
(Martys et al., 1996
). The effects of this drug on the distribution of transferrin receptors was half-maximal at 30 nM
wortmannin, consistent with the involvement of a mammalian class I or III PI 3'-kinase (Vanhaesebroeck et al.,
1997
). We now find that inhibition of both p110
and to a
lesser extent hVPS34 replicates the wortmannin phenotype with regard to transferrin recycling.
The role of the p85/p110
PI 3'-kinase as a positive regulatory of receptor recycling is consistent the fact that insulin, which activates p85/p110 (Ruderman et al., 1990
),
enhances the recycling of a number of constitutively recycling receptors (Wardzala et al., 1984
; Davis et al., 1986
).
Moreover, the p85/p110 PI 3'-kinase is required for the insulin stimulation of Glut-4 recycling to the plasma membrane (Okada et al., 1994
; Cheatham et al., 1994
) and
overexpression of p110
increases Glut 4 recycling in several systems (Martin et al., 1996a
; Frevert and Kahn,
1997
). Inhibition of hVPS34 also delays transferrin recycling, but to a much smaller extent. The different degrees
of inhibition observed with anti-hVPS34 versus anti p110
antibodies could reflect differential recruitment of a regulatory protein that binds to PI[3,4,5]P3 with higher affinity
than to PI[3]P. Alternatively, hVPS34 and p110
could act
on distinct proteins within the recycling compartment.
PI 3'-Kinases in Mitogenic Signaling
The most striking result in this study is the requirement for the hVPS34 in insulin-stimulated DNA synthesis. This result has been verified using two entirely different approaches to reduce hVPS34 activity and/or expression. Our data suggest that hVPS34 is specifically required for entry of insulin-stimulated cells into S phase.
Previous studies have shown that the levels of PI[3,4]P2
and PI[3,4,5]P3 increase acutely in response to mitogens
such as insulin or PDGF, whereas the levels of PI[3]P does
not change (Auger et al., 1989
; Kapeller et al., 1991
).
hVPS34 is restricted to the production of PI[3]P, and it is
therefore surprising that its activity is required for mitogenic signaling. It may be that constitutive levels of PI[3]P
are required for cellular systems that are needed during
the transition to S phase. Alternatively, PI[3]P levels may
be acutely regulated in specific intracellular locations that
are not detectable when whole cell lipid production is
measured. Although we do not yet know the function of
PI[3]P in mitogenic signaling, our data suggests that the
products of hVPS34 are required only during the first 6 h
of insulin stimulation. In contrast, the products of p110
are still critical at 6-9 h of insulin stimulation.
One can propose three general mechanisms by which
hVPS34 could act during mitogenic signaling. First, as suggested above, the constitutive production of PI[3]P could
be required for a cellular process that is needed during
early G1. For example, it is possible that normal trafficking of tyrosine kinase receptors is required for efficient
signal transduction. However, insulin receptor signaling is
relatively normal in cells expressing a dominant-negative
mutant of dynamin, which blocks coated pit-mediated endocytosis (Ceresa et al., 1998
). Second, insulin could regulate the activity and/or subcellular distribution of hVPS34,
leading to the production of PI[3]P at specific intracellular
locales. This PI[3]P could in turn recruit specific PI[3]P-binding proteins involved in mitogenic signaling. Finally, a
third hypothesis takes note of the potential conversion of
PI[3]P to higher-order polyphosphoinositides. A recent
finding by Anderson and colleagues (Zhang et al., 1997
) shows that PI[4]-5 kinases can convert PI[3]P to PI[3,4,5]P3. If this pathway is a significant source of PI[3,4]P2 and
PI[3,4,5]P3 in mitogen-stimulated cells, then reductions in
the PI[3]P pool could affect intracellular levels of PI[3,4]P2
and PI[3,4,5]P3. In this way, changes in PI[3]P levels could
influence the production of the 3-phosphoinositides that
have known signaling functions (Toker and Cantley,
1997
). Alternatively, two groups have identified a novel
lipid, PI[3,5]P2, in yeast and mammalian cells (Dove et al.,
1997
; Tolias et al., 1998
). In S. cerevisiae, PI[3,5]P2 is produced in response to osmotic stress by a pathway that requires VPS34 but is independent of the Hog1 mitogen-activated protein kinases (Dove et al., 1997
). These data
suggest a role for VPS34 in signal transduction, which
would be consistent with our findings regarding hVPS34
and mitogenesis.
In summary, we have examined the roles of type I and
type III PI 3'-kinases in mammalian cells. p110
and
hVPS34 PI 3'-kinases both effect the endoctyic system:
hVPS34 regulates events in the early endosome and to a
lesser extent the recycling compartment, whereas p110
primarily regulates the recycling pathway. Furthermore, both p110
and hVPS34 are necessary for insulin-stimulated DNA synthesis. However, the requirement for
hVPS34 occurs during a narrower time window in G1 than
the requirement for p110
, suggesting that these enzymes
perform different functions in mitogenic signaling. The determination of the distinct roles played by different PI 3'-kinase isoforms adds a new layer of complexity to the
functions of these lipid kinases in cellular signaling.
| |
Footnotes |
|---|
Address correspondence to J.M. Backer, Department of Molecular Pharmacology, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Tel.: (718) 430-2153. Fax: (718) 430-4922. E-mail: backer{at}aecom.yu.edu
Received for publication 2 March 1998 and in revised form 27 October 1998.
1. Abbreviation used in this paper: PI, phosphatidylinositol.
We thank T. McGraw (Cornell University School of Medicine), G. Orr,
and T. Meier (both from Albert Einstein College of Medicine [AECOM]), and B. Vanhaesebroeck (Ludwig Institute for Cancer Research) for helpful discussions. We thank M. Waterfield for the hVPS34 baculovirus and p110
cDNA, and A. Morris for the p110
baculovirus. We thank
M. Cammer (Analytical Imaging Facility, AECOM) for his help with the
confocal microscopy.
This work was supported by grants to J.M. Backer from the American Diabetes Association and National Institutes of Health (GM-55692). J.M. Backer is an Established Scientist of the American Heart Association, New York Affiliate, and is a recipient of a Scholar Awards from the Irma T. Hirschl Trust. J. McIlroy was supported by a fellowship from the Juvenile Diabetes Foundation.
| |
References |
|---|
|
|
|---|
| 1. | Auger, K.R., L.A. Serunian, S.P. Soltoff, P. Libby, and L.C. Cantley. 1989. PDGF-dependent tyrosine phosphorylation stimulates production of novel polyphosphoinositides in intact cells. Cell. 57: 167-175 [Medline]. |
| 2. | Burd, C.G., and S.D. Emr. 1998. Phosphatidylinositol(3)-phosphate signaling mediated by specific binding to RING FYVE domains. Mol. Cell. 2: 157-162 . [Medline] |
| 3. | Cantley, L.C., K.R. Auger, C. Carpenter, B. Duckworth, A. Graziani, R. Kapeller, and S. Soltoff. 1991. Oncogenes and signal transduction. Cell. 64: 231-302 . |
| 4. |
Ceresa, B.P.,
A.W. Kao,
S.R. Santeler, and
J.E. Pessin.
1998.
Inhibition of clathrin-mediated endocytosis selectively attenuates specific insulin receptor signal transduction pathways.
Mol. Cell. Biol.
18:
3862-3870
|
| 5. |
Cheatham, B.,
C.J. Vlahos,
L. Cheatham,
L. Wang,
J. Blenis, and
C.R. Kahn.
1994.
Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation.
Mol. Cell. Biol.
14:
4902-4911
|
| 6. |
Davis, R.J.,
S. Corvera, and
M.P. Czech.
1986.
Insulin stimulates cellular iron
uptake and causes the redistribution of intracellular transferrin receptors to
the plasma membrane.
J. Biol. Chem.
261:
8708-8711
|
| 7. | De Camilli, P., S.D. Emr, P.S. McPherson, and P. Novick. 1996. Phosphoinositides as regulators in membrane traffic. Science. 271: 1533-1539 [Abstract]. |
| 8. | Domin, J., F. Pages, S. Volinia, S.E. Rittenhouse, M.J. Zvelebil, R.C. Stein, and M.D. Waterfield. 1997. Cloning of a human phosphoinositide 3-kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem. J. 326: 139-147 . |
| 9. | Dove, S.K., F.T. Cooke, M.R. Douglas, L.G. Sayers, P.J. Parker, and R.H. Michell. 1997. Osmotic stress activates phosphatidylinositol-3,5-bisphosphate synthesis. Nature 390: 187-192 [Medline]. |
| 10. |
Field, J.,
J.-I. Nikawa,
D. Broek,
B. MacDonald,
L. Rodgers,
I.A. Wilson,
R.A. Lerner, and
M. Wigler.
1988.
Purifcation of a RAS-responsive adenylyl cyclase complex from Saccharomyces cervisiae by use of an epitope addition
method.
Mol. Cell. Biol.
8:
2159-2165
|
| 11. | Frevert, E.U., and B.B. Kahn. 1997. Differential effects of constitutively active phosphatidylinositol 3-kinase on glucose transport, glycogen synthase activity, and DNA synthesis in 3T3-L1 adipocytes. Mol. Cell. Biol. 17: 190-198 [Abstract]. |
| 12. | Fruman, D.A., R.E. Meyers, and L.C. Cantley. 1998. Phosphoinositide kinases. Annu. Rev. Biochem. 67: 481-507 [Medline]. |
| 13. | Gaullier, J.-M., A. Simonsen, A. D'Arrigo, B. Bremnes, H. Stenmark, and R. Aasland. 1998. FYVE fingers bind PtdIns(3)P. Nature. 394: 432-433 [Medline]. |
| 14. | Hara, K., K. Yonezawa, H. Sakue, K. Kotani, A. Kojima, M.D. Waterfield, and M. Kasuga. 1995. Normal activation of p70 S6 kinase by insulin in cells overexpressing dominant negative 85kD subunit of phosphoinositide 3-kinase. Biochem. Biophys. Res. Commun. 208: 735-741 [Medline]. |
| 15. |
Herman, P.K., and
S.D. Emr.
1990.
Characterization of VPS34, a gene required
for vacuolar protein sorting and vacuole segregation in Sarccharomyces cerevisiae.
Mol. Cell. Biol.
10:
6742-6754
|
| 16. | Herman, P.K., J.H. Stack, and S.D. Emr. 1992. An essential role for a protein and lipid kinase complex in secretory protein sorting. Trends Cell Biol. 2: 363-368 . [Medline] |
| 17. |
Hu, P.,
A. Mondino,
E.Y. Skolnik, and
J. Schlessinger.
1993.
Cloning of a novel,
ubiquitously expressed human phosphatidylinositol 3-kinase and identification of its binding site on p85.
Mol. Cell. Biol.
13:
7677-7688
|
| 18. |
Jhun, B.H.,
D.W. Rose,
B.L. Seely,
L. Rameh,
L. Cantley,
A.R. Saltiel, and
J.M. Olefsky.
1994.
Microinjection of the SH2 domain of the 85-kilodalton
subunit of phosphatidylinositol 3-kinase inhibits insulin-induced DNA synthesis and c-fos expression.
Mol. Cell. Biol.
14:
7466-7475
|
| 19. |
Joly, M.,
A. Kazlauskas,
F.S. Fay, and
S. Corvera.
1994.
Disruption of PDGF
receptor trafficking by mutation of its PI-3 kinase binding sites.
Science.
263:
684-687
|
| 20. |
Joly, M.,
A. Kazlauskas, and
S. Corvera.
1995.
Phosphatidylinositol 3-kinase activity is required at a postendocytic step in platelet-derived growth factor receptor trafficking.
J. Biol. Chem.
270:
13225-13230
|
| 21. | Kapeller, R., and L.C. Cantley. 1994. Phosphatidylinositol 3-kinase. Bioessays. 16: 565-576 [Medline]. |
| 22. | Kapeller, R., K.S. Chem, M. Yoakim, B.S. Schaffhausen, J.M. Backer, M.F. White, L.C. Cantley, and N.B. Ruderman. 1991. Mutations in the juxtamembrane region of the insulin receptor impair activation of phosphatidylinositol 3-kinase by insulin. Mol. Endocrinol. 5: 769-777 [Abstract]. |
| 23. | Kotani, K., K. Yonezawa, K. Hara, H. Ueda, Y. Kitamura, H. Sakaue, A. Ando, A. Chavanieu, B. Calas, F. Grigorescu, et al . 1994. Involvement of phosphoinositide 3-kinase in insulin- or IGF-1-induced membrane ruffling. EMBO (Eur. Mol. Biol. Organ.) J. 13: 2313-2321 [Medline]. |
| 24. | Lemmon, M.A., K.M. Ferguson, and J. Schlessinger. 1996. PH domains: diverse sequences with a common fold recruit signaling molecules to the cell surface. Cell. 85: 621-624 [Medline]. |
| 25. | Linassier, C., L.K. MacDougall, J. Domin, and M.D. Waterfield. 1997. Molecular cloning and biochemical characterization of a Drosophila phosphatidylinositol-specific phosphoinositide 3-kinase. Biochem. J. 321: 849-856 . |
| 26. | MacDougall, L.K., J. Domin, and M.D. Waterfield. 1995. A family of phosphoinositide 3-kinases in Drosophila identifies a new mediator of signal transduction. Curr. Biol. 5995: 1404-1414 . |
| 27. |
Martin, S.S.,
T. Haruta,
A.J. Morris,
A. Klippel,
L.T. Williams, and
J.M. Olefsky.
1996a.
Activated phosphatidylinositol 3-kinase is sufficient to mediate
actin rearrangement and GLUT4 translocation in 3T3- L1 adipocytes.
J.
Biol. Chem.
271:
17605-17608
|
| 28. | Martin, S.S., D.W. Rose, A.R. Saltiel, A. Klippel, L.T. Williams, and J.M. Olefsky. 1996b. Phosphatidylinositol 3-kinase is necessary and sufficient for insulin-stimulated stress fiber breakdown. Endocrinology. 137: 5045-5054 [Abstract]. |
| 29. |
Martys, J.L.,
C. Wjasow,
D.M. Gangi,
M.C. Kielian,
T.E. McGraw, and
J.M. Backer.
1996.
Wortmannin sensitive trafficking pathways in CHO cells: differential effects on endocytosis and lysosomal sorting.
J. Biol. Chem.
271:
10953-10962
|
| 30. |
McGraw, T.E.,
L. Greenfield, and
F.R. Maxfield.
1987.
Functional expression
of the human transferrin receptor cDNA in Chinese Hamster Ovary cells deficient in endogenous transferrin receptor.
J. Cell Biol.
105:
207-214
|
| 31. | McIlroy, J., D.X. Chen, C. Wjasow, T. Michaeli, and J.M. Backer. 1997. Specific activation of p85-p110 phosphatidylinositol 3'-kinase stimulates DNA synthesis by ras- and p70 S6 kinase-dependent pathways. Mol. Cell. Biol. 17: 248-255 [Abstract]. |
| 32. |
Meyers, R., and
L.C. Cantley.
1997.
Cloning and characterization of a wortmannin-sensitive human phosphatidylinositol 4-kinase.
J. Biol. Chem.
272:
4384-4390
|
| 33. | Mills, I.G., A.T. Jones, and M.J. Clague. 1998. Involvement of the endosomal autoantigen EEA1 in homotypic fusion of early endosomes. Curr. Biol. 8: 881-884 [Medline]. |
| 34. |
Molz, L.,
Y.W. Chen,
M. Hirano, and
L.T. Williams.
1996.
Cpk is a novel class
of Drosophila PtdIns 3-kinase containing a C2 domain.
J. Biol. Chem.
271:
13892-13899
|
| 35. |
Okada, T.,
Y. Kawano,
T. Sakakibara,
O. Hazeki, and
M. Ui.
1994.
Essential
role of phosphatidylinositol 3-kinase in insulin-induced glucose transport
and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin.
J. Biol. Chem.
269:
3568-3573
|
| 36. |
Panaretou, C.,
J. Domin,
S. Cockcroft, and
M.D. Waterfield.
1997.
Characterization of p150, an adaptor protein for the human phosphatidylinositol (PtdIns) 5-kinase substrate presentation by phosphatedylinositol transfer protein to the p150-PtdIns 3-kinase complex.
J. Biol. Chem.
272:
2477-2485
|