|
||
4 Integrin Interactor p27BBP/eIF6 Is an Essential Nuclear Matrix
Protein Involved in 60S Ribosomal Subunit Assembly



* DIBIT, Department of Biological and Technological Research, and
Department of Pathology, San Raffaele Scientific Institute,
20132 Milano, Italy; § Dipartimento di Genetica e di Biologia dei Microrganismi, University of Milano, 20133 Milano, Italy;
Department of Pharmacology, University of Milano and CNR Center, 20129 Milano, Italy; and ¶ Department of Biomedical
Sciences and Human Oncology, University of Torino School of Medicine, 10126 Torino, Italy
| |
Abstract |
|---|
|
|
|---|
p27BBP/eIF6 is an evolutionarily conserved
protein that was originally identified as p27BBP, an interactor of the cytoplasmic domain of integrin
4 and, independently, as the putative translation initiation factor
eIF6. To establish the in vivo function of p27BBP/eIF6, its
topographical distribution was investigated in mammalian cells and the effects of disrupting the corresponding gene was studied in the budding yeast, Saccharomyces cerevisiae. In epithelial cells containing
4 integrin,
p27BBP/eIF6 is present in the cytoplasm and enriched at
hemidesmosomes with a pattern similar to that of
4 integrin. Surprisingly, in the absence and in the presence
of the
4 integrin subunit, p27BBP/eIF6 is in the nucleolus
and associated with the nuclear matrix. Deletion of the
IIH S. cerevisiae gene, encoding the yeast p27BBP/eIF6
homologue, is lethal, and depletion of the corresponding gene product is associated with a dramatic decrease
of the level of free ribosomal 60S subunit. Furthermore,
human p27BBP/eIF6 can rescue the lethal effect of the
iih
yeast mutation. The data obtained in vivo suggest
an evolutionarily conserved function of p27BBP/eIF6 in ribosome biogenesis or assembly rather than in translation. A further function related to the
4 integrin subunit may have evolved specifically in higher eukaryotic cells.
| |
Introduction |
|---|
|
|
|---|
INTEGRINS are heterodimeric receptors formed by the
assembly of one
and one
transmembrane subunit.
16
and 8
subunits heterodimerize to produce >20
receptors that are differentially expressed in a wide variety
of tissues. Most integrins bind components of the extracellular matrix and can organize the cytoskeleton through
their cytoplasmic domain (for review see Hynes, 1992
). Moreover, integrins are involved in the control of cell
growth, apoptosis, and differentiation through the recruiting of several signal transduction and adaptor molecules
(for review see Clark and Brugge, 1995
; Giancotti, 1997
;
Howe et al., 1998
). The steadily increasing role of integrins
in the organization of cellular metabolic processes has recently encompassed the process of protein synthesis. Indeed, clustering of some integrin subunits at points of focal adhesion results in the relocation of mRNA and ribosomes to focal adhesion contacts (Chicurel et al., 1998).
Although the molecular mechanisms of this process are
unknown, a picture in which most biochemical processes
are spatially regulated, with integrins playing a major role,
has emerged.
The integrin subunit
4 associates with
6 to form a
multivalent laminin receptor present at high levels in most
epithelia. Its ligand engagement correlates with PI3 kinase
activation (Shaw et al., 1997
) and recruitment of the shc
and grb2 adaptors (Mainiero et al., 1995
). In addition, in
squamous and transitional epithelia,
4 is required for the
formation of hemidesmosomes, specialized structures providing firm mechanical links between basal lamina and the
intermediate filament cytoskeleton (for review see Giancotti, 1996
). Loss of function of
4 both in human and
mice results in hemidesmosome disruption, blistering, and
perinatal death (Vidal et al., 1995
; Dowling et al., 1996
;
van der Neut et al., 1996
).
Mutations in the functional cytodomain of
4 result
in an inability to translocate into hemidesmosomes and
be targeted to the intermediate filament cytoskeleton
(Spinardi et al., 1993
; Niessen et al., 1997
) accompanied by
lethal forms of the blistering disease junctional epidermolysis bullosa associated with pyloric atresia (Vidal et al.,
1995
). These and other data strongly indicate that the
cytodomain of
4 exerts its function through the interaction with cytoplasmic molecules led us to search for
protein interactors of the
4 cytodomain. Through an extensive yeast two hybrid analysis, a previously unknown
peptide named p27BBP (BBP for beta4 binding protein)1
that binds the
4 cytodomain was discovered. p27BBP directly binds, in vitro and in vivo, a 300-amino acid long
stretch of
4 integrin cytodomain, a region required for
targeting
4 to the hemidesmosomes and to the intermediate filament cytoskeleton as determined by genetic studies. In addition, p27BBP was found to be present at high
levels in the submembrane region of epithelial cells containing
4. Finally, the biochemical association of p27BBP
with keratin intermediate filaments, suggested that p27BBP
might be the molecular link between
4 and the cytoskeleton (Biffo et al., 1997
). The precise ultrastructural localization of p27BBP, in in vivo hemidesmosomes was not yet defined.
The finding that p27BBP homologues exist both in yeast
and Drosophila, in which
4 integrin homologues are absent (Biffo et al., 1997
) suggested that p27BBP might also
have a
4-independent function. Consistently, the cloning
of a human cDNA encoding a protein named eIF6 (identical to p27BBP) was almost concomitantly obtained by Si et al.
(1997)
. The biological assay used to clone eIF6 was based
on its in vitro ability to inhibit the association between the
40S and the 60S ribosomal subunits, and was not related to
integrin function. On the basis of its in vitro determined
properties, it was suggested that eIF6 might act as a translation initiation factor. The cloning and sequencing of eIF6
unequivocally indicate that eIF6 and p27BBP are the same
protein (Biffo et al., 1997
; Si et al., 1997
). Much more recently, eIF6/p27BBP has also been identified by another
group as a gene induced in mast cells by allergic reaction
(Cho et al., 1998
). To acknowledge the independent identification of p27BBP and eIF6, the protein will be denoted
as p27BBP/eIF6 throughout this work.
Both studies left a set of unresolved questions: (a)
Which is the precise cellular localization of p27BBP/eIF6 and
is it modulated by the presence of
4 integrin?; (b) Is the association of p27BBP/eIF6 with the intermediate filament
cytoskeleton a unique feature of cells that contain
4?;
(c) Is p27BBP/eIF6 present in hemidesmosomes?; and (d)
Which is the general, evolutionarily conserved, function of
p27BBP/eIF6? To address these questions, we used integrated approaches. First, the fine localization of p27BBP/eIF6
was studied in cell lines, either containing
4 integrin or
not. Our studies show that p27BBP/eIF6 is a nuclear matrix-associated protein present in the nucleolus of all cells analyzed and enriched at the basal membrane of
4 expressing epithelial cells. Second, the function of p27BBP/eIF6 was
addressed in Saccharomyces cerevisiae by constructing and characterizing a null mutant. The yeast p27BBP/eIF6 homologue is essential for cell viability and its depletion results in an abnormal ribosomal profile, with a dramatic reduction of the levels of free 60S ribosomal subunits. Taken together these data indicate that the conserved role of
p27BBP/eIF6 is linked to 60S ribosome subunit metabolism,
and that this process may be linked to the nuclear matrix.
In higher organisms, novel functions of p27BBP/eIF6 may
have appeared that link this molecule to epithelial adhesion.
| |
Materials and Methods |
|---|
|
|
|---|
Antibodies and Cell Lines
The rabbit polyclonal antiserum against the COOH-terminal peptide of
p27BBP/eIF6 (NH2-CTIATSMRDSLIDSLT-COOH) was tested for its specificity by Western blotting and immunoprecipitation both on the recombinant protein and on cellular lysates (Biffo et al., 1997
). Integrin
4 was detected with the rat mAb3E1 (10 µg/ml; Chemicon International, Inc.), or
with the mouse mAb AA3 (Kajiji et al., 1989
) at 10 µg/ml (gift of Vito
Quaranta, Scripps Research Institute, La Jolla, CA). The human autoantibodies against fibrillarin (Ochs and Smetana, 1991
) were a generous gift
of Robert Ochs (Scripps Research Institute) and were diluted 1:300. Cytokeratins were detected either with mouse monoclonal anticytokeratin
8:18, IgG2a (Diagnostika) at 1:200, or with mouse monoclonal anticytokeratin 7/17 IgG1, according to the manufacturer's protocol (C46;
Euro-Diagnostica). Secondary antibodies were rhodamine- and fluorescein-tagged swine anti-rabbit IgGs (1:50; DAKO Corp.), rhodamine-tagged goat anti-human IgGs (10 µg/ml; Chemicon International, Inc.),
rhodamine-tagged goat anti-mouse IgGs (7.5 µg/ml; Molecular Probes
Europe) and fluorescein-tagged goat anti-mouse IgGs (1:50; Antibodies
Inc.). In control experiments, primary antibodies were replaced by preimmune sera or irrelevant mAbs. In addition, the p27BBP/eIF6 antiserum was
preadsorbed with the peptide used for its generation (1 µM, overnight,
4°C), or with the bacterially produced human recombinant full length protein (at 10 µg/ml, 2 h at 4°C) purified by ion exchange chromatography.
The cell lines and primary cells used in this study, as well as the conditions for their propagation, are described in the American Type Culture
Collection cell line catalogue or in the references between parentheses.
They are as follows: mouse NIH/3T3 fibroblasts, human A431 epidermoid
carcinoma, human HeLa epitheloid carcinoma, human pancreatic carcinoma FG2 (Kajiji et al., 1989
), human Jurkat T cells, transformed human
keratinocytes HaCat (Boukamp et al., 1988
), human insulinoma cells
Rin2A (Rouiller et al., 1990
), and human neuroblastoma SK-N-MC. The
804G rat epithelial cell line clone A was a gift of F. Giancotti (Memorial
Sloan-Kettering Cancer Center, New York) and has been described in
Spinardi et al. (1993)
.
Mouse resting splenocytes, human fibroblasts from the umbilical cord, and Xenopus oocytes were gifts of A. Cabibbo, E. Bianchi, and E. Pannese (all at DIBIT, Milano, Italy) and were obtained by standard procedures.
Actinomycin Treatment
Cells were treated with actinomycin D (Boehringer Mannheim GmbH) at the final concentration of 5 µg/ml for 1, 4, and 12 h, washed, and fixed as described. In some experiments cells were allowed to recover after treatment by switching them to their normal medium.
Electron Microscopy on Human Amnion
Human fresh amniotic membrane (obtained immediately upon delivery
from the Department of Obstetrics, San Raffaele Hospital, Milano, Italy)
was dissected and pieces of tissue were fixed with 4% paraformaldehyde
and 0.25% glutaraldehyde in 125 mM sodium phosphate buffer, pH 7.4, for 45 min at 4°C. The samples were infiltrated with polyvinylpyrrolidone
and frozen in a 3:1 (vol/vol) mixture of propane and isopentane cooled
with liquid nitrogen. Ultrathin cryosections (50-100 nm thick) were obtained using an Ultracut ultramicrotome equipped with a Reichert FC4
cryosectioning apparatus. The cryosections were processed as described in
Villa et al. (1993)
using the rabbit anti-p27BBP/eIF6 antiserum and the
mouse monoclonal anticytokeratin 7/17 IgG1. Cryosections were examined in an electron microscope (Hitachi H-7000).
Western Blot Analysis
All samples were denatured before loading in Laemmli buffer (Laemmli,
1970
) and run on denaturing 12% SDS-acrylamide gel, transferred to Immobilon P membranes (Millipore Corp.), and blotted with the rabbit
p27BBP/eIF6 antiserum at 1:1,000 dilution as previously described (Biffo et al.,
1997
). In the control of the fractionation experiment, a mouse monoclonal
anticytokeratin 8/18 IgG2a at 1:200 was used. Detection was always performed by the commercially available chemiluminescence detection system (ECL) technique (Nycomed Amersham).
Extraction of Nuclear Matrix and Ribosomal Proteins
Intermediate filaments/nuclear matrix filaments fractions were prepared
exactly according to He et al. (1990)
. Briefly, all the soluble proteins, the
nonintermediate filament cytoskeleton, DNA associated proteins, and
proteins loosely associated with the nuclear matrix proteins were removed
by sequential washes in buffers (Triton X-100, 250 mM ammonium sulphate, DNase I, and 2 M NaCl). At the end of this procedure, a cytoplasmic and nuclear intermediate filament network containing keratins,
lamins, and intermediate filament-associated proteins was left. The efficiency of the extraction was routinely controlled by DNA staining, or by
immunostaining for keratins.
Preparation of ribosomes was performed through established procedures and exactly as described in Madjar (1994)
. 804G clone A cell line
monolayer was washed and scraped with cold PBS. The pellet was resuspended in cold buffer A (0.25 M sucrose, 25 mM KCl, 5 mM MgCl2, 50 mM
Tris-HCl, pH 7.4), stirred slowly with a vortex, while adding NP-40 to a final concentration of 0.7%, and kept on ice for 10 min. The suspension was
centrifuged at 750 g for 10 min at 4°C and the resulting pellet containing
nuclei and insoluble proteins was resuspended in Laemmli buffer for biochemical analysis. The supernatant was centrifuged at 12,500 g, 10 min at
4°C and the resulting pellet containing mitochondria was resuspended in
Laemmli buffer. The low-speed supernatant was added to 0.32 vol of
buffer C (0.25 M sucrose, 2 M KCl, 5 mM MgCl2, 50 mM Tris-HCl, pH
7.4), layered on top of a 1 M sucrose cushion, and ultracentrifuged (TL100; Beckman Instruments, Inc.) at 245,000 g, 2 h at 4°C. The high-speed pellet containing ribosomal proteins was resuspended in Laemmli
buffer. The high-speed supernatant was precipitated with cold 10% TCA,
for 45 min on ice, centrifuged at 14,000 rpm at 4°C, and resuspended in
Laemmli buffer for biochemical analysis.
Indirect Immunofluorescence and Immunocytochemistry
Immunofluorescence was performed as previously reported (Marchisio et al.,
1991
). In brief, the following was performed: cell monolayers were fixed in
3% paraformaldehyde in PBS, pH 7.6, containing 2% sucrose for 10 min
at room temperature; permeabilized in Hepes-Triton X-100 buffer for 5 min at 4°C (20 mM Hepes, 300 mM sucrose, 50 mM NaCl, 3 mM MgCl2,
0.5% Triton X-100, pH 7.4); and blocked with 5% BSA in PBS for 30 min
at room temperature. Next, the cells were incubated in primary antibodies
(diluted in 5% BSA in PBS) for 2 h at room temperature, washed in 0.2%
BSA in PBS, and treated with secondary antibodies diluted in PBS. Staining for F-actin was performed with 200 nM fluorescein-labeled phalloidin
(Sigma Chemical Co.) for 20 min at 37°C in the dark and with 2 µg/ml DNA counterstaining (Hoechst 33342; Sigma Chemical Co.). Once mounted in Mowiol 4-88 (Hoechst AG), coverslips were analyzed with a
confocal microscope (MRC-1024; Bio-Rad Laboratories) equipped with a
krypton/argon laser. To reduce bleed through, double-label confocal images (XY and XZ sections) were acquired sequentially. Micrographs were
taken using either a Focus Imagecorder Plus (Focus Graphics Inc.) on
Kodak film or a Professional color Point II dye sublimation printer
(Seiko). Stained cells were observed in parallel with a Zeiss Axiophot microscope equipped for epifluorescence and a 63× planapochromatic lens;
pictures were taken on Kodak T-MAX 400 films exposed at 1000 ISO and
developed at 1600 ISO in T-MAX developer for 10 min at 20°C.
In some experiments, p27BBP/eIF6 was revealed by immunoperoxidase labeling using the avidin-biotin amplification method (ABC Kit Vectastain; Vector Labs Inc.). Briefly, after incubation with the primary antiserum cell monolayers were washed and treated with a goat anti-rabbit biotin-conjugated antibody for 30 min at room temperature, followed by the preformed avidin-biotin complex (ABC). The staining was revealed by horseradish peroxidase and 3,3'-diaminobenzidine as chromogen (BioGenex Labs).
Electron Microscopy on Extracted Cells
FG2 cells were extracted to reveal the nuclear matrix as described above
and fixed with fresh 3.7% paraformaldehyde in digestion buffer for 30 min
at 4°C. They were washed once in digestion buffer, once in TBS-1 (10 mM
Tris-HCl, pH 7.7, 150 mM NaCl, 3 mM KCl, 1.5 mM MgCl2, 0.05% Tween
20, 0.1% BSA, 0.2% glycine), and blocked in 5% BSA in TBS-1 for 30 min at room temperature. The cells were incubated in rabbit p27BBP/eIF6
antiserum, 1:200 in 5% BSA in TBS-1 rocking overnight at 4°C. After this
incubation, they were sequentially washed in TBS-1, blocked with 5%
BSA in TBS-1, 10 min at room temperature, and incubated with 5-nm
gold bead-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch Laboratories, Inc.), 1:40 in TBS-2 (20 mM Tris-HCl, pH 8.2, 140 mM NaCl, 0.1% BSA) rocking for 1 h at room temperature. Cells were
washed in TBS-1, postfixed in 2.5% glutaraldehyde in 0.1 M cacodylate
buffer, pH 7.4, and centrifuged at low speed (600 g for 5 min). The cell pellets were included in diethylene glycol distearate as described by Nickerson et al. (1994)
. Resinless sections were examined in a Hitachi H-7000
electron microscope.
Database Searches
Homology searches were performed with the Blast programs available
through http://www.ncbi.nlm.nih.gov, or by the alerting system of EMBL
(http://www.bork.embl-heidelberg.de/Alerting). The accession number of
the sequences retrieved are: Homo sapiens, Y11435; S. cerevisiae, Z49919;
Caenorhabditis elegans, Z99709; Arabidopsis thaliana, AC003000; Methanococcus jannaschii, U67463; S. acidocaldarius, P38619; Methanobacterium thermoautotrophicum, AE000920; P. bomkoshii, AB009481; and
Archaeoglobus fulgidus, AE000961. The alignment was created using the
CLUSTAL W algorithm (Thompson et al., 1994
). The phylogram of the
aligned proteins were produced with the GROWTREE program in GCG
with the Jukes-Cantor distance matrix and neighbor-joining method.
Yeast Strains and Media
All strains used are derivatives of W303 (MATa, ade2-1, trp1-1, leu2-3, 112, his3-11,15, ura3, can1-100). Cells were grown in YEP medium (1% yeast extract, 2% bactopeptone, 50 µg/liter adenine) supplemented with either 2% glucose (YEPD) or 2% raffinose and 1% galactose (YEPRG). Transformants carrying the kanMX4 cassette were selected on YEPD plates containing 400 µg/ml G418 (US Biological).
Plasmid Construction and Genetic Manipulations of Yeast Strains
Standard techniques were used for genetic crosses (Rose et al., 1990
) and
DNA manipulations (Sambrook et al., 1989
). The yeast integrin interacting homologue (IIH1) gene was cloned by PCR using as a template the
genomic DNA of strain W303 and oligonucleotides oSP44 (5'CAG-AATAGTCGGAGAAGCGGAC3') and oSP45 (5'GTAAGGTGCAAGATCAGACAAAG 3'). To construct a IIH1 chromosomal deletion
(iih1::kanMX4), the heterologous kanMX4 cassette was amplified by PCR
using plasmid pFA6a-kanMX4 (Wach et al., 1994
) as a template and
oligonucleotides oSP43 (5'CGCATACAACTGTAAACAGACTTGA-
GGAAGGAGGGGAATCCCCTCAGGAGATC GATGAAT TC GAGCTC-G3') and oSP46 (5'GCCTCATCCCTCGTTCTTATAGTATAATTACAAGAAGCAATACGACAGCGTACGCTGCAGGTCGAC3') as primers. The amplification product contained the kanMX4 cassette flanked by IIH1 sequences (underlined in the oligonucleotide sequences) and was used to transform the diploid strain W303. G418-resistant transformants were shown by PCR analysis to be heterozygous for the replacement of most of the IIH1 chromosomal ORF with the kanMX4 cassette.
By sporulation and tetrad analysis of one of these transformants (ySP478),
iih1::kanMX4 segregants were shown to be inviable, since all tetrads contained only two viable spores that were always G418 sensitive.
To construct the GAL-IIH1 fusion (pSP43), the IIH1 XbaI/SspI fragment was cloned in XbaI (SalI) of a Yiplac211-derived plasmid (Gietz and
Sugino, 1988
) that carried the BamHI-EcoRI GAL1-10 promoter fragment (c2139). To construct the GAL-Hsp27BBP/eIF6 fusion (pSP40), a PCR
fragment containing a hemagglutinin (HA)-tagged version of Hsp27BBP/eIF6
was amplified using as a template the pSG5-p27 expression plasmid in
which the entire open reading frame of human p27BBP/eIF6 gene was cloned
in frame with a 10-amino acid HA tag in the NH2 terminus (the original
vector is described in Green et al., 1988
, the HA-modified vector was a
gift of V. Zappavigna, DIBIT). The oligonucleotides YSTAG (5'CGG-AATTCAACAATAATGTACCCATACGAGCTTCCA3') and YAS-TAG2 (5'CGGAATTCCTAGGTGAGGCTGTCAATGAGGGA3'),
where the sequences of the human gene and of the HA tag are underlined
were used as primers. The obtained PCR product was cut with EcoRI and cloned in the EcoRI site of c2139. Both GAL-IIH1 and GAL-Hsp27BBP/eIF6
fusions were integrated at the ura3 locus of ySP478 by cutting pSP43 and
pSP40 with ApaI before transformation. As a result, strains ySP650
(GAL-IIH1 single copy), ySP653 (GAL-Hsp27BBP/eIF6 single copy), and
ySP652 (GAL-Hsp27BBP/eIF6 multiple copies), respectively were generated. The copy number of the integrated plasmids was checked by Southern analysis. Strain ySP661 (MATa, iih1::kanMX4, and ura3::URA3::
GAL-IIH1) was obtained after sporulation and tetrad dissection of
ySP650, whereas ySP664 (MATa, iih1::kanMX4, and ura3::URA3::GAL-Hsp27BBP/eIF6) was obtained after sporulation and tetrad dissection of ySP653.
Polysome and Western Blot Analysis of Ribosomal Fractions
Polyribosome preparation and polysome analysis were done exactly according to Foiani et al. (1991)
. Briefly, cell cultures of W303 (wt), ySP661
(iih1
, GAL-IIH1), and ySP664 (iih1
, GAL-HSp27BBP/eIF6) were grown
in YEPRG medium and shifted to YEPD at time 0 to repress the GAL
promoter. Yeast extracts were prepared from 300 ml of cell culture at
OD = 0.5-1 (Foiani et al., 1991
), layered on a 7-47% sucrose gradient in
50 mM Tris-acetate, pH 7.0, 50 mM NH4Cl, 12 mM MgCl2, and 1 mM
dithiothreitol and centrifuged at 4°C in a SW41 Beckman rotor for 2 h at
39,000 rpm. Gradient analysis was performed with a gradient collector
with continuous monitoring at A254.
For protein analysis, the collected fractions were precipitated with TCA to a final concentration of 10% and left on ice for 30 min. Fractions were centrifuged at 15,000 g, for 15 min at 4°C, and resuspended in Laemmli buffer. Equal amounts of extracts were run on denaturing 12% acrylamide gels and blotted as described above.
| |
Results |
|---|
|
|
|---|
p27BBP/eIF6 Is Present in all Cell Lines, at Early Developmental Stages and Is Associated with the Cytoskeleton
It was previously observed that p27BBP/eIF6 mRNA was
highly expressed during mouse embryonic development
and that highly conserved homologues were present in
the unicellular organism S. cerevisiae (Biffo et al., 1997
).
These data suggested that p27BBP/eIF6 might have a general
role in cellular processes that is not limited to epithelial
cells expressing
4 integrin only. To test this hypothesis,
the expression of p27BBP/eIF6 was first measured by Western blot analysis with a polyclonal antiserum directed
against the COOH terminus of p27BBP/eIF6 on total protein
lysates from immortalized cell lines of various origin (see
Materials and Methods for original references). So far,
p27BBP/eIF6 has been detected in all cell lines analyzed. Fig.
1 (left) shows the levels of p27BBP/eIF6 in the immortalized
cell lines NIH/3T3 (nontransformed mouse fibroblasts),
Jurkat (human T cells), SK-N-MC (human neuroblastoma), A431, HeLa, HaCaT, and FG2 (transformed human epithelial cell lines), and Rin2A (human insulinoma).
Constitutive expression of p27BBP/eIF6 was also detected in
two out of two primary cultures tested, respectively, human primary fibroblasts, and mouse resting splenocytes.
|
It was previously observed that p27BBP/eIF6 mRNA was
abundant during embryonic development and declined in
the adult, where it was mainly retained in epithelial tissues
(Biffo et al., 1997
). To test the hypothesis that p27BBP/eIF6
protein may be present already at early phases of development, its onset was studied in embryos. The protein was
found to be expressed from the earliest developmental
stage and later on. Fig. 1 (right) shows p27BBP/eIF6 in the
Xenopus egg, between fertilization and the beginning of segmentation. Comparable results were obtained in mice.
As previously observed for p27BBP/eIF6 mRNA, in the
adult, high levels of p27BBP/eIF6 protein were retained
mostly in epithelial tissues, and testis (not shown).
In epithelial cells containing
4 integrin, ~50% of
p27BBP/eIF6 was associated with the intermediate filament
cytoskeleton (Biffo et al., 1997
). The association of p27BBP/eIF6
with the cytoskeleton was analyzed in cell lines not containing
4 integrin. For this purpose, cells were first extracted with detergent containing buffers (Materials and
Methods) and the various fractions were analyzed by
Western blot. Part of p27BBP/eIF6 was always found in the
cytoskeletal fraction. However, the extent of the association varied according to the cell line (not shown). Fig. 1
(right) shows the results of the fractionation experiments in Xenopus eggs, where at least half of p27BBP/eIF6 was
found to be resistant to detergent extraction and associated with the cytoskeleton.
Nucleolar Localization of p27BBP/eIF6
The topographical distribution of p27BBP/eIF6 was studied
in detail by immunofluorescence, immunocytochemistry,
and electron microscopy. To summarize our findings, as
shown in Figs. 2-4, p27BBP/eIF6 was present in the nucleus,
with a clear nucleolar pattern. The nucleolar staining of
p27BBP/eIF6 was present in all the organisms analyzed so far
(from worms to humans) and in all cell lines. In addition,
in some cell lines containing
4 integrin, p27BBP/eIF6 was
clearly evident in the cytoplasm (see Fig. 5). All the immunoreactivity described is specific, since both the nuclear
and the cytoplasmic staining could be routinely abolished
by preincubating the antiserum with either the peptide
used for immunization or with the recombinant protein
(Fig. 2, A and B). In addition, a similar nucleolus-enriched staining pattern could be seen on NIH/3T3 fibroblasts
transfected with a HA-tagged version of p27BBP/eIF6, followed by immunofluorescence with a mouse anti-HA
mAb (not shown).
|
|
|
|
The nuclear staining of p27BBP/eIF6 and its dynamic features will be described using the FG2 cell line as a model. In the interphase nucleus, p27BBP/eIF6 was clearly concentrated in the nucleolus (Fig. 2, A and C). This pattern was similar to the one obtained with an antiserum recognizing the nucleolar protein, fibrillarin (Fig. 2 E). The nucleolar colocalization was supported by double immunofluorescence studies with fibrillarin and p27BBP/eIF6 (not shown).
To establish whether p27BBP/eIF6 was dynamically associated with the nucleolus, epithelial cells were treated with
low doses of actinomycin D and p27BBP/eIF6 localization
was analyzed after 1, 4, and 12 h. This treatment caused
the collapse of the nucleolus and the redistribution of nucleolar-associated proteins (Schofer et al., 1996
). In actinomycin D-treated cells, both p27BBP/eIF6 (Fig. 2 D) and the
nucleolar antigen, fibrillarin (Fig. 2 F), reversibly weakened their association with the nucleolus and became mostly diffuse in the cell's nucleus. Importantly, no effect
on p27BBP/eIF6 localization was seen when cells were
treated with the protein synthesis inhibitors, cycloheximide and puromycin (not shown). Nucleolar localization of p27BBP/eIF6 was confirmed by immunoelectron microscopy, using the anti-p27BBP/eIF6 antiserum, followed
by 5-nm gold-labeled secondary antibodies. 5-nm gold
beads were strongly concentrated within the nucleolus (Fig. 2 G).
Next, we tested whether p27BBP/eIF6 was stably associated with ribosomal proteins in the cytoplasm of the 804G-clone A epithelial cell line. For this purpose, ribosomes and ribosomal proteins were separated from all of the following: mitochondria, nuclear matrix/intermediate filaments, and soluble proteins. Afterwards, the different fractions were tested for the presence of p27BBP/eIF6 by Western blot analysis. As shown in Fig. 2 H, most of the protein was present in the nuclear matrix/intermediate filament cytoskeleton fraction. A faint band was associated with the ribosomal fraction.
p27BBP/eIF6 Redistributes during Mitosis
The strong nucleolar-associated pattern of p27BBP/eIF6 was
visible in all cell lines during interphase, as well as in various normal and neoplastic tissues (Sanvito, F., manuscript
in preparation). Therefore, it was expected that during mitosis, when the nucleolus disappears, the protein would be
redistributed. Indeed, during cell division p27BBP/eIF6 dramatically changed its topographical pattern. At prophase, the immunoreactivity tended to become more dispersed at
first. Later, it became associated with the periphery of
condensed chromosomes (Fig. 3, A and B). At metaphase,
p27BBP/eIF6 was enriched in the central mass of chromatin
formed by the condensed chromosomes of the metaphasic
plate (Fig. 3, C and D) and this pattern was even more
noted at anaphase (Fig. 3, E and F). With the onset of telophase and the reappearance of the nucleolar organization, p27BBP/eIF6 first scattered and then regained its association
with the nucleolus (Fig. 3, G and H). The redistribution of
p27BBP/eIF6 during the mitotic phases was not associated
with its proteolytic degradation. Furthermore, no obvious
physical association of p27BBP/eIF6 with tubulin was observed (not shown). A similar redistribution was observed
for some nucleolar antigens, chromosome passengers, which redistribute around chromosomes during mitosis
(Earnshaw and Bernat, 1991
), as well as for some nuclear
matrix-associated antigens, whose immunoreactivity become more dispersed during mitosis (Nickerson et al.,
1992
).
p27BBP/eIF6 Is Associated with the Nuclear Matrix
To investigate whether the nucleolar p27BBP/eIF6 was associated with the nuclear matrix, FG2 cells were extracted
with a sequential treatment by means of detergents, DNase,
RNase, and high salts (He et al., 1990
), and then analyzed
by immunofluorescence and electron microscopy. This
treatment removed >90% of the proteins, and 95% of the
DNA. In addition, the treatment uncovered a nuclear matrix consisting of a nuclear lamina connected to the cytoplasmic intermediate filaments and of an internal meshwork of polymorphic fibers connecting the lamina to
masses within the nucleus. In conditions that lead to the
complete loss of DNA (Fig. 4 D), the p27BBP/eIF6 staining,
associated with the nucleolus was clearly retained (Fig. 4,
C-E). Also, the nuclear staining of p27BBP/eIF6 was unaffected after digestion of residual RNA with RNase (not shown).
To establish whether the residual staining of p27BBP/eIF6 was present in specific structures, extracted cells were examined by immunoelectron microscopy. By this analysis, immunoreactivity of p27BBP/eIF6 was always found to be associated with the residual thick filaments of the nuclear matrix (Fig. 4 F). Taken together these data show that in the nucleolus and in the nucleus a relevant part of p27BBP/eIF6 is tightly associated with the nuclear matrix.
Topographical Relationships of p27BBP/eIF6 and
4 at
Hemidesmosomes in Epithelial Cells
In epithelial cells containing the
4 integrin, the pattern of
immunoreactivity of p27BBP/eIF6 was slightly different and
is briefly described using the epithelial cell line 804G clone
A. This cell line contains human
4 integrin, clustered in
rosettes of hemidesmosomes (Spinardi et al., 1993
). As a
result, when stained with antibodies against
4, these cells exhibit a typical Swiss cheeselike pattern in which intense
4 staining surrounds cytoplasmic areas devoid of integrin
(Fig. 5, A and D). Confocal laser scanning microscopy
analysis in the horizontal section (x, y) of p27BBP/eIF6 immunolocalization in these cells clearly showed a cytoplasmic staining partially superimposable to the one for
4
integrin (Fig. 5, A and D,
4; B and C, p27BBP/eIF6; E,
4-
p27BBP/eIF6). Most importantly, in the vertical (x, z) and
horizontal (x, y) sections, both
4 and p27BBP/eIF6 stainings
were excluded from the small circular areas forming the
holes of the Swiss cheeselike pattern (Fig. 5, A' and D; B' and C). However, staining with the labeled actin-binding
drug, phalloidin, showed that these holes contained other
cytoskeletal components such as actin and actin-binding
proteins (data not shown; Spinardi, L., manuscript in preparation). These data suggest that in epithelial cells that
require
4 to form hemidesmosomes, p27BBP/eIF6 can be
specifically recruited in the intermediate filament's cytoskeleton converging on these adhesion structures.
To extend these observations, the presence of p27BBP/eIF6 was analyzed by immunoelectron microscopy on cryosections of human amnion, a tissue that contains hemidesmosomes clustered at the basal cell surface. Consistent with the pattern observed in the 804G clone A cells, p27BBP/eIF6 was detected at the level of inner plaque of the hemidesmosome, where it seemed associated with a thin filament network (Behzad, 1995) running between the intermediate filaments and the hemidesmosomal dense plaque (5-nm gold beads; Fig. 5, F and H, arrowheads). A specific immunolabeling was also noticed in the cytoplasm associated with filamentous structures (e.g., the area indicated by the arrow in Fig. 5, G and H), and also at the inner face of desmosomes (Fig. 5 I). In agreement with the association with the intermediate filament cytoskeleton, p27BBP/eIF6 immunolocalization was resistant to high salt extraction (not shown). However, the p27BBP/eIF6 positive structures (5-nm gold beads) were within intermediate filament bundles, as shown by a double staining with antikeratin antibodies (15-nm gold beads; Fig. 5, G and H, arrows).
p27BBP/eIF6 Is Essential for Yeast Cell Viability
To gain more insights into p27BBP/eIF6 function, several approaches were taken, but our efforts to manipulate the levels of p27BBP/eIF6 in mammalian cell lines were not successful. Briefly, the expression of p27BBP/eIF6 antisense mRNA
in NIH/3T3 cells led only to a small decrease of protein
levels and established clones could not be derived (Sanvito, F., unpublished observations). Furthermore, transient expression of several mutated constructs in COS cells
led in some cases to accumulation of p27BBP/eIF6 either in
the nucleus or in the cytoplasm, and was toxic to the cells
(Sanvito, F., unpublished observations). These observations, together with the nucleolar localization and the fact
that the protein is conserved from yeast to humans (Biffo
et al., 1997
; Si et al., 1997
), might suggest a conserved function for this protein, which should be independent of
4
integrin (S. cerevisiae does not have
4 homologues). The
possibility that p27BBP/eIF6 has an ancestral function is further supported by the finding that putative genes encoding
peptides homologous to human p27BBP/eIF6 are present in
the genome of different Archibacteria and are also found
in plants (Fig. 6).
|
The analysis of the conserved amino acid sequences
does not provide any insight into p27BBP/eIF6 function.
However, the fact that S. cerevisiae contains a p27BBP/eIF6
homologue, 80% identical to the human protein, allowed
us to analyze the functional role of the protein in the yeast
model. The yeast protein is encoded by a single copy gene,
which we called IIH1. We disrupted one chromosomal
copy of the IIH1 gene in a diploid strain (see Materials
and Methods), followed by sporulation of the obtained
IIH1/iih1
heterozygous strain. Tetrad dissection and
analysis showed that all tetrads contained only two viable spores (Fig. 7), none of which carried the disruption
marker KanMX4, indicating that deletion of IIH1 was lethal. Spores carrying the iih1
allele were able to germinate, but arrested cell division either in the first or the second cell cycle.
|
We asked whether the human protein could rescue the
lethality caused by deletion of the IIH1 gene. For this purpose, we constructed fusion genes where the yeast or the
human p27BBP/eIF6 coding sequences were expressed under
control of the yeast galactose inducible GAL1-10 promoter. These fusions were integrated in either single or
multiple copies at the yeast URA3 locus of IIH1/iih1
heterozygous diploid strains. Subsequently, these integrated
fusions underwent induced sporulation to analyze viability
of their meiotic segregants under galactose-induced conditions. As shown in Fig. 7, most tetrads derived from any of
these diploid strains contained either three or four viable
spores, as expected if expression of human p27BBP/eIF6
(Hsp27BBP/eIF6) was able to rescue the lethality caused by
the iih1
allele. These data indicate that human and yeast
p27BBP/eIF6 share a common function. However, expression
of human p27BBP/eIF6 seems to complement the defect less
efficiently than its yeast counterpart; as indicated by the
slower growth of the clones derived from spores expressing a single copy of the human gene and the iih1
allele
(Fig. 7). This might be due to inefficient translation of the
human mRNA gene in yeast (CAI-S.c. = 0.076); consistently with this hypothesis, the slow growth phenotype was
substantially abolished when multiple copies of the GAL-
Hsp27BBP/eIF6 fusion were integrated at the ura3 locus (Fig. 7).
Depletion of p27BBP/eIF6 Causes Accumulation of G1 Cells
To study the function of p27BBP/eIF6 in yeast cells, we characterized the phenotype caused by its depletion. For this
purpose, wild-type and iih1
cells, carrying either the
GAL-IIH1 or the GAL-Hsp27BBP/eIF6 fusion and logarithmically growing in galactose, were transferred to glucose-containing medium, to switch off the GAL promoter. The
switch to a glucose-containing medium resulted in the progressive loss of the p27BBP/eIF6 protein (not shown). Since
the shut-off of the GAL-Hsp27BBP/eIF6 fusion caused a
much quicker arrest of cell division than that of the GAL-IIH1 fusion, we used the GAL-Hsp27BBP/eIF6 fusion-expressing strain for all the described depletion experiments. As shown by the FACS® profiles in Fig. 8, yeast
cells depleted of p27BBP/eIF6, progressively stopped growing and accumulated as G1 cells with 1C DNA content.
This phenotype is consistent with a role of p27BBP/eIF6 in
protein synthesis since yeast cells need to grow in cell mass and reach a critical size before they can enter the S phase.
|
p27BBP/eIF6 Depletion Correlates with the Loss of Free 60S Ribosomal Subunit
The arrest of p27BBP/eIF6 depleted cells in G1, the fact that
p27BBP/eIF6 has been independently identified as a putative
translation initiation factor (Si et al., 1997
) and our observation that p27BBP/eIF6 is detected in the nucleolus of all
cell lines, suggested that this protein might be involved in
protein synthesis and/or ribosome assembly. To understand the relevance of p27BBP/eIF6 in one of these processes
in yeast, the polysome profiles of wild-type- and p27BBP/eIF6-depleted cells were analyzed. For this purpose, wild-type
and iih
strains carrying the GAL-Hsp27BBP/eIF6 were
grown in galactose-containing medium, and then shifted to glucose-containing medium to switch off the GAL promoter. As a control, a strain where the iih1
allele lethality was rescued by the GAL-IIH1 fusion was also used.
As shown in Fig. 9, the ribosomal profiles of wt and
iih1
GAL-IIH1 strains were very similar at time 0, whereas iih1
GAL-Hsp27BBP/eIF6 cells, consistently with
their slow growth phenotype, already showed a marked
decrease in the amount of both the 60S subunit and the
polysome fraction at the same time point. In contrast, the
levels of the free 40S subunit seemed unaffected or slightly increased. This phenotype was even more dramatic 6 h after shifting to the glucose-containing medium of iih1
GAL-Hsp27BBP/eIF6 cells (Fig. 9). Furthermore, an accumulation of half-mer polysomes (i.e., 80S + 60S) was detectable under these conditions. These data suggest that
p27BBP/eIF6 might have a primary function in the correct assembly of the 60S ribosomal subunit in yeast.
|
Cofractionation of human p27BBP/eIF6 in yeast cells was analyzed in parallel. For this end, fractions from the ribosomal gradients were precipitated with TCA and analyzed by Western blot using antibodies against the human protein. As shown in Fig. 10, p27BBP/eIF6 was detected in the 80S and in the free 60S fractions, but absent from polysomes.
|
| |
Discussion |
|---|
|
|
|---|
p27BBP/eIF6 was simultaneously identified by two laboratories using two different approaches. It was isolated in our
laboratory as a cytoplasmic interactor of the
4 integrin
subunit, and we have shown that it can specifically bind
the cytodomain of
4 in vitro (Biffo et al., 1997
). However,
the discovery of p27BBP/eIF6 homologues in organisms that
do not contain
4 indicated that this protein might have a
function independent of
4. Along this line, p27BBP/eIF6
was independently identified by Si et al. (1997)
as a putative translation initiation factor, able to inhibit the association between the 60S and the 40S ribosomal subunits.
In this study, we have shown that although in epithelial
cells p27BBP/eIF6 is coherent with
4 at hemidesmosomes,
its association with the cytoskeleton is not a unique feature of epithelial cells. Indeed the protein is in the nuclear
matrix of all growing cells. Consistently with its conserved
nucleolar expression pattern and sequence, p27BBP/eIF6 is
necessary for growth in yeast cells where its loss correlates with a reduced level of the free 60S ribosomal subunit. The
in vivo findings were unexpected because they were consistent with a role of p27BBP/eIF6 in ribosomal biogenesis
rather than in mRNA translation. In addition, the association of p27BBP/eIF6 with the nuclear matrix suggested that
this process was linked to the nuclear cytoskeleton. The
ability of the human protein to complement yeast mutation further suggested a conserved function for p27BBP/eIF6.
An Evolutionarily Conserved Function for p27BBP/eIF6 in 60S Metabolism
Database analysis indicates that p27BBP/eIF6 is a very ancient, evolutionarily conserved protein. It is striking to
note that the homology is not restricted to a particular domain of the protein, and that even the length of the protein
is constant among different species (246 amino acids in C. elegans; 245 in humans, fly, yeast, and A. thaliana; and
215-222 in different Archibacteria). These data suggest
that p27BBP/eIF6 may have a critical and conserved function.
Indeed, we have shown that the deletion of the S. cerevisiae IIH1 gene, encoding the p27BBP/eIF6 homologue, is lethal to yeast cells, and that the human protein can complement the yeast-null mutation. Some lines of evidence suggest that also in mammalian cells, p27BBP/eIF6 may be
required for growth because of the following: (a) the inability to produce stable p27BBP/eIF6 mRNA antisense expressing mammalian cells (not shown); (b) the ubiquitous
p27BBP/eIF6 expression in all immortalized cell lines so far
analyzed; (c) and the presence of a single p27BBP/eIF6 gene
in the human genome (Sanvito et al., 1998
). The generation of p27BBP/eIF6-null mice will help to understand whether
p27BBP/eIF6 is also necessary for growth in higher vertebrates. Unfortunately, extensive sequence analysis did not
yield significant clues to understand p27BBP/eIF6 function.
To gain some insights into this problem, we used two
complementary approaches: the depletion of p27BBP/eIF6
in the genetically manipulable yeast model, and the study
of its topographical localization and biochemical properties in mammalian cell lines and tissues. Yeast cells depleted of p27BBP/eIF6 are progressively arrested in G1, a
phenotype consistent with a defect in either protein synthesis or ribosomal biogenesis. This fact, and the localization of p27BBP/eIF6 in nucleoli prompted us to analyze the
effect of its depletion on the polysome profile. These experiments provide useful information about how p27BBP/eIF6,
based on its in vitro ribosomal anti-association activity,
could be a translation initiation factor (Si et al., 1997
).
Polysome profiles of p27BBP/eIF6-depleted yeast cells showed
a dramatic reduction in the peak of free 60S subunits and
the appearance of half-mer polysomes. Similar polysome
profiles have been observed for mutants defective in ribosomal proteins of the 60S ribosomal subunit (Moritz et al.,
1991; Deshmukh et al., 1993
; Vilardell and Warner, 1997
), or for components involved in pre-rRNA processing and
60S ribosomal subunit assembly (Ripmaster et al., 1992
;
Sun and Woolford, 1994
; Hong et al., 1997
; Weaver et al.,
1997
; Zanchin et al., 1997
; Kressler et al., 1998
). Thus, the
primary function of p27BBP/eIF6 in yeast is likely related to
the 60S ribosomal subunit metabolism.
Polysome profiles of yeast cells, defective in translation
initiation factor proteins, are generally characterized by
the reduction of the rate of polysomes accompanied by the
gradual accumulation of both the free 40S and 60S subunits. Therefore, the polysome profile of p27BBP/eIF6-depleted
yeast cells does not support its primary function as a translation initiation factor. However, on the basis of the in
vitro data of Si et al. (1997)
, and in view of the presence of
p27BBP/eIF6 also in the cytoplasm of some human cells, the
possibility that this protein might have a function also as a
cytosolic initiation factor cannot be ruled out, as such activity could be masked by the predominant defect in 60S metabolism.
The polysome profile does not enlighten the precise role played by p27BBP/eIF6 in 60S metabolism. The protein may be necessary for ribosome assembly/transport, or may act as a structural ribosomal protein. On the basis of the available data, this last possibility is less likely to be true. In fact, the amount of p27BBP/eIF6 sedimenting with the ribosomal fraction in several cell lines represents only a minor fraction of the total p27BBP/eIF6 content. Furthermore, no p27BBP/eIF6 was detected in the polysome fraction.
p27BBP/eIF6 accumulates in the nucleolus of all the analyzed cell lines, where its pattern follows nucleolar evolution (redistribution at mitosis, when the nucleolar organizing region disappears, and redistribution after actinomycin
D treatment). Since the nucleolus is the site where ribosomal subunits are assembled, it seems plausible to speculate
that p27BBP/eIF6 might be involved in 60S ribosomal biogenesis. The process of ribosome biogenesis is complex and
involves several factors (for review see Woolford and
Warner, 1991; Eichler and Craig, 1994
) including proteins
with diverse functions such as RNA helicases, transcription factors, and nucleases. Further studies will address the
precise role that p27BBP/eIF6 might play in this process.
Finally, it is possible that p27BBP/eIF6 may be involved in
the transport of the 60S subunit from the nucleus to the cytoplasm. To date, very little is known about this process
(for review see Shaw and Jordan, 1995
), and only a few nucleolar proteins have been found to shuttle between the
nucleolus and the cytoplasm. In this context, three observations are particularly intriguing: (a) the presence of
p27BBP/eIF6 both in a soluble pool and in a cytoskeletal
bound compartment; (b) the existence of trace amounts of
soluble cytoplasmic p27BBP/eIF6 in all cells; and (c) the ability of p27BBP/eIF6 to bind also the mature 60S subunit (Si et al.,
1997
).
It is also worth noting that the nucleolar localization of p27BBP/eIF6 is observed in the absence of a consensus nuclear localization signal. Therefore, either p27BBP/eIF6 carries an unknown sequence for nuclear targeting or it is targeted into the nucleus by binding an additional factor in the cytoplasm. The second hypothesis is supported by the fact that even in its most soluble form, p27BBP/eIF6 partitions in gel filtration as a high molecular weight complex (unpublished observation). The molecular dissection of this high molecular weight complex may shed light on the mechanism by which p27BBP/eIF6 is transported to the nucleus.
p27BBP/eIF6 in the Nuclear Matrix/Intermediate Filaments Fraction
Our study shows that a relevant fraction of p27BBP/eIF6 is
highly insoluble in vivo and is associated both with the nuclear matrix and with the intermediate filament pool. In
the cytoplasm, electron microscopy studies have detected
p27BBP/eIF6 on thin cytoplasmic filaments of unknown composition that are spatially separated from the classical
keratin intermediate filaments, and converge both upon
hemidesmosomes and desmosomes. To our knowledge, beside keratins, only another intermediate filament associated protein, IFAP300, has been described both in
hemidesmosomes and desmosomes (Skalli et al., 1994
). In
this context, it is interesting to note that a recent thorough
electron microscopy analysis of human hemidesmosomes
has shown the presence of a novel filamentous structure in
the proximity of the inner plaque of the hemidesmosome (Behzad et al., 1995
).
Nuclear matrix consists of both thick polymorphous filaments and of thin filaments known as core filaments (He
et al., 1990
). In the nucleus, p27BBP/eIF6 is associated with
polymorphous thick filaments, and is absent from the core
filaments. This observation is fully consistent with the notion that core filaments may be formed by nuclear RNA, and that p27BBP/eIF6 distribution is resistant to RNase digestion (He et al., 1990
). The localization of p27BBP/eIF6 in
the nuclear matrix is of extreme interest in the context of ribosome biogenesis. Our data provide an intriguing link
between the nuclear cytoskeleton and the process of ribosome assembly.
In recent years growing evidence has indicated that
most nuclear and cytoplasmic processes including transcription, DNA replication, and protein synthesis are spatially organized in association with the cytoskeleton. The
combined roles of p27BBP/eIF6 protein in 60S assembly, its
association with the cytoskeleton, and its ability to bind
4
integrin (Biffo et al., 1997
) and the mature 60S ribosome
subunit (Si et al., 1997
) belong to an integrated view of cell
regulation that encompasses structure as well as biochemical processes (Chicurel et al., 1998).
p27BBP/eIF6 and
4 Integrin
We have previously shown that p27BBP/eIF6 binds specifically to the cytodomain of
4 integrin in vitro and in yeast
(Biffo et al., 1997
). Our previous data, and specifically the
association of p27BBP/eIF6 with keratin intermediate filaments, strongly suggested that this interaction could occur
also in vivo and be necessary for targeting
4 to hemidesmosomes and intermediate filaments. Since intermediate
filament-associated proteins can be solubilized only upon
SDS treatment, rendering the maintenance of biochemical
interactions impossible, an association between
4 and
p27BBP/eIF6 in tissues could not be proved. We now provide
two further elements suggesting that p27BBP/eIF6 is functionally associated to the
4 integrin in vivo: (a) its peculiar Swiss cheese distribution is superimposable to that of
4 in cells that form hemidesmosomes; and (b) the presence of the protein, in vivo, in hemidesmosomes of the human amnion. Further experiments are needed to clarify
the functional significance of
4-p27BBP/eIF6 interaction,
and specifically whether p27BBP/eIF6 may direct
4 to hemidesmosomes. Alternatively, as it has been recently suggested, on the basis of in vitro evidence and yeast two-hybrid
assays, the crucial step in targeting
4 to hemidesmosomes is the interaction with the large intermediate filament-associated protein, HD-1 (Niessen et al., 1997
; Rezniczeck
et al., 1998). If this is the case also in vivo, then the role of
p27BBP/eIF6 binding to
4 may be related to a nonstructural
function of
4 integrin, similar to that shown in the case of
the recruitment of shc and grb2 (Mainiero et al., 1995
) or
of PI3 kinase (Shaw et al., 1997
).
In the absence of further evidence, we may reasonably
suggest that p27BBP/eIF6 has an evolutionarily conserved
function linked to 60S ribosome biogenesis, and one acquired during evolution in epithelial cells containing
4 integrin. At least one precedent of a protein with a dual
function acquired during evolution, i.e.,
-catenin/armadillo, has already been reported. This remarkable protein
can be found both at sites of cell-cell adhesion in connection to cadherins and in the nucleus where it can signal in
conjunction with LEF-1 (for review see Willert and Nusse,
1998
).
| |
Footnotes |
|---|
Received for publication 15 September 1998 and in revised form 14 January 1999.
F. Sanvito and S. Piatti contributed equally to this work.
Address correspondence to Stefano Biffo, Lab. Istologia Molecolare
DIBIT, San Raffaele Scientific Institute, V. Olgettina 58, 20132 Milano,
Italy. Tel.: 39-22-643-4857. Fax: 39-22-643-4855. E-mail: s.biffo{at}hsr.it