|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MRC Laboratory for Molecular Cell Biology, and Department of Biochemistry and Molecular Biology, University College London, London WC1E 6BT, United Kingdom
| |
Abstract |
|---|
|
|
|---|
By analyzing the trafficking of HRP-P-selectin chimeras in which the lumenal domain of P-selectin was replaced with horseradish peroxidase, we determined the sequences needed for targeting to synaptic-like microvesicles (SLMV), dense core granules (DCG), and lysosomes in neuroendocrine PC12 cells. Within the cytoplasmic domain of P-selectin, Tyr777 is needed for the appearance of P-selectin in immature and mature DCG, as well as for targeting to SLMV. The latter destination also requires additional sequences (Leu768 and 786DPSP789) which are responsible for movement through endosomes en route to the SLMV. Leu768 also mediates transfer from early transferrin (Trn)-positive endosomes to the lysosomes; i.e., operates as a lysosomal targeting signal. Furthermore, SLMV targeting of HRP-P-selectin chimeras, but not the endogenous SLMV protein synaptophysin/p38, previously shown to be delivered to SLMV directly from the plasma membrane, is a Brefeldin A-sensitive process. Together, these data are consistent with a model of SLMV biogenesis which involves an endosomal intermediate in PC12 cells. In addition, we have discovered that impairment of SLMV or DCG targeting results in a concomitant increase in lysosomal delivery, illustrating the entwined relationships between routes leading to regulated secretory organelles (RSO) and to lysosomes.
Key words: P-selectin; PC12 cells; lysosomes; dense core granules; synaptic-like microvesicles| |
Introduction |
|---|
|
|
|---|
NEUROENDOCRINE cell lines have served as good
model systems for studying the biogenesis of
regulated secretory organelles (RSO)1, i.e., the
dense core granules (DCG) and synaptic-like microvesicles (SLMV), which are involved in storage and exocytotic
release of soluble material after external stimulation. Although substantial progress has been made towards understanding trafficking routes to individual RSO, the relationships between routes to the different RSO, as well as
between RSO and other post-Golgi destinations such as
the lysosome, are largely unknown. Since more than one pathway contributes to the steady state intracellular distribution of many proteins, it is important to establish how
paths leading to different destinations are interconnected
and therefore how homeostasis of RSO membrane composition is maintained. This is especially important for
membrane proteins that are found in both RSO such as
vesicle-associated membrane protein (VAMP) I and II, as
well as synaptotagmin I (Elferink et al., 1993
; Walch-Solimena et al., 1993
; Chilcote et al., 1995
; Papini et al., 1995
).
An extreme example of a multiorganellar distribution is
that exhibited by P-selectin. This type I membrane protein
was originally found in the specialized secretory granules
of endothelial cells and platelets (Bonfanti et al., 1989
;
McEver et al., 1989
). It belongs to a family of adhesion
molecules and operates in early stages of the inflammatory
response as a receptor for leukocytes (Johnston et al.,
1989
). When expressed in nonendothelial cells, P-selectin
is sorted to secretory granules and/or constitutively delivered to the cell surface (Disdier et al., 1992
; Koedam et al.,
1992
; Subramaniam et al., 1993
; Setiadi et al., 1995
). From the plasma membrane, P-selectin is rapidly internalized to
endosomes and then, depending on the cell type, either recycles back to secretory granules (Koedam et al., 1992
;
Subramaniam et al., 1993
) or is delivered to SLMV
(Strasser et al., 1999
, in press) or to lysosomes for degradation (Green et al., 1994
; Blagoveshchenskaya et al.,
1998a
,b; Straley et al., 1998
). Interestingly, despite its efficient endocytosis, no discrete internalization signal has
been found within this protein (Setiadi et al., 1995
).
The cytoplasmic tail of P-selectin has been found to be
both necessary and sufficient for mediating the delivery of
this protein to different post-Golgi destinations, i.e., DCG
and SLMV, and lysosomes, although the transmembrane
domain of P-selectin was recently shown to increase the
efficiency of granule targeting (Fleming et al., 1998
). Together, these findings suggest that P-selectin provides an
ideal model with which to examine the relations between
different post-Golgi pathways taken by the same protein.
Among neuroendocrine cell lines, PC12 is the best characterized with respect to both RSO, SLMV and DCG.
SLMV are considered to be a neuroendocrine counterpart
of the small synaptic vesicles (SSV) from neurons, since
they share many biochemical and physical properties with
authentic SSV (Clift-O'Grady et al., 1990
). The DCG are
the dominant RSO in endocrine cells and they store and release not only classical neurotransmitters, but also peptides and proteins (Cramer and Cutler, 1992
; Bauerfeind
and Huttner, 1993
). When expressed in PC12 cells,
P-selectin is targeted to both RSO as well as to lysosomes,
thus providing a highly appropriate system to investigate
relationships between these different trafficking routes.
One complication in carrying out this sort of analysis is
that there is often more than one route to organelles. For
example, although there is a consensus as to the initial step
of SLMV/SSV formation which involves the constitutive
delivery of newly synthesized SLMV membrane proteins
from the TGN to the plasma membrane (Cutler and Cramer,
1990
; Regnier-Vigouroux et al., 1991
; Bauerfeind and Huttner, 1993
), subsequent trafficking from the plasma
membrane to the SLMV/SSV remains less clear, with two
alternative routes being proposed, one direct from the
plasma membrane and another involving an endosomal intermediate.
In contrast, DCG bud from the TGN. Newly formed
granules (immature DCG, iDCG) are often partially
coated with clathrin and adaptor protein (AP) 1, which are
involved in a remodelling process leading to mature DCG
(mDCG) which are devoid of coats (Arvan and Castle, 1998
;
Tooze, 1998
). A direct route incorporating newly synthesized DCG membrane proteins into forming iDCG from the
TGN would therefore be expected to operate, although
evidence for this process is currently lacking. In addition,
resident granule membrane proteins are capable of recycling to granules via the plasma membrane, endosomal intermediates, and the TGN (Patzak and Winkler, 1986
; von
Grafenstein and Knight, 1992
; Partoens et al., 1998
).
The third major destination of P-selectin is the lysosome. A substantial body of data has established that
membrane proteins are delivered to lysosomes by two
routes, either directly from the TGN via endosomes or via
the plasma membrane followed by a passage through endosomal compartments en route to lysosomes (Kornfeld and Mellman, 1989
; Hunziker and Geuze, 1996
).
Given such a multiplicity of post-Golgi routes, how might
a complex distribution such as the triorganellar localization shown by P-selectin be achieved? An accumulating
body of evidence indicates that trafficking of transmembrane proteins to post-Golgi destinations is controlled by
short, specific sequences (often called targeting signals) located in their cytoplasmic domains. The most common targeting signals are classified into two groups, tyrosine- and dileucine-based signals. The signals mediating lysosomal
targeting generally belong to these two families, although
novel categories of lysosomal targeting signals (LTS) have
recently been described (Subtil et al., 1997
; Blagoveshchenskaya et al., 1998a
,b; Straley et al., 1998
).
Some targeting signals have been shown to mediate
more than one sorting step, e.g., those controlling internalization from the plasma membrane and subsequent trafficking to lysosomes, or endocytosis and trafficking to
SLMV (Sandoval and Bakke, 1994
; Grote et al., 1995
;
Grote and Kelly, 1996
; Marks et al., 1997
). Given the endosomal origin of SLMV documented by some investigators, the targeting requirements for delivery to SLMV and
lysosomes might overlap. However, there is no experimental support for this notion, since resident SLMV proteins
have not been thought to be targeted to lysosomes. Moreover, whether common signals are used for delivery to the
two different RSO is not yet clear either, although data on
VAMPII expressed in insulinoma cells suggest that targeting requirements to both RSO might be similar (Regazzi et al., 1996
). Nevertheless, despite the numerous studies of
sequence requirements mediating post-Golgi trafficking,
analyses of multiorganellar targeting of single proteins
have not been attempted.
In this study, we examined the signal dependence of targeting to three major post-Golgi destinations in PC12
cells, SLMV, DCG, and lysosomes, by following HRP-
P-selectin chimeras in which the extralumenal domain of
P-selectin was replaced with HRP. These chimeras provide a quantitative and convenient enzymatic assay with
which to detect the protein in a variety of intracellular compartments (Connolly et al., 1994
; Stinchcombe et al.,
1995
; Norcott et al., 1996
; Blagoveshchenskaya et al.,
1998a
,b; Strasser et al., 1999
). Here, we describe how the
complex distribution of P-selectin is controlled by multiple
determinants, some of which are needed for more than
one destination. The pattern of usage of the targeting determinants reveals relationships between the pathways
leading to the three organelles. In addition, our data determine the extent of the contribution of different routes to
the target organelles. Finally, the pattern of changes in distribution of P-selectin to these organelles, when one or
two destinations are removed from the protein's itinerary,
shows how post-Golgi trafficking choices are restricted.
| |
Materials and Methods |
|---|
|
|
|---|
Materials and Reagents
Mouse monoclonal (clone 2H11) and rabbit polyclonal anti-HRPs were
purchased from Advanced ImmunoChemical Inc. and from DAKO, respectively. Polyclonal antibodies against secretogranin II and synaptophysin/p38 have been described previously (Cutler and Cramer, 1990
).
Immobilon-P membrane was obtained from Millipore; 3H-Dopamine was
from Amersham International; NHS-SS-biotin was from Pierce; Express
35S-labeling mix of methionine and cysteine was from NEN Life Science Products; and AmplifyTM was from Amersham. Other chemicals were purchased from Sigma Chemical Co.
Mouse receptor grade epidermal growth factor (EGF), human iron saturated transferrin (Trn), protein A, and 2H11 were iodinated using the
modified IODO-GEN procedure as described elsewhere (Wiley and Cunningham, 1982
).
Constructs
A chimeric cDNA comprising the human growth hormone signal sequence followed by HRP, the transmembrane domain, and cytoplasmic tail of P-selectin (see Fig. 2) was generated as previously described (Norcott et al., 1996
), as were chimeras with deletions of the cytoplasmic tail.
The tetra-alanine substitutions and point mutations were made as described (Blagoveshchenskaya et al., 1998a
,b). Two additional mutants
were constructed in the same way using the following primers: Y777A:
AGCCACCTAGGAACAGCTGGAGTTTTTACAAA and Y777F:
AGCCACCTAGGAACATTTGGAGTTTTTACAAA. Only the sense
primer is shown, the anti-sense primer used is the exact complement. The
constructs obtained were confirmed by sequencing.
|
Cell Culture and Transfection
The rat pheochromocytoma cell line PC12 (CCL23; American Type Culture Collection) was maintained and transfected as described previously
(Norcott et al., 1996
). Where necessary, cells were stimulated with 10 mM
Carbachol for 30 min at 37°C.
Endocytosis of External Ligands and 3H-Dopamine Labeling
Cells were labeled with 125I-Trn or 125I-EGF as described previously
(Blagoveshchenskaya et al., 1998a
). Removal of cell surface-bound ligands was as described in Blagoveshchenskaya et al. (1998a)
. 125I-2H11
(1 µg/ml) was internalized for 1 h at 37°C in growth medium and then cells
were placed on ice. Antibody present on the plasma membrane was removed by treatment of cells with acidic buffer (100 mM sodium acetate,
pH 4.0, and 500 mM NaCl) on ice twice for 10 min each. DCG were labeled with 3H-Dopamine as previously described (Norcott et al., 1996
).
Pulse-Chase Metabolic Labeling Experiments
PC12 cells grown on 150-mm dishes to 70% confluency were rinsed twice with methionine/cysteine-free DME supplemented with 0.5% FCS and cultivated in this medium for 30 min in the CO2-incubator. Cells were pulsed in 15 ml of methionine/cysteine-free DME containing 2 mCi of Express 35S-labeling mix and 1% FCS for 10 min at 37°C, washed with growth medium, and chased for either 20 min at 37°C or 16 h at 37°C in fresh growth medium. 35S-labeled cells were washed three times with ice-cold HSE buffer (0.25 M sucrose, 10 mM Hepes-KOH, pH 7.2, 1 mM EDTA, 2 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ ml pepstatin A) and subjected to subcellular fractionation for isolation of immature and mature DCG (see below).
Subcellular Fractionation and Quantitation of Data
Subcellular fractionation of PNS on the initial 1-16% Ficoll velocity gradients, secondary 5-25% Ficoll velocity gradients for lysosome isolation and
5-25% Glycerol velocity gradients for SLMV isolation were carried out as
described (Norcott et al., 1996
; Blagoveshchenskaya et al., 1998a
)
Calculation of Lysosomal Targeting Indexes and SLMV Targeting Indexes. Cells were fed with 125I-2H11 as described above, homogenized, and then subjected to a two-stage fractionation procedure for lysosomal isolation. Targeting data were presented as a lysosomal targeting index (LTI), i.e., the amount of 125I-2H11 radioactivity present in the lysosomal peak for each chimera normalized to that for wild-type ssHRPP-selectin. In all experiments, the LTI for wild-type ssHRPP-selectin was set at 1. To take into account variations of expression level and lysosomal yield, the amount of 125I-2H11 radioactivity present in the lysosomal peak (125I-2H11 peak) has been corrected for the amount of NAGA activity (NAGA peak) within the lysosomal fractions and for total 125I-2H11 radioactivity in the homogenate (125I-2H11 hmg). After simplifying the original equation, the LTI was defined as follows:
|
(1) |
|
(2) |
|
Secondary Sucrose Equilibrium Gradients for Separation of Late Endosomes and DCG. Those fractions (14-20) from initial 1-16% Ficoll gradients containing most 3H-Dopamine radioactivity were pooled, diluted with HB (320 mM sucrose, 10 mM Hepes-NaOH, pH 7.3), and 4 ml of this material was then layered on top of 9 ml preformed 0.9-1.85 M sucrose gradients. The gradients were centrifuged at 35,000 rpm for 20 h in a SW40Ti rotor and fractionated. The lighter peak of HRP activity containing NAGA and internalized 125I-EGF corresponds to late endosomes, while the denser peak, which overlaps with 3H-Dopamine distribution, contains the DCG (see Fig. 1 B).
|
|
(3) |
Initial 0.3-1.2 M Sucrose Velocity Gradients for Isolation of iDCG and
mDCG.
The gradient system used was that established earlier by Tooze
and Huttner (1990)
and then modified (Dittie et al., 1997
). In brief, after
three washes with ice-cold HSE buffer, cells from one 150-mm dish were
scraped in this buffer and pelleted by low-speed centrifugation at 1,000 g
for 3 min. The supernatant was discarded and cells resuspended in 2 ml of
fresh HSE buffer were then passed 10 times through a ball bearing homogenizer with 0.01-mm clearance. After centrifugation of the homogenate at 1,000 g for 10 min, 1.3 ml of PNS was layered on top of an 11-ml
preformed 0.3-1.2 M sucrose gradient made in 10 mM Hepes-KOH, pH
7.2, and centrifuged in a SW40Ti rotor for 19 min with slow acceleration
and deceleration. The gradients were then collected in 1-ml fractions from
the top of the tube.
Secondary 0.9-1.7 M Sucrose Equilibrium Gradients for Isolation of
iDCG and mDCG.
After fractionation of the initial 0.3-1.2 M sucrose gradients, the fractions containing iDCG (fractions 2-4) or mDCG (fractions 4-6) (Dittie et al., 1997
) were pooled, diluted with 10 mM Hepes-KOH, pH 7.2, to a final volume of 4 ml, and then layered on top of 9-ml preformed 0.9-1.7 M sucrose gradients made in 10 mM Hepes-KOH, pH 7.2, and recentrifuged to equilibrium for 21 h in a SW40Ti rotor. 1-ml fractions
were collected from the top of the equilibrium gradients. 200 µl of each
fraction was diluted in NDET buffer to 10 ml (final concentration: 1%
NP-40, 0.4% sodium deoxycholate, 66 mM EDTA, 10 mM Tris-HCl, pH
7.4, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ml
pepstatin A) and used for immunoprecipitation of 35S-labeled SgII. The
rest was aliquoted and used for measurement of HRP activity or for Western blotting with anti-SgII.
Immunoprecipitation, Fluorography, and Quantitation of Data
Immunoprecipitation using polyclonal anti-SgII followed by SDS-PAGE
was carried out as described previously (Cramer and Cutler, 1992
). The
gels were exposed to a PhosphorImager screen for weak
emission (Bio-Rad Laboratories) and then to x-ray film for 2 d. Quantitation of data was
performed using Molecular Analyst software (Bio-Rad Laboratories).
The distribution of unlabeled SgII across the gradients was analyzed by
Western blots of fractions followed by detection with polyclonal anti-SgII,
then with 125I-protein A and PhosphorImager exposure.
Miscellaneous Methods
N-acetyl-
-D-glucosaminidase activity was determined as described (Kornilova et al., 1992
). Protein concentration was measured using the Micro
BCA protein assay kit (Pierce) according to the manufacturer's instructions. HRP activity in the samples was determined in triplicate as previously described (Norcott et al., 1996
). HRP proteolysis, internalization
assays, and the DAB cytochemistry were carried out as described
(Blagoveshchenskaya et al., 1998a
,b).
| |
Results |
|---|
|
|
|---|
A New Two-Step Subcellular Fractionation Procedure for Separation of DCG and Late Endosomes
We set out to reexamine the determinants needed for DCG targeting of P-selectin in PC12 cells where parallel analyses of SLMV and lysosomal targeting were being carried out. To quantitatively evaluate targeting of HRP- P-selectin chimeras (see Fig. 2) to DCG at steady state conditions, we have introduced an improved subcellular fractionation protocol for DCG isolation, as illustrated in Fig. 1, because of the contamination of DCG enriched fractions by late endosomes.
The first stage of DCG isolation is a velocity centrifugation of PNS on preformed linear 1-16% Ficoll gradients as
described earlier (Cramer and Cutler, 1992
; Norcott et al.,
1996
). This procedure was originally developed to separate SLMV and DCG, but has also proved successful for
the separation of plasma membrane, multiple endosomal
compartments, and lysosomes (Blagoveshchenskaya et al.,
1998a
). To determine the position of intracellular compartments on this gradient, the distributions of 125I-Trn
(early recycling endosomes), 125I-EGF (late endosomes),
3H-Dopamine (DCG), and NAGA activity (lysosomes)
were monitored. PC12 cells transfected so as to transiently
express ssHRPP-selectin were loaded either with 3H-Dopamine, 125I-Trn, or 125I-EGF, homogenized, and a PNS was
then centrifuged on linear 1-16% Ficoll gradients. The
early endosomes containing 125I-Trn sedimented in the low
density fractions 5-10 (Figs. 1 A and 9). After binding to
the plasma membrane at 4°C, 125I-EGF was allowed to internalize for 20 min at 37°C to reach late endosomal compartments (Fig. 1 A). The distribution of 3H-Dopamine
overlaps both with 125I-EGF and partially with NAGA in
fractions 14-20 (Fig. 1 A), indicating that DCG and late
endosomes have similar sedimentation characteristics under these centrifugation conditions.
To separate late endosomes from DCG, fractions containing the majority of 3H-Dopamine radioactivity (14-20)
(Fig. 1 A) were pooled and recentrifuged on 0.9-1.85 M
sucrose gradients. The single peak of HRP activity seen on
the initial Ficoll gradient (Fig. 1 A) splits into two peaks
on the sucrose gradient (Fig. 1 B). The lighter peak of HRP activity corresponds to late endosomes since it
cosediments with NAGA and 125I-EGF internalized for
20 min at 37°C, but is devoid of 125I-Trn. Although we
have no direct evidence from these data as to whether the
HRP activity is within the same organelles which contain
NAGA and 125I-EGF, we have used a diaminobenzidine
density shift procedure to show that this is the case in
H.Ep.2 cells (Blagoveshchenskaya et al., 1998a
). The second, denser peak of HRP activity codistributes with the
single peak of 3H-Dopamine, thereby indicating the position of DCG on this gradient (Fig. 1 B). Therefore, to
quantitate targeting to DCG for each chimera, we measured the amount of HRP activity within the latter peak.
The Sequences YGVF and TNAAF, Located within the C2 Domain of the Cytoplasmic Tail, Are Necessary for Targeting of HRP-P-Selectin Chimeras to DCG
We have carried out a screen for short discrete determinants in the cytoplasmic domain that might mediate trafficking to the DCG in PC12 cells, using a series of HRP-
P-selectin chimeras (Fig. 2). Inclusion of the transmembrane
domain, as in these chimeras, has been recently shown to
increase the efficiency of targeting to DCG in neuroendocrine RIN5 cells, presumably by providing a more native
context in which the cytoplasmic domain operates (Fleming et al., 1998
). Cells expressing HRP-P-selectin chimeras
were loaded with 3H-Dopamine, homogenized, and then
the PNS was fractionated as described above. We have
monitored the targeting efficiency for each chimera by calculating a granule targeting index (GTI). Most of the chimeras with tetrapeptide substitutions show GTI similar to
that for ssHRPP-selectin (GTI = 1) (Fig. 3 B). However,
targeting to granules of ssHRPP-selectinYGVF and ssHRPP-selectinTNAAF was reduced by ~85%: 0.12 ± 0.06 (± SE) and
0.172 ± 0.1, correspondingly (Fig. 3 B).
|
YGVF resembles a typical Tyr-based sorting signal conforming to the consensus YXXø (where X is any amino
acid and ø is a bulky hydrophobic amino acid). Since Tyr is
often a critical residue within such signals (Trowbridge
et al., 1993
; Sandoval and Bakke, 1994
; Marks et al., 1997
),
we examined the contribution of Tyr777 to DCG targeting. As shown in Fig. 3 C, substitution of Tyr777 by Ala,
but not by Phe, reduced the GTI by 79%, i.e., to the level of ssHRPP-selectinYGVF, while substitution of Phe780 by Ala
did not cause a significant fall of the GTI. Therefore,
Tyr777 makes a major contribution to the promotion of
granule targeting but can be substituted by another aromatic amino acid without loss of function.
Substitution of the sequences surrounding YGVFTNAAF does not have a pronounced effect on DCG targeting. However, we have also tested the effects of grosser alterations within the C2 domain (Fig. 3 A). In agreement with the effect of tetrapeptide alanine substitutions (Fig. 3 B), removal of four carboxy-terminal amino acids (DPSP) did not affect the GTI (Fig. 3 A), whereas larger truncations including removal of TNAAF or TYGVFTNAAF reduced the GTI to levels similar to that of ssHRPP-selectinY777A. Deleting the entire C1 domain also caused the GTI to fall, implying that the spacing between YGVFTNAAF and the lipid bilayer may be important for granule targeting in PC12 cells.
ssHRPP-selectin but Not ssHRPP-selectinY777A Is Found in both Immature and Mature DCG in PC12 Cells
Although we and others have shown that when expressed
in neuroendocrine cells, P-selectin is targeted to DCG
(Disdier et al., 1992
; Green et al., 1994
; Norcott et al.,
1996
; Fleming et al., 1998
; this paper), the distribution of
this protein between iDCG and mDCG has not been determined, although current models for granule biogenesis
(Arvan and Castle, 1998
; Tooze, 1998
) imply that any protein found within mDCG will first enter the iDCG from the TGN. It is of interest to determine whether a mutant
that fails to accumulate in mDCG also fails to enter the
iDCG (i.e., sorting occurs at the level of the TGN) or is
found only in the precursor iDCG population (i.e., signal-mediated sorting is occurring during maturation of iDCG
to mDCG). To address this issue, we have adopted a well-established subcellular fractionation procedure for separation of iDCG and mDCG (Tooze and Huttner, 1990
;
Tooze et al., 1991
; Dittie et al., 1997
). PC12 cells transiently expressing wild-type HRPP-selectin were pulsed and
then chased to label iDCG or mDCG followed by fractionation as described (Materials and Methods). Fractions rich in iDCG or mDCG were collected and recentrifuged
on 0.9-1.7 M sucrose equilibrium gradients followed by
fractionation and immunoprecipitation with anti-secretogranin II (SgII, a soluble marker protein of DCG) and SDS-PAGE. The distribution on the secondary equilibrium gradient of 35S-labeled SgII shows a clear separation of iDCG
(Fig. 4 A) from mDCG (Fig. 4 B), with iDCG peaking in
fractions 7-10 and mDCG in fractions 10-13. We wished
to determine whether the HRP activity of wild-type
ssHRPP-selectin is present within these peaks. Since, this
analysis is performed at steady state conditions rather than
in pulse-chase experiments, we first examined the steady
state distribution along the gradients of the defining
marker, SgII. Western blotting (Fig. 4, C and D) shows
that even at steady state, SgII is found within those same
peaks corresponding to iDCG and mDCG as revealed by
pulse-chase experiments (Fig. 4, A and B).
|
To confirm that SgII is indeed present within functional
secretory granules, we examined the effects of secretagogue stimulation on both peaks. In agreement with previous studies (Tooze and Huttner, 1990
; Tooze et al., 1991
),
the peaks corresponding to both iDCG and mDCG diminished after carbachol treatment (Fig. 4, E and F). Having
established the distribution of the secretagogue-responsive peaks of SgII corresponding to iDCG and mDCG, we
determined the distribution of HRP-P-selectin chimeras
on the same gradients. Accordingly, PC12 cells expressing
ssHRPP-selectin were fractionated as above followed by
measurement of HRP activity across the secondary equilibrium gradients. We have also analyzed the effect of
secretagogue stimulation on distribution of HRP activity
across these gradients. Fig. 4, G and H, show that ssHRPP-selectin is present within both iDCG (fractions 7-10) and
mDCG (fractions 10-13) and that both peaks of HRP activity are responsive to secretagogue.
Since P-selectin has a more complex intracellular distribution than SgII, we expected that in addition to the DCG
peaks, there would also be HRP activity corresponding to
other organelles. Indeed, in addition to the peaks representing iDCG and mDCG, there is substantial HRP activity within a lighter peak (fractions 5 and 6; Fig. 4, G and
H). However, unlike the fall of HRP activity within iDCG
and mDCG, HRP activity in the lighter peak increases after secretagogue stimulation. Since secretagogue action
transfers ssHRPP-selectin from the DCG to the plasma membrane and thence via endosomes to SLMV (Strasser et al.,
1999
), we presume that the material in fractions 5 and 6 represents a mixture of SLMV, plasma membrane, and endosomes.
Quantitation of HRP activity revealed that 7.2% of the ssHRPP-selectin in the homogenate was recovered within the iDCG, whereas 14% was present in the mDCG. Importantly, this ratio is comparable to that for SgII recovered at steady state conditions within the iDCG and mDCG, as judged by quantitative Western blotting, 10 and 28%, respectively. Thus, when expressed in PC12 cells, ssHRPP-selectin is found in the iDCG and mDCG in a ratio similar to that of the DCG marker protein SgII.
Having established that wild-type ssHRPP-selectin is sorted to both iDCG and mDCG, we determined whether a DCG targeting mutant is present in iDCG but not in mDCG, or whether it is found in neither population. Therefore, we have examined the targeting of ssHRPP-selectinY777A to both populations of DCG. After the fractionation of PNS obtained from cells expressing ssHRPP-selectinY777A, no peaks of HRP activity within the fractions corresponding either to iDCG (fractions 7-10) or to mDCG (fractions 10-13) was detected (Fig. 4, I and J), despite the presence of HRP activity in the lighter peak (fractions 5-6) as for ssHRPP-selectin. Moreover, secretagogue stimulation did not cause an increase of HRP activity within the light membrane peak, confirming that ssHRPP-selectinY777A is not sorted to either population of DCG. These data strongly suggest that Tyr777-dependent sorting of HRP-P-selectin chimeras to iDCG occurs at the level of the TGN.
Leu768 within the C1 Domain, as Well as Multiple Determinants within the C2 Domain, Mediate Targeting of HRP-P-Selectin Chimeras to SLMV
Previously, we have demonstrated that HRP-P-selectin
chimeras are efficiently transported to SLMV in PC12
cells (Norcott et al., 1996
). We have now determined in
detail the sequence(s) within the cytoplasmic domain of
P-selectin that are needed for trafficking to SLMV, exploiting a glycerol gradient fractionation scheme (Norcott et
al., 1996
; Clift-O'Grady et al., 1998
). We have previously determined that >90% of ssHRPP-selectin from the SLMV
peak on glycerol gradients could be immunoisolated using
an antibody to the cytoplasmic domain of p38/synaptophysin (Norcott et al., 1996
). Whereas both p38 and
ssHRPP-selectin are present within the SLMV peak on this
type of gradient, these fractions are completely devoid of
125I-Trn, thus confirming that the SLMV peak is free from
endosomal recycling vesicles (Fig. 5).
After expression of the HRP-P-selectin chimeras in
PC12 cells and subcellular fractionation on glycerol gradients, a SLMV targeting index (SLMV-TI) was calculated
for each chimera (Fig. 6). Within the C1 domain, substitution of KCPL reduced SLMV targeting by 80% (0.204 ± 0.05) compared with the SLMV-TI of ssHRPP-selectin (Fig. 6
B). Analysis of single amino acid substitutions across KCPL reveals that replacement of Leu768 with Ala resulted in a similar reduction of SLMV targeting (0.23 ± 0.01) (Fig. 6 C), suggesting that Leu768 within KCPL is required for SLMV targeting. In contrast to the C1 domain,
most tetrapeptide substitutions within the C2 domain reduced targeting to SLMV to some degree. In the most dramatic of these, the SLMV-TI for ssHRPP-selectinYGVF was as
low as that for tail-less ssHRPP-selectin763 (SLMV-TI = 0),
which was found to accumulate at the plasma membrane (Norcott et al., 1996
). Analysis of point mutations within
YGVF indicates that Tyr777 makes a major contribution
to SLMV targeting and that this residue is tolerant of substitution by another aromatic amino acid (Fig. 6 C) suggesting that, in at least this respect, targeting to both RSO
is mediated by the same determinant. Substitution or deletion of DPSP (ssHRPP-selectinDPSP and ssHRPP-selectin786) reduced SLMV targeting by ~75% (0.25 ± 0.05 and 0.27 ± 0.055, respectively). Altering the sequence between DPSP
and YGVF, as seen with ssHRPP-selectinTNAAF, revealed a
less severe phenotype (0.43 ± 0.108). Deletions of the C1
or C2 domains, or of the nine carboxy-terminal amino
acids (ssHRPP-selectin
C1, ssHRPP-selectin776, and ssHRPP-selectin782, respectively) also dramatically inhibited SLMV
targeting (Fig. 6 A).
|
Lysosomal Targeting of HRP-P-Selectin Chimeras in PC12 Cells
When expressed in several cell lines, including PC12 cells,
a substantial proportion of newly synthesized P-selectin is
constitutively transported to the plasma membrane and
then efficiently endocytosed to lysosomes for degradation (Green et al., 1994
; Setiadi et al., 1995
; Blagoveshchenskaya et al., 1998a
,b; Straley et al., 1998
). Findings of
cell type-specific variations (Blagoveshchenskaya et al.,
1998a
,b; Straley et al., 1998
) encouraged us to analyze lysosomal targeting in PC12 cells. We have previously established two assays that allow for quantification of lysosomal
targeting of HRP chimeras. The first, an HRP proteolysis
assay, reveals exposure of chimeras to intracellular proteolytic activity under steady state conditions in living
cells. The second assay uses sequential Ficoll velocity gradients for the isolation of lysosomal compartments allowing for calculation of lysosomal targeting indexes (LTI;
Blagoveshchenskaya et al., 1998a
,b).
As measured by HRP proteolysis, substitution of KCPL within the C1 domain dramatically reduced HRP clipping to 1.43 ± 1.08%, as compared with the average for ssHRPP-selectin which was 16 ± 2% (Fig. 7 A). Chimeras in which other sequences within the C1 domain have been substituted, i.e., ssHRPP-selectinKDDG and ssHRPP-selectinNPHS, were proteolyzed as efficiently as ssHRPP-selectin. Analysis of point mutations across KCPL revealed that as for SLMV targeting, Leu768 also operates to promote lysosomal targeting (Fig. 7 B).
|
In contrast, two mutations of the C2 domain, ssHRPP-selectinYGVF and ssHRPP-selectinDPSP, exhibited a significant increase in HRP proteolysis, up to 45 ± 5% and 35 ± 6% compared with 16 ± 2% for the wild-type chimera. Tyr777, a critical residue within YGVF for targeting to DCG and SLMV, was also found to be an important residue in preventing lysosomal targeting, since when substituted by Ala but not by Phe, it caused increased HRP clipping of 32 ± 4.4% (Fig. 7 B).
HRP-P-Selectin Chimeras which Are Not Targeted to RSO Are Redirected to Lysosomes via the Plasma Membrane
The analysis of targeting to lysosomes described above was performed under steady state conditions and does not answer the question of whether chimeras pass exclusively via the plasma membrane to lysosomes or are transported directly from the TGN. This is an important point to establish, since a direct route from the TGN to the lysosomes might bypass the compartment from which SLMV bud, thus leading to a misinterpretation of the SLMV targeting data. Therefore, we determined the efficiency of delivery of internalized 125I-2H11 from the plasma membrane to lysosomes using the fractionation procedure designed for isolation of lysosomal compartments.
After a 1-h uptake of 125I-2H11 at 37°C, 11% of 125I-2H11 radioactivity was present in the lysosomal peak of cells expressing ssHRPP-selectin (Fig. 8 B). However, only 2.8% of the 125I-2H11 intracellular radioactivity was detected in the lysosomal peak from cells expressing ssHRPP-selectin763 (Fig. 8 B). If most ssHRPP-selectin transfers to lysosomes directly from the TGN, then the amount of 125I-2H11 recovered in the lysosomal peak should have been as low as that for ssHRPP-selectin763 which is clearly not the case. This suggests that the ssHRPP-selectin that is not sorted to DCG and SLMV is delivered to lysosomes via the plasma membrane. To ascertain whether those chimeras that exhibit the greatest differences in lysosomal targeting also travel via the plasma membrane, we have calculated LTI by 125I-2H11 uptake for each chimera. The LTI for ssHRPP-selectinYGVF and ssHRPP-selectinDPSP exceeded those for ssHRPP-selectin implying that these mutant chimeras are indeed targeted to lysosomes via the plasma membrane (Fig. 8 C). ssHRPP-selectinL768A, which was incapable of targeting to lysosomes, as measured by HRP proteolysis (Fig. 7 B), is not detected in lysosomal fractions as seen by 125I-2H11 uptake either, indicating that the results obtained by either assay are consistent.
|
ssHRP P-selectinL768A Accumulates within 125I-Trn-containing Endosomes
As shown above, Leu768 was found to promote lysosomal
targeting of HRP-P-selectin chimeras in PC12 cells. Mutation of this amino acid might act either by blocking exit
from the endosomes or by affecting internalization from
the plasma membrane. Since the internalization rate for
ssHRPP-selectinL768A is 75% of that of wild-type ssHRPP-selectin
(see Table II), the latter was not the case. To determine
whether ssHRPP-selectinL768A accumulates within Trn-containing endosomes, we have exploited a DAB density shift
procedure. DAB cross-linking in the presence of H2O2 results in an increase in density of the vulcanized HRP-containing organelles, as seen by subcellular fractionation.
PC12 cells transfected so as to transiently express ssHRPTrnR(tail
) (a chimera between HRP and an amino-terminally truncated TrnR, which is incapable of internalization and therefore accumulates on the plasma membrane,
Stinchcombe et al., 1995
), ssHRPP-selectin, or ssHRPP-selectinL768A were analyzed for their ability to shift 125I-Trn using a DAB-reaction protocol. As shown in Fig. 9
and quantitated in Table I, in control cells expressing
ssHRPTrnR(tail
) only 8% of the 125I-Trn was shifted (Fig. 9
A). We consider this value to be a basal level, representing signal-independent traffic through the endosomes. It
should be noted that DAB shift percentages (Table I) do
not measure absolute amounts of chimera within the Trn-containing endosomes since the procedure was performed
on transiently expressing cells. They provide comparative
data showing differences in the levels of colocalization between different HRP chimeras and 125I-Trn. ssHRPP-selectin
demonstrated higher colocalization with 125I-Trn than
ssHRPTrnR(tail
), shifting 13% of the original radioactivity.
However, in cells expressing ssHRPP-selectinL768A, the
shift was 27%, suggesting that this chimera is concentrated within early Trn-containing endosomes and indicating that Leu768 operates at the level of Trn-positive endosomes to mediate transfer to SLMV and to lysosomes.
|
|
|
DCG, SLMV, and Lysosomal Targeting Determinants Do Not Mediate the Internalization of HRP-P-Selectin Chimeras
Some of the variations in targeting to post-Golgi destinations might be attributable to alterations in internalization
rates, as demonstrated for VAMPII (Grote and Kelly,
1996
). Therefore, we have measured internalization rates
for ssHRPP-selectin, ssHRPP-selectin763, ssHRPP-selectinYGVF,
ssHRPP-selectinTNAAF, ssHRPP-selectinDPSP, and ssHRPP-selectinL768A using a cell surface biotinylation procedure
(Blagoveshchenskaya et al., 1998b
). First order internalization rates were calculated from data obtained during
the first 4 min of endocytosis at 37°C and expressed as
%/min (Table II). In agreement with previous studies
(Norcott et al., 1996
; Blagoveshchenskaya et al., 1998b
), ssHRPP-selectin763 was internalized ~10-fold less efficiently
than ssHRPP-selectin. Partial inhibition of endocytosis (by
40%) was observed for ssHRPP-selectinDPSP, while the other
chimeras revealed smaller reductions. These data strongly
suggest that RSO and lysosomal targeting signals operate
independently of internalization from plasma membrane.
Targeting of HRP-P-Selectin Chimeras to SLMV Is a BFA-sensitive Process
Recent data from Shi et al. (1998)
have indicated that targeting of VAMPII to SLMV in PC12 cells can occur by
two pathways: either directly from the plasma membrane
or from endosomes. The former route is thought to be
AP2, clathrin, and dynamin dependent and is BFA insensitive, whereas the latter is AP3 and adenosine ribosylation factor (ARF) 1 mediated and is BFA sensitive (Shi et
al., 1998
). Our data presented above (Figs. 6 and 7) suggest the involvement of an endosomal intermediate en
route to SLMV, since both SLMV and lysosomal targeting
are dependent on Leu768. To provide further support for
this hypothesis, we have examined the BFA sensitivity of
SLMV targeting for wild-type HRPP-selectin. Fig. 10 A
shows that BFA treatment resulted in an 88% reduction of
the HRP activity recovered within the SLMV peak. The
magnitude of this effect is similar to the 77% reduction in
SLMV targeting found for ssHRPP-selectinL768A (Fig. 6).
This strongly suggests that HRP-P-selectin chimeras are passing to SLMV via an endosomal intermediate. As a
control, we analyzed levels of the endogenous SLMV
membrane protein synaptophysin/p38 in those same
SLMV peaks in which HRP activity was measured (Fig. 10
A). As shown in Fig. 10 B, levels of p38 in the SLMV
peaks from BFA-treated and untreated cells were identical, confirming the observation of Schmidt et al. (1997)
that
p38 is sorted to the SLMV from a plasma membrane-
derived subcompartment and that this process is therefore
BFA insensitive.
|
| |
Discussion |
|---|
|
|
|---|
In this work, we have explored the relationships between trafficking to SLMV, DCG, and lysosomes in PC12 cells, by characterizing the targeting signals of P-selectin, which is localized to all three organelles in this cell line. We have used quantitative measures of the targeting of a series of HRP-P-selectin chimeras to identify the sequences needed for delivery to a variety of destinations. In summary of our results (Fig. 11), we conclude that: (a) While a Tyr-based motif within the cytoplasmic domain is critical for trafficking of HRP-P-selectin to both DCG and SLMV, additional determinants are required to direct this protein to SLMV. (b) There is an overlap between trafficking routes to SLMV and to lysosomes, since Leu768 is essential in exiting from the Trn-positive endosomes for subsequent transfer to either of these organelles. (c) There are complex relationships between targeting to RSO and to lysosomes, since reduction of SLMV or DCG targeting results in a corresponding rise in lysosomal delivery but does not affect delivery to the alternative RSO.
|
Targeting to Granules
We have discovered that alanine substitution of two short colinear determinants located within the C2 domain of the cytoplasmic tail, YGVF and TNAAF, causes a considerable reduction in targeting to the DCG in PC12 cells. HRP-P-selectin chimeras in which these sequences are substituted by Ala were targeted to DCG at levels only 10% above that found for the tail-less ssHRPP-selectin763. Analysis of chimeras in which sequences on either side of YGVFTNAAF are deleted shows that removal of the four-amino acid sequence at the carboxy side did not affect DCG targeting. Deleting the C1 domain reduced DCG targeting to basal levels, suggesting that the spacing of YGVF and TNAAF from a lipid bilayer is important for the proper functioning of DCG targeting determinants.
When carboxy-terminal deletions are extended to remove first TNAAF and then both TNAAF and YGVF, we
do not find an additive inhibition of DCG targeting, since
removal of TNAAF alone (ssHRPP-selectin782) caused the
same reduction as removal of YGVFTNAAF (ssHRPP-selectin776). In addition, while TNAAF does not reveal homology to other sorting signals known to promote targeting to different post-Golgi destinations, YGVF is similar
to other Tyr-based signals (Trowbridge et al., 1993
; Sandoval and Bakke, 1994
; Marks et al., 1997
). We have found
that Tyr777 is important for YGVF to function and is tolerant of conservative replacement with another aromatic
amino acid (Fig. 3). Therefore, we speculate that Tyr777
plays a major role within the targeting determinant, while
TNAAF may make a local structural contribution to its function.
Our results on identification of DCG targeting determinants within P-selectin partly agree with those obtained in
the anterior pituitary line AtT-20 by Modderman et al.
(1998)
. These authors found that Leu768/Asn769 within
the C1 domain, as well as Tyr777, Gly778, and Phe780
within the C2 domain, are needed for DCG targeting in
AtT-20 cells. Interestingly, the Leu768/Asn769 DCG determinant in AtT-20 cells overlaps with that (Leu768)
which functions as a lysosomal targeting signal in both
PC12 and NRK cells (this paper and Straley et al., 1998
),
but has no effect on DCG targeting in PC12 cells. One
plausible explanation for this apparent discrepancy is that
a recycling route leading to DCG via plasma membrane
and endosomal intermediates is more important in AtT-20
than in PC12 cells for maintaining steady state levels of
proteins within the granule membrane. If so, then this
would explain why mutation of Leu768, which leads to an
accumulation of P-selectin within the early Trn-containing
endosomes, reduces levels of the protein in the DCG
within AtT-20 cells, but not in PC12 cells.
The DCG targeting determinants found in P-selectin do
not reveal any homology to the DCG targeting signal
identified in VAMPII (Regazzi et al., 1996
). Our finding
that a Tyr-based sequence promotes DCG targeting was
unexpected; Tyr-based motifs are generally thought to be
involved in the recruitment of adaptors followed by the
binding of clathrin and are therefore concerned with selection for entry into small vesicles. This is difficult to reconcile with a simple model for entry of membrane proteins
into forming granules in which sorting in the plane of the
membrane precedes budding of an iDCG from the TGN.
The role of clathrin and AP1 during subsequent maturation of forming granules is thought to be in the removal via
small vesicles of proteins like furin and M6PR that are
present in immature but not mature granules (reviewed in
Tooze, 1998
; Arvan and Castle, 1998
). Our data show that
the ratio of relative levels of HRP-P-selectin within iDCG
(7.2%) and mDCG (14%) is similar to that found for SgII
(10 and 28%, respectively). Therefore, we conclude that
Tyr 777 promotes sorting to DCG at the level of the TGN
since ssHRPP-selectinY777A was not found in either population of DCG (Fig. 4).
These data lead us to suggest an alternative mechanism
used in delivery of membrane proteins to this RSO. We
speculate that coats might be involved as planar matrices
(Miller et al., 1991
) in concentrating proteins within the
TGN into "rafts" (microdomains consisting of distinct proteins and lipids found in various membrane compartments;
for review see Brown and London, 1998
; Thiele and Huttner, 1998
; Zegers and Hoekstra, 1998
) that could interact with the forming dense core, thus driving granule formation in a process analogous to virus budding. However, until now, this mechanism of sorting at the level of the TGN
has only been demonstrated for transmembrane proteins
that are involved in apical transport in epithelial cells
(Keller and Simons, 1998
). A contribution of the transmembrane domain of P-selectin to the formation of DCG
(Fleming et al., 1998
) would be consistent with the raft
model, since the transmembrane domain might facilitate
the inclusion of protein within such a raft. Although AP1
and clathrin have not yet been shown to be directly involved in granule formation in the TGN in vivo, in vitro
granule budding assays have documented a role for ARF1
(which is implicated in recruitment of AP1 and clathrin to
the TGN) in promoting the formation of DCG (Stamnes and Rothman, 1993
; Barr and Huttner, 1996
; Chen and
Shields, 1996
). Currently, granule formation is very poorly
understood, but a role for cytoplasmic factors, as well as
interactions between the core and the lumenal domains of
membrane proteins, clearly must be included in models of
granule biogenesis.
Targeting to Lysosomes
In this study, we show that KCPL mediates sorting from early Trn-containing endosomes to late endosomes and lysosomes in PC12 cells. Detailed site-directed mutagenesis revealed that Leu768 within this tetrapeptide promotes lysosomal targeting, i.e., operates as a positive lysosomal targeting signal in PC12 cells (Figs. 7 and 8). Substitution of Leu768 caused the retention of this mutant chimera within Trn-positive endosomes as seen by colocalization with 125I-Trn using a DAB-shift procedure (Fig. 9 and Table I).
In addition, some tetra-alanine substitutions within the
C2 domain, most notably, YGVF and DPSP, have been
found to increase delivery to protease-rich compartments
in PC12 cells. This strongly suggests that YGVF and DPSP
operate as lysosome avoidance signals at late stages of endocytosis (Figs. 7 and 8), in agreement with results that we
obtained previously in H.Ep.2 cells using double mutants
(Blagoveshchenskaya et al., 1998b
).
Targeting to SLMV
To date, very little is known about the sequences needed
for targeting to SLMV. The only protein within which such
signals have been characterized in detail is VAMPII, in
which an amphipathic
-helix was found to be a necessary requirement for SLMV targeting in PC12 cells (Grote
et al., 1995
). However, the SLMV targeting signal in
VAMPII was later found to be required for endocytosis from plasma membrane implying that internalization
and SLMV targeting are controlled by the same signal
(Grote and Kelly, 1996
). By contrast, our results show that
in HRP-P-selectin chimeras, determinants located in both
the C1 and C2 domains are implicated in targeting to
SLMV regardless of internalization (Fig. 6 and Table II).
Within the C1 domain, KCPL and, in particular, Leu768
are necessary requirements for SLMV targeting (Fig. 6).
In addition, most sequences within the C2 domain; YGVF
(in particular, Tyr777), as well as DPSP and, to a lesser
extent, TNAAF, are needed for SLMV targeting (Fig. 6). Thus, the trafficking of HRP-P-selectin chimeras to
SLMV is controlled by multiple signals located in different
portions of the cytoplasmic tail.
SLMV versus Lysosomal Targeting
An important consideration in understanding SLMV biogenesis is how the signal-mediated trafficking steps en route to SLMV operate with respect to those en route to other post-Golgi destinations, such as lysosomes and DCG. We have discovered that Leu768 is needed for both SLMV and lysosomal targeting. Since substi