|
||


* Institut für Biochemie und Molekularbiologie, Universität Freiburg, D-79104 Freiburg, Germany; and
Institute for Molecular
Cell Biology, BioCentrum Amsterdam, 1098 SM Amsterdam, The Netherlands
| |
Abstract |
|---|
|
|
|---|
Tim44 is a protein of the mitochondrial inner
membrane and serves as an adaptor protein for
mtHsp70 that drives the import of preproteins in an
ATP-dependent manner. In this study we have modified the interaction of Tim44 with mtHsp70 and characterized the consequences for protein translocation. By
deletion of an 18-residue segment of Tim44 with limited
similarity to J-proteins, the binding of Tim44 to
mtHsp70 was weakened. We found that in the yeast
Saccharomyces cerevisiae the deletion of this segment is
lethal. To investigate the role of the 18-residue segment, we expressed Tim44
18 in addition to the endogenous
wild-type Tim44. Tim44
18 is correctly targeted to mitochondria and assembles in the inner membrane import
site. The coexpression of Tim44
18 together with wild-type Tim44, however, does not stimulate protein import, but reduces its efficiency. In particular, the promotion of unfolding of preproteins during translocation is
inhibited. mtHsp70 is still able to bind to Tim44
18 in an
ATP-regulated manner, but the efficiency of interaction is reduced. These results suggest that the J-related segment of Tim44 is needed for productive interaction with
mtHsp70. The efficient cooperation of mtHsp70 with
Tim44 facilitates the translocation of loosely folded
preproteins and plays a crucial role in the import of
preproteins which contain a tightly folded domain.
| |
Introduction |
|---|
|
|
|---|
THE biogenesis of mitochondria requires the import
of nuclear-encoded preproteins from the cytosol.
The translocation of preproteins across the mitochondrial membranes is mediated by Tom proteins in the
mitochondrial outer membrane and by Tim proteins in the inner membrane (Pon and Schatz, 1991
; Ryan and Jensen,
1995
; Schatz, 1996
; Neupert, 1997
; Pfanner et al., 1997
;
Pfanner and Meijer, 1997
). Tim441 was the first Tim protein identified (Maarse et al., 1992
; Scherer et al., 1992
).
The gene encoding Tim44 is essential. Tim44 is synthesized as a precursor protein of 49 kD and processed inside mitochondria to a mature protein of 44 kD (Maarse et al.,
1992
). It behaves like a peripheral inner membrane protein and is exposed to the matrix (Blom et al., 1993
; Rassow et al., 1994
). Tim44 was found as a component of complexes together with the integral membrane proteins
Tim23 and Tim17 (Berthold et al., 1995
; Blom et al., 1995
;
Bömer et al., 1997
) which are putative components of a
protein translocation channel (Bauer et al., 1996
; Dekker et al., 1997
; Jensen and Kinnally, 1997
; Lohret et al., 1997
; Ryan et al., 1998
; Rassow et al., 1999
).
Recent efforts to determine the function of Tim44 have
concentrated on the finding that Tim44 binds to mitochondrial Hsp70 (mtHsp70) in a 1:1 complex (Kronidou et al.,
1994
; Rassow et al., 1994
; Schneider et al., 1994
). Cells
combining mutations in the genes encoding these proteins
show synthetic growth defects (Rassow et al., 1994
).
mtHsp70 is essential for driving preproteins across the
membranes into the matrix (Kang et al., 1990
) and seems
to constitute the motor unit of mitochondrial protein import (Pfanner and Meijer, 1995
; Rassow and Pfanner,
1995
; Schatz, 1996
). Nucleotides and cochaperones are involved in the complex formation between both proteins.
mtHsp70 initially binds to Tim44 in the ATP-bound state,
but the ATP is rapidly hydrolyzed (von Ahsen et al., 1995
; Horst et al., 1996
; Schneider et al., 1996
; Ungermann et al., 1996
). The interaction with nucleotides is modulated by
Mge1, the mitochondrial homologue of the prokaryotic
heat shock protein GrpE. Mge1 is associated with the
Tim44 complex in substoichiometric amounts, acts as a nucleotide release factor, and is required for the efficient
function of the import motor (Nakai et al., 1994
; Voos et al.,
1994
; Laloraya et al., 1995
; Westermann et al., 1995
; Deloche and Georgopoulos, 1996
; Schneider et al., 1996
; Dekker and Pfanner, 1997
; Deloche et al., 1997a
; Miao et
al., 1997
). Mdj1p and Mdj2p, the mitochondrial homologues of prokaryotic DnaJ, are not associated with the
Tim44 complex and there is no indication of an involvement in preprotein translocation (Rowley et al., 1994
;
Westermann et al., 1996
; Deloche et al., 1997b
; Westermann and Neupert, 1997
).
The binding site of Tim44 for mtHsp70 is not known.
Therefore, it is interesting to note that the sequence of
Tim44 contains a short stretch of 18 amino acids (residues
185-202) which shows some similarity to a part of the
J-domain which is characteristic of DnaJ and related modulators of Hsp70 proteins (Silver and Way, 1993
; Cyr et al.,
1994
; Rassow et al., 1994
; Hartl, 1996
; Bukau and Horwich, 1998
; Cheetham and Caplan, 1998
; Kelley, 1998
).
This observation is reminiscent of several systems in which
J-domains are the structures by which Hsp70s are bound
to partner proteins and customized for specific functions
(Rassow et al., 1995
). It is tempting to speculate that the 18 residues of the J-similarity region of Tim44 may contribute
to the interaction with mtHsp70. In this case Tim44 could
function in analogy to Sec63p, the membrane protein of
the ER membrane which binds BiP and thereby plays an important role in the transport of proteins into this organelle (Scidmore et al., 1993
; Schlenstedt et al., 1995
;
Brodsky, 1996
; Rapoport et al., 1996
; Corsi and Schekman,
1997
). However, the similarity of Tim44 to J-domains is
very limited, raising the question of whether the 18-residue segment in the sequence of Tim44 is of functional relevance for the protein.
Similarly unclear is the role of Tim44 in the mechanism
of mtHsp70-driven protein import. A complete inactivation of Tim44 retains the mitochondrial protein import
channels intact but causes defects in the translocation of
the mature parts of matrix-targeted preproteins (Bömer
et al., 1998
). Therefore, it is possible that the only function
of Tim44 is the cooperation with mtHsp70. Since up to
now no method was available to specifically modulate the interaction between Tim44 and mtHsp70, suggestions on
the involvement of Tim44 in the mechanism of protein
transport were often based on circumstantial evidence or
referred to studies using temperature-sensitive mutants of
the SSC1 gene encoding mtHsp70. In these mutants, the interactions between Tim44 and mtHsp70 are impaired,
but additional defects and thus indirect effects could not
be ruled out. In fact, there is evidence that the mitochondrial Tim machinery contains two binding sites for
mtHsp70, one site directly at Tim44 and a second binding
site at the Tim23/Tim17 complex (Rassow et al., 1995
;
Voos et al., 1996
; Bömer et al., 1997
). Therefore, it was unclear whether the defects in mitochondrial protein import
which are observed with the ssc1-mutant strains are due to
the impaired interaction of mtHsp70 with Tim44 or due to
other functions of mtHsp70.
In this study, we asked whether residues 185-202 of
Tim44 are required for the function of Tim44. We found
that Tim44 lacking this segment (Tim44
18) is unable to
substitute for authentic Tim44 in a yeast strain lacking the
wild-type TIM44 gene although Tim44
18 is correctly imported into mitochondria and assembled into the inner
membrane. Our results indicate that the 18-residue segment of Tim44 is required for the efficient interaction of Tim44 with mtHsp70. Moreover, we find that this interaction is necessary for the efficient action of mtHsp70 on
translocating folded preproteins and thus for the full activity of the mitochondrial protein import motor.
| |
Materials and Methods |
|---|
|
|
|---|
Construction of Strains and Plasmids
For expression of Tim44 in vivo, a 2.7-kb HindIII fragment containing the
TIM44 gene (Maarse et al., 1992
) was cloned into YEplac33 and
YEplac181 (Gietz and Sugino, 1988
). tim44
18 was constructed using the
Promega Altered Sites System. The 2.7-kb HindIII TIM44 fragment was
cloned into pSELECT-1 (= pALTER-1) and mutagenized with the mutagenic oligonucleotide 5'CAAAGGAGACTTAAACGTGCAGGAACAGCAGTGG3'. The 54-bp deletion was verified by DNA sequence
analysis. The mutagenized HindIII fragment was subsequently cloned into
YEplac181 (as a multi-copy vector) or YCplac111 (as a single-copy vector), respectively. The following Saccharomyces cerevisiae strains were used: PK82 (MAT
his4-713 lys2 ura3-52
trp1 leu2-3,112; Gambill et al.,
1993
), PK81 (MAT
ade2-101 lys2 ura3-52 leu2-3,112
trp1 ssc1-2(LEU2); Gambill et al., 1993
), MB3 (MAT
ade2-101 his3-
200 leu2-
1
lys2-801 ura3::LYS2; Maarse et al., 1992
), and MB20 (MATa ade2- trp1-
ura3- leu2- TIM44::LYS2 + YEplac33::TIM44(URA3); this study). For
plasmid shuffling, double transformed cells were grown in rich liquid
broth (YPD) and then plated on solid medium containing 5-fluoro-orotic
acid according to Boeke et al. (1987)
.
Import of Preproteins into Isolated Mitochondria, Cross-linking by EGS, and Blue Native Electrophoresis
The cDNA constructs encoding mitochondrial preproteins were cloned
into pGEM4 (Promega), the transcription was performed using SP6-RNA-polymerase (Stratagene), and the precursor proteins were subsequently synthesized in rabbit reticulocyte lysate in the presence of
[35S]methionine and [35S]cysteine (Amersham). For import experiments,
mitochondria were isolated from strains of S. cerevisiae following a standard protocol (Daum et al., 1982
). The wild-type strain PK82 or the strain
MB3 containing different expression plasmids was used, as indicated in
the figure legends. The import assays were carried out following standard
procedures as published previously (Söllner et al., 1991
; Alconada et al.,
1995
). In brief, the mitochondria (20 µg protein/100-µl assay) were incubated with reticulocyte lysate containing the preproteins in import buffer
(3% [wt/vol] BSA, 250 mM sucrose, 80 mM KCl, 5 mM MgCl2, 10 mM
MOPS-KOH, pH 7.2) at 25°C for up to 30 min. Treatment with proteinase
K (50 µg/ml) was performed at 0°C for 10 min. The protease was stopped
by addition of 1 mM PMSF. The mitochondria were reisolated by centrifugation at 16,000 g at 2°C for 10 min.
For cross-linking experiments, the hybrid protein Su9-DHFR was accumulated in import sites by import into ATP-depleted mitochondria. Mitochondria (in the presence of 20 µM oligomycin to inhibit the F0F1-ATPase) and reticulocyte lysate were depleted of ATP by incubation with apyrase (10 U/ml; Sigma) for 10 min at 0°C. The import was performed in the presence of 20 µM oligomycin. The mitochondria were washed by centrifugation through a sucrose cushion (500 mM sucrose, 1 mM EDTA, 10 mM MOPS, pH 7.2) and resuspended in 250 mM sucrose, 1 mM EDTA, 10 mM MOPS-KOH, pH 7.2 (SEM buffer). The mitochondria (100 µg protein) were incubated at 0°C for 20 min in 1 ml SEM containing 0.1 mg/ml ethylene glycolbis succinimidylsuccinate (EGS). The reaction was stopped by addition of 100 mM Tris-HCl, pH 7.2, and a second incubation of 20 min at 0°C. Proteins were precipitated by addition of 10% trichloroacetic acid in the presence of 0.0125% deoxycholate. For immunoprecipitation, the precipitates were lysed in 20 µl 1% SDS, 60 mM Tris-HCl, pH 6.8. The samples were diluted 40-fold by addition of 1% (wt/vol) Triton X-100, 0.3 M NaCl, 10 mM Tris-HCl, pH 7.5, and the antibodies bound to protein A-Sepharose (Pharmacia) were added.
Blue native electrophoresis was essentially performed following the
protocols of Schägger and von Jagow (1991)
. The samples were prepared
as described by Dekker et al. (1997)
.
Fractionation of Mitochondria
The procedures of protease treatment, swelling of mitochondria, and carbonate extraction were published previously (Blom et al., 1993
; Rassow
et al., 1994
). The tendency of mitochondrial proteins to form aggregates
was tested by lysis of the organelles and subsequent centrifugation. Mitochondria from the wild-type and from the strain expressing Tim44
18 in
addition to the authentic Tim44 (40 µg protein) were lysed in 0.1% Triton
X-100, 250 mM sucrose, 5 mM EDTA, 80 mM KCl, 10 mM MOPS, pH
7.5. The samples were divided into three parts, one part was incubated for
1 h at 0°C, the second part at 25°C, the third part was immediately mixed
with trichloroacetic acid. After 1 h, the samples which had been left without trichloroacetic acid were subjected to a centrifugation of 10 min at
16,000 g and 2°C. Proteins were precipitated from the supernatants by addition of 10% trichloroacetic acid. For sonication the mitochondria (40 µg
protein) were suspended in 500 µl 1 mM EDTA, 1 mM EGTA, 30 mM
Tris, pH 7.5, 1 mM PMSF, 0.5 mM o-phenantroline and sonicated by a
Branson Sonifier 10 times for 10 s (30% duty cycle, output 3) with intervals of 6 min for cooling of the samples. The membranes were pelleted by centrifugation at 100,000 g for 30 min. Proteins were precipitated from the
supernatants by addition of 10% trichloroacetic acid.
Coimmunoprecipitations
For coimmunoprecipitations, mitochondria (25 µg/sample) were lysed in
200 µl 250 mM sucrose, 80 mM KCl, 20 mM MOPS-KOH, pH 7.2, 0.1%
(vol/vol) Triton X-100, 5 mM EDTA, 0.5 mM PMSF. In the experiment
shown in Fig. 6 F, the mitochondria were lysed in 150 mM NaCl, 0.1%
Triton X-100, 0.5 mM PMSF, 10 mM Tris-HCl, pH 7.4. After a spin of
16,000 g for 10 min, the lysates were incubated with antibodies directed
against mtHsp70. The antibodies were covalently coupled to protein
A-Sepharose as described previously (Voos et al., 1994
).
|
Assessment of the Mitochondrial Membrane Potential
The membrane potential (
) of isolated yeast mitochondria was determined by recording the fluorescence decrease of the voltage-sensitive dye
3,3'-dipropylthiacarbocyanine iodide [DiSC3(5); Molecular Probes; Sims
et al., 1974
]. The assays were performed using a Perkin-Elmer 640-40 fluorescence spectrometer at 25°C (excitation at 622 nm, slit width 5 nm). The
mitochondria (100 µg protein) were incubated in 1 ml of 0.6 M sorbitol,
0.1% (wt/vol) BSA, 80 mM KCl, 10 mM MgCl2, 0.5 mM EDTA, pH 7.4. The final concentration of the fluorescent dye DiSC3(5) was 3.6 µM. The
membrane potential was dissipated by the addition of 3 µM (final concentration) KCN. The difference between the fluorescences before and after
the addition of KCN represents a rough assessment to the membrane potential.
| |
Results |
|---|
|
|
|---|
A Segment of Tim44 Essential for Viability of S. cerevisiae
The region of sequence similarity between Tim44 and
characteristic J-domains is shown in Fig. 1 A. The similarity extends from residue 185 to residue 202 and is depicted
for the two yeast proteins Sec63p (Sadler et al., 1989
; Feldheim et al., 1992
) and Sis1p (Luke et al., 1991
; Zhong and
Arndt, 1993
), and for the Escherichia coli protein DnaJ
(Ohki et al., 1986
; Liberek et al., 1991
). The structure of
the J-domain of DnaJ has been determined by NMR spectroscopy (Szyperski et al., 1994
; Hill et al., 1995
). The
J-similarity segment of Tim44 corresponds to
helix II of DnaJ (residues 18-30) and the first half of the following
turn region. In DnaJ, the turn is followed by helix III comprising residues 41-55. The secondary structures which are
predicted for the corresponding part of Tim44 similarly
show two hydrophilic
helices which are connected by a
putative turn element. However, it should be emphasized
that the similarity of Tim44 to J-domains is still very limited. Tim44 obviously does not belong to the family of homologous J-proteins.
|
To determine the relevance of the J-similar segment for
the function of Tim44 in vivo, we constructed a plasmid
encoding a Tim44 with a deletion of residues 185-202
(Tim44
18). We then tested whether Tim44
18 can substitute for authentic Tim44 in a genetic assay (Fig. 1 B). In a
strain of S. cerevisiae expressing both forms of Tim44 from
different plasmids, we used the URA3/FOA technique to
deplete the authentic Tim44. It turned out that the cells
lacking the authentic Tim44 were not viable. Tim44
18
could not substitute for wild-type Tim44, and neither on
glycerol nor on glucose was any growth observed. Thus,
this result demonstrates that the 18-residue segment of
Tim44 is essential for viability of yeast.
Tim44 Lacking Residues 185-202 Is Imported into Mitochondria and Reaches Its Functional Location
The lethality of the 18-residue deletion could be caused by
two different reasons. Either the 18-residue segment is
crucial for the biogenesis of Tim44, or this segment is required for the function of Tim44 within the mitochondria.
To address the first possibility, we expressed Tim44
18 in
reticulocyte lysate and tested whether the protein could be
imported into isolated mitochondria. In parallel we imported the authentic Tim44 (Fig. 2 A). Both preproteins
were processed to a mature form (Fig. 2 A, lanes 1 and 5)
and translocated into a location protected against externally added proteinase K (lanes 3 and 7). The import was dependent on the mitochondrial membrane potential, confirming the specificity of the reaction. The result demonstrates that the 18-residue segment of Tim44 is not required for efficient transport into mitochondria in vitro.
|
To test whether Tim44
18 is similarly imported in vivo,
Tim44
18 was expressed in a S. cerevisiae wild-type strain from a multi-copy vector, and mitochondria were isolated
to determine the amount of imported protein (Fig. 2 A,
lanes 9 and 10). We found that the mitochondria had
imported both the authentic Tim44 and Tim44
18. The
amount of authentic Tim44 was not significantly reduced
as compared with the original wild-type strain; Tim44
18 was overexpressed about threefold. The location of the
imported Tim44 proteins was confirmed by a fractionation
experiment. Both proteins were resistant against externally added trypsin in intact mitochondria (Fig. 2 B, lane
2) and after opening of the intermembrane space by swelling (Fig. 2 B, lane 5). Only after disruption of the inner
membrane by sonication did the proteins become accessible for the protease (Fig. 2 B, lanes 3 and 6), in agreement
with results which were obtained previously for the wild-type Tim44 (Blom et al., 1993
; Rassow et al., 1994
). After
lysis of the mitochondria by detergent, both proteins were
similarly soluble (Fig. 2 C). Even after prolonged incubation at 0 or 25°C, no formation of aggregates was observed
(Fig. 2 C, lanes 2 and 4). We then tested whether the deletion of the 18-residue segment may affect the association
of Tim44 with the inner membrane. The extraction of Tim44 and Tim44
18 was monitored by sodium carbonate
and again both proteins showed the same behavior (Fig. 2
D). In contrast to the ADP/ATP carrier (AAC) which was
resistant against this treatment, both Tim44 proteins were
extracted. The association of Tim44 with the inner membrane was also determined in the presence of different salt
concentrations (Fig. 2 E). Mitochondria were sonicated in
the presence of up to 500 mM KCl and the membranes were subsequently pelleted by centrifugation. Tim44 and
Tim44
18 were found stably associated with the membranes; only minor amounts of both proteins were released at higher ionic strength. As a control, we followed
the distribution of Mge1p which was soluble in all samples.
The AAC was completely resistant against extraction.
Eventually, we investigated the involvement of both
forms of Tim44 in the formation of high molecular weight
complexes using the method of blue native electrophoresis
(BN-PAGE; Schägger and von Jagow, 1991
; Dekker et al.,
1997
). As shown in Fig. 2 F, Tim44 and Tim44
18 both
showed the same distribution, suggesting that both proteins participate in the same interactions with the components of the Tim machinery. In a previous study we found
that Tim44 is mainly associated with Tim23 (Bömer et al.,
1997
). Therefore, we also determined the complex formation of Tim23 and found that it showed the same running
behavior in the BN-PAGE, irrespective if only the authentic Tim44 was present or if Tim44
18 was overexpressed in addition.
We conclude from these experiments that Tim44
18 is
efficiently imported into mitochondria and acquires the
correct topology at the inner side of the inner membrane.
The results of the BN-PAGE indicate that Tim44
18
adopts the native folding state and engages in the same interactions with the Tim machinery as the authentic Tim44.
These conclusions are corroborated by the interactions
of Tim44
18 with different forms of mtHsp70 (see below,
Fig. 6 F).
Tim44
18 Interacts with Mitochondrial Preproteins
If Tim44
18 is recruited by the Tim machinery, is it also
present at import sites during translocation of preproteins? We addressed this question by chemical cross-linking (Fig. 3). As a substrate we synthesized the hybrid protein Su9-DHFR, containing the presequence of subunit 9 of the mitochondrial ATP synthase fused to the complete
DHFR. The import of this protein is dependent on the
membrane potential 
(Fig. 3 A, lanes 1-4) and ATP
(Fig. 3 A, lanes 5-8). After depletion of ATP, Su9-DHFR
is accumulated in import sites as a membrane-spanning
translocation intermediate. Following this protocol, Su9-DHFR was accumulated in mitochondria of both the
Tim44
18 overproducing strain and the wild-type (Fig. 3 B,
lanes 1 and 2). The translocation intermediates were cross-linked to the proteins in the vicinity by addition of the reagent EGS. In wild-type mitochondria, two products were
formed, corresponding to the precursor form and the processing intermediate of Su9-DHFR (Fig. 3 B, lane 4, bands
labeled Tim44* and Tim44**; Blom et al., 1993
). In mitochondria, which in addition contained Tim44
18, a third
cross-linking product was formed which could be precipitated by antibodies against Tim44 (Fig. 3 B, lane 7, band
labeled Tim44***). No reaction product was precipitated by the preimmune serum. According to its size in the SDS-PAGE, the additional product corresponds to cross-linking of Tim44
18 to the processing intermediate of Su9-DHFR. The cross-linking of a protein in transit across
the mitochondrial membranes confirms that Tim44
18 is
present at protein import sites.
|
Coexpression of Tim44
18 Causes Membrane
Potential-independent Defects in Protein Import
To determine the possible role of the 18-residue segment
in Tim44, additional preproteins were imported and tested
for defects in distinct steps of translocation across the mitochondrial membranes. In a first series of experiments,
the
subunit of the mitochondrial ATP synthase (F1
)
was synthesized in reticulocyte lysate in the presence of
[35S]methionine/[35S]cysteine and imported into mitochondria which were isolated from the Tim44
18-overexpressing strain and the corresponding wild-type (Fig. 4 A). It is
known from previous studies that the import of F1
is very
sensitive against defects in the import machinery and requires the mtHsp70-dependent unfolding machinery of
the mitochondria (Kang et al., 1990
; Rassow and Pfanner,
1991
; Gambill et al., 1993
). We now observed only a slight
reduction in processing of F1
, suggesting that the deletion
of the 18-residue segment of Tim44 does not cause major
changes in the insertion of the presequence into the Tim
machinery of the inner membrane (Fig. 4 A, top). However, a protease-protection assay revealed a delay in the
translocation of the mature part of the preprotein (Fig. 4
A, bottom), indicating that the deletion affected the completion of translocation. After an import time of 20 min
the efficiency of translocation was reduced by 75-80%
(Fig. 4 B, column 2 vs. column 3). Some reduction was also
observed after overexpression of the authentic Tim44, but
the effect was much less pronounced (Fig. 4 B, column 3, and see below, Fig. 5 C).
|
|
Modifications of mitochondrial inner membrane proteins can easily lead to a reduction of the mitochondrial
membrane potential and thereby indirectly cause reduced
efficiencies of protein transport. To address this possibility, we compared the membrane potential of the mitochondria which had been used in the previous experiments. As a sensitive assay we determined the membrane
potential-dependent uptake of the dye DiSC3(5) (Sims et al.,
1974
). The uptake is reversible and can be quantified by
following the change in the fluorescence of the dye. With
mitochondria from the Tim44
18 mutant strain no reduction in the membrane potential was observed (Fig. 4 C).
An indirect effect of the mutation on mitochondrial protein import mediated by a weakened membrane potential
can thus be excluded.
Coexpression of Tim44
18 Leads to Reduced Import
Efficiencies of Folded Protein Domains
We then asked if the effect of the deletion of the 18-residue segment on protein import is dependent on the folding state of the preprotein. Previous studies have shown
that the heme-binding domain of cytochrome b2 is tightly
folded and requires an intact mtHsp70 system to drive the
unfolding of this domain (Glick et al., 1993
; Voos et al.,
1993
, 1996
). Following this principle, we now imported
two different preproteins, b2(167)
-DHFR and b2(220)
-DHFR (Fig. 5 A). Both constructs contain amino-terminal
parts of cytochrome b2 of different length fused to DHFR.
The intermembrane space sorting signal is deleted to allow
passage into the mitochondrial matrix. The hybrid protein
b2(167)
-DHFR only contains an incomplete and therefore loosely folded heme-binding domain. A step of active unfolding of this preprotein is not required to allow the
import reaction. The situation is different with the longer
construct b2(220)
-DHFR. This protein contains the complete heme-binding domain (residues 81-179) and requires an unfolding reaction to allow the import. Thereby,
the heme-binding domain causes restrictions if imported
by a weakened translocation machinery (Glick et al., 1993
;
Voos et al., 1993
, 1996
).
We compared the import kinetics of b2(167)
-DHFR
and b2(220)
-DHFR in wild-type mitochondria and in mitochondria containing Tim44
18 in addition to the intact
Tim44 (Fig. 5 B, lanes 1-8). With both preproteins, the import was clearly reduced in the Tim44
18 mitochondria
(Fig. 5 B, lanes 5-7). To assess the effect of the heme-binding domain on the import efficiency we calculated the relative amounts of the imported proteins (Fig. 5 C). We
found that after 10 min of import, both constructs were imported into wild-type mitochondria with the same efficiency (Fig. 5 C, column 4). With mitochondria from a
Tim44-overproducing strain, the relative import efficiency
of b2(220)
-DHFR was slightly improved (Fig. 5 C,
column 6). However, with mitochondria from the strain
overproducing Tim44
18, the relative import efficiency of
b2(220)
-DHFR was reduced to ~35%, as compared with
the import efficiency of b2(167)
-DHFR (Fig. 5 C, column
5). Similar ratios were found at other time points of the
import reaction (Fig. 5 C, columns 1-3). The 18-residue
segment of Tim44 appears to be required to permit the efficient import of partially folded preproteins which require
the full activity of the import machinery. The effect on
loosely folded preproteins is less pronounced but also in
this case the translocation is clearly facilitated if the activity of mtHsp70 is exclusively mediated by intact Tim44.
Deletion of the 18-Residue Segment Causes Reduced Complex Formation of Tim44 with mtHsp70
The experiments shown in Figs. 2 and 3 have indicated
that the interactions of Tim44
18 with the Tim machinery
are not disturbed by the deletion of the 18-residue segment. We now ask if Tim44
18 shows an altered interaction
with mtHsp70. We lysed mitochondria from the wild-type
in the presence of detergent and performed coimmunoprecipitations using specific antibodies raised against
mtHsp70. The precipitates were analyzed by immunoblotting and demonstrated the association of mtHsp70 with
Tim44 (Fig. 6 A). We then lysed mitochondria from the
strain expressing both forms of Tim44. The mitochondria
contained about three- to fourfold more Tim44
18 than
Tim44 (Fig. 6 B, lane 1, and Fig. 6 C, lane 1). By coimmunoprecipitates from these lysates we compared the association of mtHsp70 with Tim44
18 and the authentic Tim44.
The ratio of Tim44
18 to Tim44 in the precipitates was
close to 1:1, demonstrating that complex formation of
Tim44
18 to mtHsp70 was reduced about three- to fourfold
by the deletion of the 18-residue segment (Fig. 6 B, lane 2, and Fig. 6 C, lane 3). Both forms of Tim44 were stable
upon prolonged incubation after lysis, confirming that the
reduced amount of Tim44
18 in the immunoprecipitates
was due to a reduced complex formation with mtHsp70
(Fig. 6 C, lanes 1 and 2).
The reduced affinity of mtHsp70 to Tim44
18 as compared with the authentic Tim44 was confirmed by systematic quantifications (Fig. 6 D). Complex formation of
mtHsp70 with Tim44
18 was reduced by ~70%. In the
presence of ATP, Tim44
18 and Tim44 were both efficiently released from mtHsp70, confirming the specificity of the precipitations (Fig. 6 E). ATP at a concentration of
2.5 nM was sufficient to cause the dissociation of 50% of
the complexes with Tim44
18 as well as with Tim44 (not
shown). We conclude that the 18-residue segment of
Tim44 is not the only structure which is involved in complex formation with mtHsp70. But the segment appears to
be required to allow binding of sufficient efficiency and, as
suggested by the results of the import experiments, for optimal cooperation of both proteins in mitochondrial protein import.
The allele ssc1-2 encodes a mutant form of mtHsp70
which shows a reduced affinity for Tim44 but an enhanced
affinity for substrate proteins (Kang et al., 1990
; Gambill
et al., 1993
; Voos et al., 1993
, 1996
; Schneider et al., 1994
;
von Ahsen et al., 1995
). We expressed Tim44
18 in a ssc1-2
strain and determined the interactions of the mutant
mtHsp70 with both Tim44 proteins and a substrate protein
by coimmunoprecipitations (Fig. 6 F). While the efficiency
of binding of the mutant mtHsp70 to the substrate protein
Su9-DHFR was more than fourfold higher than that of
wild-type mtHsp70 (Fig. 6 F, columns 5 and 6), the association of the mutant mtHsp70 with both Tim44 and Tim44
18
was blocked (Fig. 6 F, columns 2 and 4). This result implies
that not only the authentic Tim44 but also the truncated
Tim44
18 is recognized by mtHsp70 as a partner protein of
special properties, and not as a substrate protein.
| |
Discussion |
|---|
|
|
|---|
In this study we have characterized the role of complex
formation of mtHsp70 with Tim44 in mitochondrial protein import. A system of reduced binding between both
proteins was created by the deletion of an 18-residue segment in Tim44 (residues 185-202) which shows a limited
similarity to one of the two
helices of J-domains. The intracellular localization of Tim44
18 is not altered by the deletion. In all fractionation experiments Tim44
18 showed
the same behavior as the authentic Tim44, and by chemical cross-linking we found that Tim44
18 is localized at the
inner membrane protein import sites.
The correct topology of Tim44
18 within the mitochondria allowed us to test whether the 18-residue segment of
Tim44 is required to recruit mtHsp70 to the Tim machinery of the inner membrane. We found that binding of
mtHsp70 to Tim44
18 was reduced by ~70% as compared
with the authentic Tim44. The 18-residue segment of
Tim44 is obviously not the only site for binding to mtHsp70. In contrast to the integral membrane protein
Sec63p which is exposed to the ER lumen only by short
segments of its sequence (Feldheim et al., 1992
), Tim44 is
a peripheral protein and in larger parts exposed to the matrix (Blom et al., 1993
; Rassow et al., 1994
). This topology
may allow the formation of multiple binding sites.
While this manuscript was in preparation, a publication
appeared by Greene et al. (1998)
showing that the binding
site of DnaJ for DnaK is the helix II of the J-domain,
which corresponds exactly to the segment of similarity to
Tim44. Since Tim44 seems not to belong to the family of
J-proteins (Wada and Kanwar, 1998
) we assume that
the J-related segment of Tim44 does not represent a
J-homology in the strict sense but rather a J-analogous development to facilitate the interaction with mtHsp70. According to Greene et al. (1998)
, the helix II of DnaJ interacts with the ATPase domain of DnaK. Following the
analogy between Tim44 and DnaJ, Tim44 should similarly
bind to the ATPase domain of mtHsp70. However, other
J-proteins were found to interact with the carboxy-terminal domain of Hsp70s (Freeman et al., 1995
; Demand et
al., 1998
) or to require both domains for binding (Ungewickell et al., 1997
). Therefore, it may be speculated
that the interaction between mtHsp70 and Tim44 is mediated by multiple attachment sites, as was shown recently
by the x-ray structure for the complex of DnaK with GrpE (Harrison et al., 1997
). We cannot completely rule out allosteric effects of the deletion of the 18-residue segment.
However, the only difference to the wild-type protein we
observed was restricted to the interaction with mtHsp70.
The very sensitive assays of chemical cross-linking (Fig. 3
B) and blue native electrophoresis (Fig. 2 F) demonstrate
that the oligomeric state of Tim44, and the direct interactions with preproteins and other components of the Tim
machinery were retained. The comparison to the DnaJ-DnaK complex as analyzed by Greene et al. (1998)
suggests that the 185-202 segment of Tim44 provides the major binding site for mtHsp70.
Several data indicate that Tim44 binds to Tim23 and
provides a dynamic link between the Tim proteins which
form the protein import channel and the soluble mtHsp70
system of the matrix (Bömer et al., 1997
; Dekker et al.,
1997
). With Tim44
18 the function of this link is specifically
impaired in the interactions of Tim44
18 with mtHsp70.
Our import experiments demonstrate that the presence of
Tim44
18 causes a significant reduction in the import efficiencies of different preproteins, including proteins which are regarded as loosely folded. The import of all of these
preproteins is strictly dependent on mtHsp70 as demonstrated by previous studies using temperature-sensitive
strains of SSC1 (encoding mtHsp70) (Gambill et al., 1993
;
Voos et al., 1993
). The strongest inhibition of import was
observed with preproteins which contain a tightly folded
domain. Such domains cause restrictions in the translocation across the mitochondrial membranes which are due to
the requirement of unfolding within the import channel
(Gambill et al., 1993
; Glick et al., 1993
; Voos et al., 1993
,
1996
; Matouschek et al., 1997
). To overcome these restrictions, the mtHsp70 system of the matrix has to exert a
force on the translocating protein which is sufficient to
pull the protein across the membranes.
Studies to elucidate the mechanism by which this force
is generated made use of the ssc1-2 mutant of mtHsp70
(Kang et al., 1990
; Schneider et al., 1994
; von Ahsen et al.,
1995
; Voos et al., 1996
). The mtHsp70 of this mutant binds
efficiently to translocating preproteins but is impaired in
binding to Tim44. This defect correlates with an inhibition
in the import of tightly folded protein domains. However,
conclusions could only be drawn with reservation. The Tim machinery seems to contain at least two binding sites
for mtHsp70, one at Tim44 and a second site at the Tim23/
Tim17 import channel, and both interactions are inhibited
by the ssc1-2 mutation (Bömer et al., 1997
). The principle
which governs the mechanism of mtHsp70-dependent protein import is still unknown. A Brownian ratchet mechanism (Simon et al., 1992
; Ungermann et al., 1994
; Gaume
et al., 1998
) and a mechanism of mtHsp70/Tim44-mediated pulling (Glick, 1995
; Pfanner and Meijer, 1995
) have
been suggested. In this context it is remarkable that the effect of Tim44
18 on the import of different preproteins and
on the viability of yeast resembles the effects of ssc1-2.
This similarity in the phenotype thus corroborates and
specifies the concept that the cooperation of Tim44 with
mtHsp70 is of particular importance in the import of
tightly folded protein domains. In a previous study on a
complete inactivation of functional Tim44 in isolated mitochondria we showed that Tim44 acts at the inner side of
the inner membrane (Bömer et al., 1998
). The results obtained with the Tim44
18 construct suggest that in this location the functions of Tim44 in protein import may be
confined to specific interactions with mtHsp70.
In summary, the results of this study demonstrate that
the J-related segment of Tim44 (residues 185-202) is required for the essential functions of Tim44 in mitochondria. This segment is not the only element involved in the
interaction of Tim44 with mtHsp70, but it is required for
productive cooperation of both proteins and the optimal
efficiency of mitochondrial protein import. mtHsp70 is an
essential motor protein in the translocation of all proteins
which are imported into the mitochondrial matrix, irrespective of whether or not they contain tightly folded domains (Schatz, 1996
; Neupert, 1997
; Pfanner et al., 1997
).
In contrast, the requirement for an interaction of mtHsp70
with Tim44 seems to be less strict and appears to play an
important role primarily in situations which require the
full activity of the import motor, for example in overcoming stronger restrictions in the translocation of preproteins. The import of loosely folded preproteins is facilitated by Tim44, but the effect is much more pronounced in
the case of tightly folded domains.
| |
Footnotes |
|---|
Address correspondence to Dr. Nikolaus Pfanner, Institut für Biochemie und Molekularbiologie, Universität Freiburg, Hermann-Herder-Strasse 7, D-79104 Freiburg, Germany. Tel.: 49-761-203-5224. Fax: 49-761-203-5261. E-mail: pfanner{at}ruf.uni-freiburg.de
Received for publication 29 June 1998 and in revised form 31 March 1999.
We thank Drs. Oliver von Ahsen, Michael Kübrich, and Martin Moczko for technical advice, Nicole Zufall for help in cloning procedures, Dr. Bernard Guiard for the b2-DHFR plasmids, Dr. Elizabeth Craig for the ssc1-2 strain, and Drs. Bernd Bukau, Ulrich Hartl, and Gabriel Schlenstedt for helpful discussions.
This work was supported by the Deutsche Forschungsgemeinschaft, the Sonderforschungs-bereich 388, and the Müller-Fahnenberg-Stiftung.
| |
Abbreviations used in this paper |
|---|
EGS, ethylene glycolbis succinimidylsuccinate; mt, mitochondrial; Su9-DHFR, fusion protein between presequence of F0-ATPase subunit 9 and dihydrofolate reductase; Tim44, 44-kD protein of the mitochondrial inner membrane import machinery.
| |
References |
|---|
|
|
|---|
| 1. | Alconada, A., F. Gärtner, A. Hönlinger, M. Kübrich, and N. Pfanner. 1995. Mitochondrial receptor complex from Neurospora crassa and Saccharomyces cerevisiae. Methods Enzymol. 260: 263-287 [Medline]. |
| 2. | Bauer, M.F., C. Sirrenberg, W. Neupert, and M. Brunner. 1996. Role of Tim23 as voltage sensor and presequence receptor in protein import into mitochondria. Cell. 87: 33-41 [Medline]. |
| 3. | Berthold, J., M.F. Bauer, H.-C. Schneider, C. Klaus, K. Dietmeier, W. Neupert, and M. Brunner. 1995. The MIM complex mediates preprotein translocation across the mitochondrial inner membrane and couples it to the mt-Hsp70/ ATP driving system. Cell. 81: 1085-1093 [Medline]. |
| 4. |
Blom, J.,
M. Kübrich,
J. Rassow,
W. Voos,
P.J.T. Dekker,
A.C. Maarse,
M. Meijer, and
N. Pfanner.
1993.
The essential yeast protein MIM44 (encoded
by MPI1) is required at an early step of preprotein translocation across the
mitochondrial inner membrane.
Mol. Cell. Biol.
13:
7364-7371
|
| 5. | Blom, J., P.J.T. Dekker, and M. Meijer. 1995. Functional and physical interactions of components of the yeast mitochondrial inner-membrane import machinery (MIM). Eur. J. Biochem. 232: 309-314 [Medline]. |
| 6. | Boeke, J.D., J. Trueheart, G. Natsoulis, and G.R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154: 164-175 [Medline]. |
| 7. | Bömer, U., M. Meijer, A.C. Maarse, P.J.T. Dekker, N. Pfanner, and J. Rassow. 1997. Multiple interactions of components mediating preprotein translocation across the inner mitochondrial membrane. EMBO (Eur. Mol. Biol. Organ.) J. 16: 2205-2216 [Medline]. |
| 8. | Bömer, U., A.C. Maarse, F. Martin, A. Geissler, A. Merlin, B. Schönfisch, M. Meijer, N. Pfanner, and J. Rassow. 1998. Separation of structural and dynamic functions of the mitochondrial translocase: Tim44 is crucial for the inner membrane import sites in translocation of tightly folded domains, but not of loosely folded preproteins. EMBO (Eur. Mol. Biol. Organ.) J. 17: 4226-4237 [Medline]. |
| 9. | Brodsky, J.L.. 1996. Post-translational protein translocation: not all hsc70s are created equal. Trends Biochem. Sci. 21: 122-126 [Medline]. |
| 10. | Bukau, B., and A.L. Horwich. 1998. The Hsp70 and Hsp60 chaperone machines. Cell. 92: 351-366 [Medline]. |
| 11 |