|
||
Department of Physiology, University of Michigan, Ann Arbor, Michigan 48109-0622
| |
Abstract |
|---|
|
|
|---|
Sarcomere maintenance, the continual process of replacement of contractile proteins of the myofilament lattice with newly synthesized proteins, in fully differentiated contractile cells is not well understood. Adenoviral-mediated gene transfer of epitope-tagged tropomyosin (Tm) and troponin I (TnI) into adult cardiac myocytes in vitro along with confocal microscopy was used to examine the incorporation of these newly synthesized proteins into myofilaments of a fully differentiated contractile cell. The expression of epitope-tagged TnI resulted in greater replacement of the endogenous TnI than the replacement of the endogenous Tm with the expressed epitope-tagged Tm suggesting that the rates of myofilament replacement are limited by the turnover of the myofilament bound protein. Interestingly, while TnI was first detected in cardiac sarcomeres along the entire length of the thin filament, the epitope-tagged Tm preferentially replaced Tm at the pointed end of the thin filament. These results support a model for sarcomeric maintenance in fully differentiated cardiac myocytes where (a) as myofilament proteins turnover within the cell they are rapidly exchanged with newly synthesized proteins, and (b) the nature of replacement of myofilament proteins (ordered or stochastic) is protein specific, primarily affected by the structural properties of the myofilament proteins, and may have important functional consequences.
Key words: muscle proteins; tropomyosin; troponin; cardiomyocyte; muscle structure| |
Introduction |
|---|
|
|
|---|
THE muscle sarcomere is a complex three-dimensional array of contractile and regulatory proteins
designed to produce both force and motion. It has
been well appreciated that during myofibrillogenesis, in
embryonic and neonatal muscle cells, the contractile apparatus is very dynamic with coordinate alterations in myofilament gene expression, myofilament protein synthesis/
degradation, and structural incorporation and organization (Rhee et al., 1994
; Schiaffino and Reggiani, 1996
;
Auerbach et al., 1997
; Dabiri et al., 1997
). However, in
fully differentiated, post-mitotic contractile cells, it is important that the contractile apparatus is also dynamic. Under these conditions, the myofilament proteins that make
up this contractile apparatus are in a requisite dynamic
equilibrium involving mechanisms of incorporating newly
synthesized contractile proteins as well as degradation
processes that remove old and possibly damaged proteins.
In a global sense, myofilament protein turnover in adult
muscle cells is well documented. Metabolic labeling studies have indicated that the half-lives of the major contractile proteins in the adult rat heart vary from ~3 d for
troponin I (TnI)1, 5 d for tropomyosin (Tm) and myosin,
and up to 10 d for sarcomeric actin (Martin, 1981
), which
suggests that individual contractile proteins may turn over
by different mechanisms. Interestingly, in adult cardiac
myocytes, this dynamic process of synthesizing and replacing the myofilament proteins of the contractile apparatus is complicated by the fact that these cells must accomplish
this feat while maintaining force production at rates of 70-
200 beats per minute in humans and up to 600-700 beats
per minute in small rodents. This mechanism of sarcomere
maintenance, collectively defined as the processes of myofilament protein synthesis, incorporation, and degradation, in fully differentiated muscle cells, including adult
cardiac myocytes, is not well understood.
There have been several approaches to studying the
protein dynamics of the contractile apparatus. These approaches have made important advances in understanding
the mechanisms of synthesizing new myofibrils, or myofibrillogenesis. The formation of new myofibrils in embryonic and neonatal cardiac myocytes has been visualized by fluorescence imaging using isoform-specific, myofilament protein antibodies as well as microinjection of fluorescently labeled contractile proteins. These studies have
shown the requirement of precise regulation of myofilament protein gene expression and ordered integration of
specific myofilament proteins into the contractile apparatus (Dlugosz et al., 1984
; Sanger et al., 1986
; Wang et al.,
1988
; Rhee et al., 1994
). More recently, transfection techniques have been used to express recombinant epitope-tagged myofilament proteins in neonatal cardiac myocytes
in vitro (von Arx et al., 1995
; Auerbach et al., 1997
; Dabiri
et al., 1997
). This, along with high resolution imaging techniques, has allowed for visualization of myofibrillogenesis,
and mechanisms of myofilament protein isoform sorting in
differentiating cardiac myocytes.
Application of these types of studies to adult cardiac
myocytes, in order to understand how sarcomere maintenance occurs in the context of a fully differentiated cell,
has been limited by several factors. First, adult cardiac
myocytes are inherently unstable in primary culture. Adult
cardiac myocytes maintained in the presence of fetal bovine serum undergo a complex process of cytoskeletal
rearrangements along with myofilament degeneration and regeneration (Jacobson, 1977
; Moses and Claycomb,
1982a
,b; Eppenberger et al., 1988
; Messerli et al., 1993
)
and reexpression of neonatal myofilament protein isoforms (Eppenberger et al., 1988
). Although studies using
microinjection of expression plasmids containing cDNAs
encoding epitope-tagged myofilament proteins in serum-treated, redifferentiating adult cardiac myocyte cultures have been important in understanding the trafficking of
some myofilament proteins to the cardiac sarcomere (Soldati and Perriard, 1991
; von Arx et al., 1995
), the processes
of myofilament protein synthesis and incorporation visualized in these studies more closely resemble myofibrillogenesis in embryonic and neonatal cardiac myocytes (Eppenberger et al., 1988
; LoRusso et al., 1997
) rather than
sarcomere maintenance in adult cardiac myocytes. Second, standard transfection techniques are extremely inefficient and toxic to fully differentiated adult cardiac myocytes (Rust et al., 1998
). There have been a few studies
that have applied microinjection of mg/ml solutions of fluorescently labeled myofilament proteins into intact, fully differentiated muscle cells or bathing permeabilized muscle fibers in solutions of fluorescently labeled myofilament
proteins (Sanger et al., 1984
; Dome et al., 1988
; LoRusso
et al., 1992
; Imanaka-Yoshida et al., 1993
). These studies
have been important in localizing specific myofilament
proteins in the adult cardiac sarcomere and suggest that
the contractile apparatus is capable of rapidly incorporating exogenous myofilament proteins (seconds to minutes).
However, these studies are limited in that they do not
measure sarcomere maintenance under normal physiological conditions of myofilament protein transcription and
translation while maintaining proper protein stoichiometry and contractile function, processes that occur over several days to weeks.
As a new approach to genetically modify the cardiac sarcomere, recombinant adenoviral vectors have been used
to express reporter proteins and myofilament proteins in
fully differentiated rat adult cardiac myocytes in vitro
while maintaining the normal myofilament protein stoichiometry, adult contractile protein isoform expression, and
physiological force production of the myocytes over 6-7 d in primary culture (Westfall et al., 1997
, 1998
; Rust et al.
1998
). In this study, adenoviral-mediated gene transfer
was used to express recombinant, epitope-tagged Tm and
TnI proteins in adult cardiac myocytes in vitro to visualize
the process of thin filament sarcomere maintenance in
fully differentiated adult cardiac myocytes. Cardiac TnI
and
Tm are key thin filament regulatory proteins of the
adult cardiac contractile apparatus. TnI, a subunit of the
troponin regulatory complex, and Tm, both bind to actin
and regulate myosin crossbridge binding to actin in
response to changes in intracellular [Ca2+] (Tobacman,
1996
). More importantly for the studies presented here,
these two proteins could also differ structurally in how they assemble on the contractile apparatus. TnI forms a
trimeric complex with the Ca2+-binding subunit, troponin
C, and the Tm-binding subunit, troponin T, and this complex is bound to Tm and actin at a spacing of 1 per 7 actin
monomers (Tobacman, 1996
). In contrast, Tm forms a dimer with itself, binds to 7 actin monomers, and forms a
head to tail polymer of 24 Tm proteins along the entire
1-µm length of the thin filament (Trombitas et al., 1990;
Tobacman, 1996
). Because cTnI and
Tm also have different measured half lives in the adult rat heart, we hypothesized that these two proteins might display different mechanisms of myofilament incorporation and therefore may
provide two distinct tools for studying sarcomere maintenance.
Using this approach of gene transfer of epitope-tagged myofilament proteins into adult cardiac myocytes in vitro, along with high resolution imaging techniques, it is possible to address several fundamental questions concerning how sarcomere maintenance in adult muscle cells occurs such as: (a) Where do newly synthesized myofilament proteins incorporate into the cardiac sarcomere, i.e., is the process stochastic or ordered? (b) Is myofilament replacement uniform throughout the cell or localized to specific cellular regions? (c) Are all myofilament proteins replaced in the same manner? (d) Does sarcomere maintenance occur by complete breakdown of old thin filaments and formation of new thin filaments? By addressing these fundamental questions, this study shed new light on the mechanisms underlying how sarcomere maintenance can occur in adult cardiac myocytes while maintaining the continual ability of the cell to produce both force and motion.
| |
Materials and Methods |
|---|
|
|
|---|
Generation of Recombinant Adenovirus
The plasmid vector containing the full-length human fast skeletal
Tm
was a gracious gift from Dr. Clare Gooding (MacLeod and Gooding, 1988
).
An EcoRI fragment containing the full-length
Tm cDNA was subcloned
into pCA4 plasmid to add additional restriction enzyme sites for future
subcloning (Westfall et al., 1997
, 1998
). A XbaI, HindIII fragment containing the full-length
Tm cDNA was subcloned into pSP72 (Promega)
for mutagenesis. The COOH-terminal FLAG epitope (DYKDDDDK)
(Sigma) was engineered by PCR mutagenesis using the following primer
set to amplify a 204-bp fragment: forward primer 5' AGAGATCAAGGTCCTTTCCG 3' and reverse primer 5' GAAGTGAAGCT*T*AGAAACTTACTTGTCGTCATCGTCTTTGTAGTCTATGGAAGTCA-TATCGTTGAGAG 3' (underline indicates FLAG epitope sequence). A
HindIII site (asterisks) was engineered into the reverse primer to facilitate
subcloning. A Ppu M1, HindIII fragment of the PCR product was ligated
to the Ppu M1 site in the
Tm cDNA and the
TmFLAG cDNA was verified by DNA sequencing. This subcloning step removed 197 bp of 3' untranslated sequence. The XbaI, HindIII fragment containing the
TmFLAG cDNA was subcloned into pCA4 (pCA4
TmFLAG). The plasmid
(pGEM3ZcTnI) containing the full-length cardiac troponin I cDNA was
a gracious gift from Dr. Anne Murphy (Murphy et al., 1991
). A COOH-terminal FLAG epitope was added by PCR mutagenesis using the
following primer sets: forward primer 5' GCCAAGGAATCCTTGGACCTGAGGG 3' and reverse primer 5' CAGTGTGAGAGCCATGGCTCACTTGTCGTCATCGTCTTTGTAGTCGCCCTCG*AACTTTTT-
CTTTCGGCC 3' (underline indicates FLAG epitope sequence). An
XmnI site (asterisk) was engineered in the reverse primer to identify the
mutagenized clones. An ApaI, NcoI fragment of the PCR product was
subcloned into pGEM3ZcTNI and the resulting cTNIFLAG cDNA was
verified by DNA sequencing. An EcoRI fragment containing the cTNIFLAG cDNA was subcloned into pCA4 (pCA4cTNIFLAG).
Replication-deficient recombinant adenovirus (Ad5
E1) vectors were
constructed from the cotransfection shuttle vectors pCA4
TmFLAG or
pCA4cTnIFLAG with a vector containing the full-length adenoviral genome, pJM17 followed by homologous recombination in HEK-293 cells as
previously described (Westfall et al., 1998
). Positive viral lysates were
plaque purified and identified by restriction enzyme Southern blot analysis. The viruses were grown to high titer in HEK-293 cells, purified by
CsCl centrifugation and the viral stocks (~1010 pfu/ml) were stored in single use aliquots at
80°C.
Adult Cardiac Myocyte Culture and Gene Transfer
Adult rat ventricular myocytes were isolated and cultured as previously
described (Westfall et al., 1998
). In brief, female adult rats (~200 g) were
anesthetized with sodium pentobarbitol and the hearts were removed in
Krebs-Henseleit buffer containing 1 mM Ca2+ (KHB+Ca2+). The hearts
were perfused for 5 min with KHB+Ca2+ on a Langendorff perfusion apparatus followed by a 5-min perfusion with KHB, Ca2+-free (7-10 ml/
min). Collagenase (162 U/ml; Worthington, Type II) and hyaluronidase
(0.125 mg/ml; Sigma) were then added to Ca2+-free KHB and perfusion
continued for 15 min. CaCl2 was then added to a final concentration of 1 mM
and perfusion continued for 10-15 min. The ventricles were then minced
and digested in the enzyme solution for 2× 10 min. The tissue was then digested for 2× 15 min with gentle trituration and isolated myocytes were
collected by centrifugation. The myocytes were resuspended in KHB+1
mM Ca2+ and 2% BSA and the solution was titrated to 1.75 mM Ca2+
with three additions of CaCl2 over 15 min. The resulting myocytes were
collected by centrifugation and resuspended in DME, 5% FBS, 1% penicillin/streptomycin (P/S) (GIBCO BRL), and plated on laminin coated
glass coverslips (1 × 105 cells/ml, 200 µl/coverslip) for 2 h. The myocytes
were then infected with recombinant adenovirus diluted in 200 µl serum-free DME with P/S at 2.5-5 × 107 pfu/ml or a multiplicity of infection (MOI) of 250-500, for 1 h.
Culture Conditions
After gene transfer, 2 ml serum-free DME with P/S was then added, and for the standard culture conditions, myocytes were maintained (media changed every 48 h) in serum-free DME with P/S unless otherwise indicated. In a subset of experiments (see Fig. 4), in order to generate cultures of redifferentiating adult cardiac myocytes, myocytes were maintained in DME, 20% FBS, P/S from 12 h post infection to the end of time in culture.
|
Protein Gel Electrophoresis and Western Blotting
Intact myocyte samples were prepared by scraping myocytes from coverslips into SDS sample buffer. Permeabilized myocyte samples were prepared by exposing the myocytes on coverslips to relaxing buffer (see below) containing 0.1% Triton X-100 for 3-5 s followed by two washes in
3-4 ml of relaxing buffer. The remaining permeabilized myocytes were
scraped into SDS sample buffer. The samples were immediately boiled for
5 min, an equal volume of SDS sample buffer was added, and the samples
were stored at
20°C. The protein samples were analyzed on 12% SDS-PAGE followed by transfer to Immobilon-P PVDF membrane (Millipore) for 2,000 V· hr. The membranes were blocked overnight in TBS containing 5% nonfat dry milk. The primary antibodies used for detection of
myofilament proteins were as follows: Tm, Tm311, 1:100,000 (Sigma); TnI,
MAB1691, 1:1,000 (Chemicon); troponin T, JLT-12, 1:1,000 (Sigma); anti-FLAG M2, 1:2,000 (Sigma); sarcomeric actin, clone 5C5, 1:5,000 (Sigma).
Primary antibody binding was detected with a goat anti-mouse IgG-
horseradish peroxidase conjugate followed by ECL detection (Amersham). The films were digitized using a transparency scanner and quantitated with Multi-Analyst software (Bio Rad Laboratories). To calculate
Tm stoichiometry and to compare the ratios of different myofilament proteins using multiple blots with different exposure times, the ratio of Tm/ actin data was normalized to the mean ratio in the control myocyte samples on each blot ((Tm:actin)sample / (Tm:actin)mean control).
Indirect Immunofluorescence and Confocal Microscopy
Cardiac myocytes were prepared for confocal imaging as previously described (Westfall et al., 1998
) In brief, cardiac myocytes on coverslips
were fixed in 3% paraformaldehyde/PBS for 30 min. Myocytes were
washed 3× 5 min in PBS and incubated in PBS with 50 mM NH4Cl for 30 min followed by washing 3× 5 min in PBS. Myocytes were blocked with
20% NGS in PBS + 0.5% Triton X-100 for 30 min followed by incubation
with primary antibody (Ab) for the FLAG epitope (M2, 1:500), sarcomeric Tm (CH-1, 1:200; Sigma), or TnI (MAB1691, 1:500) diluted in 2%
NGS, PBS + Triton X-100) for 1.5 h. Myocytes were washed 3× 5 min in
PBS + Triton X-100 and blocked again for 30 min. Myocytes were incubated with secondary Ab (goat anti-mouse IgG, Texas Red, 1:100; Molecular Probes) for 1 h followed by washing 3× 5 min in PBS + Triton X-100.
The IgG Ab sites were neutralized overnight with excess whole goat anti-
mouse IgG (1:20; Sigma) and followed by neutralization with goat anti-
mouse IgG Fab (1:20; Jackson) for 2 h. The second set of Ab incubations were performed as indicated above with anti-
-actinin (EA53, 1:500; Sigma) followed by a goat anti-mouse IgG FITC conjugate (1:200; Sigma). Coverslips were mounted and stored at
80°C. Immunofluorescence was visualized in dual channel mode on a Nikon Diaphot 200 microscope equipped with a Noran confocal laser scanning imaging system and Silicon Graphics Indy workstation and colorized with Adobe Photoshop software. A Leitz Aristoplan fluorescence microscope was used for data
presented in Fig. 4.
Cardiac Myocyte Functional Analysis
Cardiac myocyte contractile function was performed on adult cardiac
myocytes maintained in serum free media as previously described
(Metzger et al., 1993
; Westfall et al., 1997
).
Solutions.
Relaxing and activating solutions contained in mmol/liter: 7 EGTA, 1 free Mg2+, 4 MgATP, 14.5 creatine phosphate, 20 imidazole, and
KCl to yield a total ionic strength of 180 mmol/liter. Solution pH was adjusted to 7.00 with KOH. The pCa (i.e.,
log [Ca2+]) of the relaxing solution was set at 9.0 and the pCa of the maximal activating solution was 4.0. Intermediate pCa solutions were generated by mixing the pCa 9.0 and
pCa 4.0 solutions as previously described (Metzger et al., 1993
).
Cardiac Myocyte Attachment.
Coverslips were removed and washed
several times with relaxing solution which results in permeabilization of
the myocyte membrane. Single rod-shaped cardiac myocytes were attached to micropipettes coated with an adhesive between a force transducer (model 403A; Cambridge Tech) and moving coil galvanometer
(6350; Cambridge Tech) mounted on three-way positioners (Metzger et al.,
1993
). Sarcomere length was set at 2.2 µm by light microscopy.
Isometric Tension Analysis. At each pCa, steady state isometric tension was allowed to develop, followed by rapid slackening to obtain the baseline tension. The myocyte was then relaxed. Total tension was measured as the difference in tension just before and after the slack step. Active tension was calculated by subtracting the resting tension (measured at pCa 9.0)
Data Analysis. Data were acquired on a Nicolet 310 oscilloscope. Tension-pCa curves were fit using the Marquardt-Levenberg nonlinear least squares fitting algorithm and the Hill equation in the form: P = [Ca2+]n/ (Kn + [Ca2+]n) where P is the fraction of maximum tension (Po), K is the [Ca2+] that yields one-half maximum tension, and n is the Hill coefficient (nH). Analysis of variance (ANOVA) with a Student-Neuman Keuls post hoc test were used to examine significant differences with P < 0.05 indicating significance.
| |
Results |
|---|
|
|
|---|
Generation of Recombinant Adenovirus Ad
TmFLAG
and AdcTnIFLAG
Recombinant replication-deficient adenovirus was generated by homologous recombination in HEK-293 cells. Southern blots of restriction enzyme digests of viral DNA using full-length cDNA digoxigenin-labeled (Boehringer Mannheim) probes show the correct insertion of the expression cassettes into the left end of the viral genome (Fig. 1).
|
Expression of
TmFLAG in Adult Cardiac Myocytes
To quantitate the rate of expression and incorporation of
newly synthesized
Tm in adult cardiac myocytes, protein
expression was determined by Western blotting of total
cellular protein from Ad
TmFLAG infected myocytes at
several time points in primary culture (Fig. 2). The addition of the epitope resulted in a slower migration pattern
of
TmFLAG than the endogenous
Tm on SDS-PAGE allowing direct quantitation of expression using an
Tm
antibody. Note that the expressed
TmFLAG in cardiac
myocytes comigrates with the protein expressed in HEK-293 cells (Fig. 2 C) infected with the same adenovirus indicating the correct processing size of
TmFLAG in two different cell types. The
TmFLAG protein was first detected in adult cardiac myocytes at day 2 in culture and the
ratio of
TmFLAG to total Tm (
TmFLAG + endogenous
Tm) increased over time in culture. A summary of
densitometric analysis of these Western blots is shown in
Fig. 2 B. If we assume that by using a strong viral promoter
we can outcompete the endogenous Tm gene expression
for sites available on the thin filament, then hypothetically the expression of
TmFLAG would be limited by the rate
at which Tm is replaced in the thin filament. In that regard, it is interesting that the proportion of
TmFLAG to
total Tm correlates well with the half-life of Tm measured
in vivo (5.5 d) (Martin, 1981
). Permeabilization of adult
cardiac myocytes in relaxing buffer containing 0.1% TX-100 before collection for Western blot analysis resulted in
no apparent change in the proportion of
TmFLAG to total Tm indicating indirectly that the expressed Tm was
bound to the myofilaments (Fig. 2 C). At day 5-7 in primary culture, intact cardiac myocytes contained 39.8 ± 3.3%
TmFLAG (n = 4) and permeabilized cardiac myocytes contained 40.0 ± 2.5%
TmFLAG (n = 7, P > 0.05).
|
Expression of
TmFLAG Does Not Alter Myofilament
Protein Isoform Expression or Stoichiometry
To determine if the newly synthesized Tm was replacing
the endogenous Tm, Tm stoichiometry was analyzed by
reprobing Western blots with antibodies recognizing sarcomeric actin and normalizing the total amount of Tm
(Tm +
TmFLAG) to the amount of actin in each lane
(Fig. 2 C). To compare several different Western blots from different experiments the ratios of Tm/actin were
normalized to the average of the Tm/actin ratio in control
myocytes on each blot (see Materials and Methods). There
was no significant change in the ratio of total Tm to actin
in uninfected cells (1.00 ± 0.03, mean ± SEM, n = 4) compared with the total Tm in cells at days 5-7 expressing
TmFLAG (1.21 ± 0.12, n = 8, P > 0.05). In addition,
there were no detected changes in isoform expression of
troponin I (Fig. 2 D) or troponin T (data not shown) and
no induction of
Tm in controls and Ad
TmFLAG infected cells after 7 d in culture (Fig. 2 D) indicating that
the adult cardiac myocytes were maintained in fully differentiated state throughout the experiments. In support of
this result, it has been shown previously that similar culture conditions and adenoviral mediated gene transfer of
reporter proteins has no effect of the stability and differentiated state of adult rat cardiac myocytes over 7 d in culture (Rust et al., 1998
).
TmFLAG First Incorporates into the Pointed End of
the Thin Filament
Indirect immunofluorescence using an anti-FLAG mAb
and confocal microscope imaging was used to follow the
incorporation of the expressed
TmFLAG into the myofilaments of adult cardiac myocytes over time in culture.
No
TmFLAG protein was detected by indirect immunofluorescence in Ad
TmFLAG infected myocytes at day 1 after infection (data not shown). In Fig. 3 the immunofluorescence three-dimensional reconstructions of representative myocytes at days 2 and 4 after treatment with Ad
TmFLAG are shown. Several interesting points can be noted
from these experiments. First, the
TmFLAG incorporation is uniform throughout the entire width, length, and
depth of the cardiac myocytes. Second, the
TmFLAG
decorates the thin filament between, but not including, the
Z-line structures (as noted by the
-actinin staining). Finally,
TmFLAG immunofluorescence always appears
first at the center of the sarcomere (Fig. 3 B, inset), with
absence of
TmFLAG immunofluorescence between the
center of the sarcomere and the Z-line. This is quite different from the immunofluorescence pattern of endogenous
Tm in uninfected cells (data not shown) and the immunofluorescence pattern of cardiac TnI which shows labeling
of the entire thin filament from Z-line to Z-line (see Fig. 7).
It should be noted that the resting sarcomere length in cultured fully differentiated adult cardiac myocytes is 1.8-1.9
µm. Because at this sarcomere length the thin filaments are partially overlapped, one would not expect to see a gap
at the center of the sarcomere as seen in immunofluorescence of thin filament proteins in skeletal muscle fibers or
neonatal cardiac myocytes (Dome et al., 1988
; Helfman et
al., 1999
) where clearly segregated I-bands are evident.
The region that is void of
TmFLAG immunofluorescence, as shown in Fig. 3, C and D, appeared to decrease slightly over time in culture which is associated with increased
TmFLAG protein expression by Western analysis. These results suggest the
TmFLAG incorporates
most readily into the pointed end of the thin filament and
incorporates in a direction from the pointed end to the
barbed end of the thin filament.
|
|
The FLAG Epitope on Tm Does Not Limit Tm Incorporation into Myofilaments or Alter Myocyte Contractile Function
To determine if the addition of the eight-amino acid
(DYKDDDDK) epitope somehow alters or limits the incorporation of Tm into myofilaments, a second experimental protocol was used. In this protocol, cardiac myocytes infected with Ad
TmFLAG were treated with 20%
serum added to the media. Treatment of cardiac myocytes with 20% serum increases myofilament protein turnover
and results in redifferentiation, or the breakdown of existing myofibrils and myofibrillogenesis with reinduction of
embryonic myofilament protein isoform expression (Eppenberger et al., 1988
). Western blot analysis shown in Fig.
4 C indicates that treatment of Ad
TmFLAG infected
myocytes with 20% serum resulted in nearly complete replacement of the endogenous Tm with
TmFLAG after
6 d in culture. Small amounts of expression of
Tm, the
fetal Tm isoform, was induced by the treatment of cells
with 20% serum, but was not different between control
serum-treated cells and Ad
TmFLAG serum-treated cardiac myocytes. Indirect immunofluorescence on Ad
TmFLAG-infected myocytes showed
TmFLAG immunofluorescence patterns that now resemble the pattern of Tm
immunofluorescence in uninfected serum-treated myocytes with striated wide bands of staining from Z-line to
Z-line around the perinuclear mature myofibrillar region
(Fig. 4 B) of the redifferentiating cardiac myocytes and
TmFLAG staining premyofibrils in the periphery (Fig. 4
A). These results together suggest that the FLAG epitope
does not limit the structural replacement of the endogenous Tm with the adenoviral delivered
TmFLAG protein.
In addition, if the epitope was altering the structural integrity of Tm, it might be expected that myocytes expressing and incorporating TmFLAG might show altered mechanical function. To determine if the FLAG epitope
alters Tm regulation of mechanical function, single cardiac
myocyte isometric force measurements were used to determine if expression of
TmFLAG in fully differentiated, serum-free cardiac myocytes, resulted in alterations in
contractile functions. As shown in Fig. 5, no significant
changes in contractile function (maximum force, pCa50,
and Hill coefficient, P > 0.05) were detected in Ad
TmFLAG infected myocytes compared with control uninfected cardiac myocytes. This result was likely not due to selection of a large population of uninfected cardiac myocytes, because of the high efficiency of adenoviral-mediated gene transfer to adult cardiac myocytes in vitro using
similar preparations of cardiac myocytes and infection
protocols (Rust et al., 1998
). In support of this point, immunofluorescence staining of time-paired myocytes indicated >85% of the Ad
TmFLAG infected rod-shaped
myocytes were expressing
TmFLAG (data not shown).
|
Cardiac Troponin I Incorporates Randomly along the Entire Length of the Thin Filament
To assess if the mechanism of incorporation of Tm into
myofilaments was unique to Tm or if a similar mechanism
exists for all thin filament regulatory proteins, myocytes
were treated with the AdcTnIFLAG vector and analyzed
for protein expression and myofilament protein incorporation. Fig. 6 shows the expression of cTnIFLAG in adult
cardiac myocytes over time in primary culture. The ratio
of cTnIFLAG to total TnI increases over time in culture indicating the cTnIFLAG protein is being expressed. Note
that the ratio of cTnIFLAG to the endogenous TnI over
time in culture (Fig. 6 B) is much greater than the expression of
TmFLAG (Fig. 2 B) which is consistent with the
greater turnover (shorter half-life) of this protein in cardiac myocytes (Martin, 1981
). Permeabilization of the myocytes before sampling does not appear to affect the ratio of
cTnIFLAG to the endogenous cTnI indicating that the
cTnIFLAG protein was bound to myofilaments (Fig. 6 A).
In addition, there was no significant change in the ratio of
total TnI to actin in untreated cells (1.00 ± 0.08, mean ± SEM, n = 8) compared with the total TnI in cells at days
5-7 expressing cTnIFLAG (0.95 ± 0.16, n = 10, P > 0.05).
Confocal three-dimensional reconstructions of a representative AdcTnIFLAG-treated cardiac myocyte is shown in
Fig. 7. Most notably, the first detectable immunofluorescence from cTnIFLAG at day 2 after treatment with viral
vector extends the entire length of the thin filament from
Z-line to Z-line (Fig. 7, inset). This pattern of immunofluorescence does not change over time in culture and appears to be identical to the immunofluorescence pattern of
cTnI labeling in control cells (data not shown). This indicates that TnI turnover and incorporation occurs randomly along the entire length of the adult cardiac thin filament.
|
To more clearly highlight the protein-specific mechanisms of replacement of endogenous myofilament proteins
with newly synthesized myofilament proteins, Fig. 8 compares the immunofluorescence pattern of
TmFLAG and
cTnIFLAG at day 2 after gene transfer. It should be noted
that day 2 is the first day at which TmFLAG or cTnIFLAG can be detected in adult cardiac myocytes by Western blotting or immunofluorescence analysis. This comparison clearly shows that while the initial replacement of
the endogenous TnI with cTnIFLAG (Fig. 8 B) occurs
along the entire length of the thin filament from Z-line to
Z-line (Z-lines marked by arrows), the initial replacement
of
Tm with
TmFLAG occurs at distinct regions of the
thin filament near the pointed end (Fig. 8 A).
|
| |
Discussion |
|---|
|
|
|---|
In this study, the mechanism of sarcomere maintenance,
collectively defined as the processes of myofilament protein synthesis, incorporation, and degradation, in a fully
differentiated muscle cell, the adult cardiac myocyte, was
examined. Using adenoviral-mediated gene transfer into
adult cardiac myocytes in vitro, the expression and incorporation of newly synthesized epitope-tagged contractile proteins into myofilaments was visualized in order to understand the process of sarcomere maintenance in fully
differentiated contractile cells. The results from the expression of epitope-tagged
Tm and cTnI in adult cardiac
myocytes suggest common mechanisms and protein specific mechanisms of sarcomeric maintenance that shed
new light on how sarcomeric maintenance occurs while the
cell is still able to maintain force production.
Common Features of Sarcomere Maintenance in Fully Differentiated Cardiac Myocytes
The results presented here suggest several common mechanisms of sarcomeric maintenance. Given the high efficiency of adenoviral mediated myofilament gene transfer
into adult cardiac myocytes in vitro (Westfall et al., 1997
,
1998
; Rust et al., 1998
; this study), it is possible to estimate
the average protein replacement in single cardiac myocytes by measuring the protein expression in a large sample of cardiac myocytes. From the results shown in Figs. 2
and 6, it is apparent that the expression of both epitope-tagged
Tm and cTnI proteins results in expression and
incorporation rates that are similar to their measured half-life in vivo (Martin, 1981
). Interestingly, in both cases the
expression of exogenous cTnI or Tm does not change the
total amount of either TnI or Tm indicating that the expression of the endogenous protein is downregulated. A
similar result was obtained previously using adenoviral-mediated gene transfer of slow skeletal TnI into adult
cardiac myocytes in vitro (Westfall et al., 1997
). This
maintenance of myofilament protein stoichiometry during
changing levels of gene expression has been seen in several mouse models where ablation of one allele of the cardiac expressed
Tm1 gene or overexpression the fetal isoform
Tm of in the heart results in no change in the total amount of myofilament bound Tm protein (Muthuchamy
et al., 1995
; Blanchard et al., 1997
; Rethinasamy et al.,
1998
). Interestingly, while ablation of one allele of the
Tm gene has no effect on total Tm in the heart and
doesn't result in any marked changes in cardiac function
(Blanchard et al., 1997
; Rethinasamy et al., 1998
), ablation
of a single copy of
Tm gene in yeast disrupts cellular
function (Liu and Bretscher, 1989
), and in Drosophila a
similar disruption of one Tm allele results in impairment
of indirect flight muscle function (Molloy et al., 1992
;
Kreuz et al., 1996
). This suggests that the ability of myofilament proteins and the contractile apparatus to adapt to
altered levels of myofilament gene expression may not be
evolutionarily conserved. Taken together, these results
also suggest that the rate of myofilament incorporation of
newly synthesized contractile proteins is limited by the
turnover rate of the endogenous myofilament protein already residing on sites on the myofilament lattice. If sites
on myofilaments are unavailable, the newly synthesized
contractile protein is likely not made or is rapidly degraded. In support of these results, a previous study by
Dome et al. (1988)
showed that binding of fluorescently labeled brain Tm to permeabilized muscle fibers could only
occur if the endogenous Tm was extracted by high salt treatment. The mechanism of regulation of myofilament
protein stoichiometry in adult muscle cells is not well understood, although mouse models of overexpression and
ablation of myofilament genes in the heart suggest that
multiple regulatory mechanisms, including transcriptional
and translation regulation, may be involved (James and
Robbins, 1997
; Rethinasamy et al., 1998
).
Another common feature of sarcomere maintenance
shown in this study is that replacement of endogenous
myofilament proteins is uniform throughout the entire
cell. This suggests that in mature adult cardiac myocytes
where the myofilament lattice is already formed, the
myofilaments throughout the muscle cell are being replaced simultaneously. A previous report using 3H-leucine pulse-chase techniques suggested that unidentified
newly synthesized protein in cultured, growing skeletal
muscle myotubes appears throughout the muscle fiber but
also showed that newly synthesized proteins appear somewhat more readily around the periphery of myofibrils
(Morkin, 1970
). Although we did not find any direct evidence in support of this latter result in fully differentiated adult cardiac myocytes, the resolution needed to address
this question is probably beyond the limits of confocal microscopy especially in the axial direction.
Protein-specific Features of Sarcomere Maintenance in Fully Differentiated Cardiac Myocytes
In this study, the visualization of the incorporation of
newly synthesized
TmFLAG and cTnIFLAG with confocal microscopy yielded some interesting and surprising results. As shown in Fig. 3, the incorporation of newly synthesized Tm appears at the free end or pointed end of the
thin filament. Two important conclusions can be drawn
from this result. First, the newly synthesized
TmFLAG protein is capable of binding to the appropriate location of
Tm in the sarcomere, namely the thin filament regions
with no binding to the Z-line (Endo et al., 1966
; Trombitas, 1990). Second, the replacement of the endogenous Tm
with newly synthesized Tm occurs more readily at the
pointed end of the thin filament and continues toward the
Z-line.
Several explanations could explain this result of preferred pointed end replacement of the endogenous Tm
with newly synthesized Tm. The first and most likely explanation is that Tm turnover occurs more readily at the
pointed end of the thin filament. We speculate that this is
due to the structural properties of Tm, in that it may be
more favorable to remove Tm from one end of the head-to-tail polymer than in the center of the polymer, especially if one end of the polymer is anchored in the Z-line
by binding to
-actinin (Puskin et al., 1977) or other Z-line
proteins. Interestingly, Trombitas et al. (1990) reported
that when localizing Tm in frog skeletal muscle with immunoelectron microscopy, there were differences in the
ability of certain Tm antibodies to recognize the Tm proteins nearest the Z-line. In particular, the 24th Tm (nearest the Z-line) was only recognized by an antibody that
preferentially binds to phosphorylated Tm. These results
suggest there may be structural differences in Tm that may
affect how rapidly Tm can exchange with newly synthesized Tm along the length of the thin filament.
A second possible explanation is that the result is an artifact due to the addition of the COOH-terminal FLAG
epitope. Previous biochemical work has shown that modification of the ends of Tm by acetylation or deletion can
alter actin binding affinity (Hitchock-DeGregori, 1994).
If the addition of the COOH-terminal FLAG epitope
merely disrupted end-to-end interactions of Tm preventing polymerization, we would expect to be able to replace
Tm equally well on both ends of the thin filament, a result which was not seen. To confirm further that the epitope does not limit or alter the incorporation of Tm into
myofilaments two additional control experiments were performed. First, under serum-treated conditions, the
TmFLAG protein nearly completely replaced the endogenous Tm protein from Z-line to Z-line in the mature
myofibrillar regions indicating that the epitope itself is not
limiting the incorporation of the
TmFLAG protein into
the myofilaments. Second, if the epitope itself was significantly altering the Tm structure, we would expect contractile function would be altered in myocytes expressing the epitope-tagged Tm. This result was not seen as there
was no significant difference in Ca2+-activated contractile
function (e.g., pCa50, P0, nH) between control cardiac myocytes and cardiac myocytes expressing
TmFLAG. In support of this result, it was also observed that serum-treated adult cardiac myocytes expressing the TmFLAG protein
spontaneously beat in culture similar to control serum-treated cardiac myocytes while in these cells nearly all the
Tm in these cardiac myocytes has been replaced with
TmFLAG.
A third possible explanation for the preferred pointed
end replacement of the endogenous Tm with newly synthesized Tm is that this process of Tm replacement is not
characteristic of the turnover of Tm protein alone but a
visualization of what is happening globally to the thin filaments. In other words, is what is visualized with Tm incorporation specific to Tm or a manifestation of thin filaments completely breaking down and reforming from
their pointed ends? If the latter were the case, it would be
hypothesized that other newly synthesized thin filament
proteins would show similar patterns of incorporation into
myofilaments. The results presented here show that incorporation of the newly synthesized cTnIFLAG protein does not show preferred pointed end incorporation.
Rather, cTnIFLAG is incorporated in all sarcomeres
throughout the cell in a stochastic fashion across the
length of the thin filament. Interestingly, the half-lives of
the subunits of the troponin complex in the rat heart in
vivo are varied with TnI and TnT at ~3 d and TnC at ~5 d
(Martin, 1994). This would suggest, along with our results, that the replacement of Tn subunits may either occur rapidly while the complex remains attached to the thin filament, or that dissociated TnC subunits are capable of reassociating with newly synthesized TnI and TnT subunits
followed by rebinding stochastically to the thin filament.
The lack of kinetic evidence from isotope studies for precursor pools of TnT and TnC in adult rat heart favors that subunit exchange might take place while the troponin
complex remains attached to actin (Martin, 1981
).
Comparison of Tm Replacement during Sarcomere Maintenance and Myofibrillogenesis
The pointed end incorporation of newly synthesized
Tm
in fully differentiated adult cardiac myocytes presented
here differs significantly from recent studies in serum-treated
neonatal cardiac myocytes. The expression of transfected
green fluorescent protein-tagged Tm (Tm-GFP) in neonatal myocytes (Helfman et al., 1999
) showed localization of
Tm after 48 h along the entire length of the thin filament.
There are several possible explanations for these different observations. First, since complete replacement of the endogenous Tm by newly synthesized Tm does not occur in
our 7-d culture period in fully differentiated adult cardiac
myocytes, we would hypothesize that if culture conditions
could be extended further, complete replacement of Tm
from Z-line to Z-line would eventually occur (see model
below). If the turnover of myofilaments is much faster in
neonatal cardiac myocytes (which is likely since neonatal
myocytes undergo shape changes and cell division) full replacement of Tm from Z-line to Z-line could be complete
in 48 h. However, the average percentage of Tm replaced
by Western blotting cannot be estimated in the Tm-GFP
experiments due to the low transfection efficiency of neonatal cardiac myocytes (Helfman et al., 1999
). Second,
Morkin (1970)
found in growing muscle myotubes (neonatal skeletal muscle) that new myofibrillar proteins were
added preferentially to the periphery of the myofibrils. If
myofibrils are adding more filaments in parallel as they
grow wider in differentiating neonatal muscle cells, the addition of new filaments from the Z-line could explain the
end to end incorporation. Indeed, our results of
TmFLAG incorporation into myofilaments of serum-treated
redifferentiating adult cardiac myocytes show very similar
incorporation patterns to GFP-Tm incorporation into neonatal adult cardiac myocytes (Helfman et al., 1999
). By
switching adult cardiac myocytes from a state of sarcomere maintenance (i.e., serum-free conditions) to increased turnover and myofibrillogenesis (i.e., serum conditions) incorporation of
TmFLAG from Z-line to Z-line
and complete replacement of the endogenous Tm can and
does occur (Fig. 4).
Models of Sarcomere Maintenance in Fully Differentiated Cardiac Myocytes
The differential incorporation of newly synthesized Tm and TnI proteins into sarcomeres of adult cardiac myocytes not only suggests that there are contractile protein specific mechanisms for sarcomere maintenance but also suggests some important basic mechanisms for sarcomere maintenance in fully differentiated contractile cells. Fig. 9 shows several possible models of how replacement of thin filament proteins during sarcomere maintenance could occur.
|
The results from this study favor the model shown in
Fig. 9 A in which sarcomere maintenance occurs while
maintaining a nearly intact thin filament. More specifically, endogenous contractile proteins of the thin filament
are capable of rapidly exchanging with newly synthesized
contractile proteins, so rapidly that the thin filament structure and function is not dramatically altered. For instance,
it has been shown previously that extraction of myofilament proteins such as TnC from skeletal muscle fibers results in a dramatic alterations in the ability to produce
force in response to a change in [Ca2+] (Moss, 1992
). Consequently, if sites remained vacant for a substantial period
of time, this would lead to a dramatic destabilization of
sarcomeric structure and alterations in force production of the cell, processes which did not occur as shown in Fig. 5.
In addition, this maintenance of intact thin filaments could
explain how myofilament protein turnover can occur while
maintaining continuous and near maximal force production of the adult cardiac myocyte in vivo.
The mechanisms of exchange of newly synthesized regulatory proteins with endogenous proteins of the thin filament in the first model are protein isoform specific. Cardiac TnI, as a subunit of the ternary troponin complex
exchanges stochastically along the length of the thin filament, possibly while the complex remains attached to the
thin filament through interactions of TnT and tropomyosin. Tm, which forms head to tail polymers, exchanges with
the endogenous Tm in a more ordered fashion. Assuming
the Tm polymer is anchored into the Z-line by binding
-actinin, or the Tm nearest the Z-line is structurally different, it is more favorable to remove and replace Tm proteins from the pointed end.
Whereas the results presented here support the model
detailed in Fig. 9 A, there are at least two other possible
models of sarcomere maintenance that could be considered. In the second model shown in Fig. 9 B, older thin filaments are replaced by formation of entirely new thin filaments. This process could occur by nucleation of new actin
polymers from the Z-line, polymerization of new thin filaments with coordinate addition of regulatory proteins followed by removal and breakdown of older thin filaments.
This model was proposed by LoRusso et al. (1992)
to explain the rapid incorporation (30 s) of microinjected fluorescently labeled actin into myofilaments of freshly isolated adult cardiac myocytes. If sarcomere maintenance
occurred by formation of new thin filaments, we would
have expected to see the newly synthesized Tm and TnI first binding near either side of the Z-line and extending
toward the pointed end over time in culture as these new
thin filaments polymerized, a result which was not obtained. It could be argued that actin cables are fully
formed from the Z-line followed by addition of newly synthesized Tm from the pointed end. However, this would
require a large portion of actin polymers to remain stable
in the absence of any Tm binding for several days, and it has been shown previously in yeast and in the hearts
of mutant axolotls that in the absence of Tm, actin filaments are not stable and/or do not readily form (Liu and
Bretscher, 1989
; Lemanski et al., 1976
).
In the hypothetical third model of sarcomere maintenance shown in Fig 9 C, the pointed ends of the thin filament are most readily turned over by a process of breaking down thin filaments from the free end, followed by repolymerization of the actin filament and association of regulatory proteins. If the extent or length of myofilament breakdown from the pointed end was stochastic, gradually over time, more and more of the thin filaments on average would be replaced. This model could explain the results seen for the incorporation of newly synthesized Tm into myofilaments. However, if this model was accurate in describing sarcomere maintenance, it would be expected to see similar pointed end incorporation of newly synthesized TnI, a result which was not obtained.
In conclusion, the results presented here support a
model for sarcomere maintenance (Fig. 9 A) in which the
replacement of thin filament proteins by newly synthesized proteins (a) is a ordered process for Tm and a stochastic process for TnI, and (b) exchange with newly synthesized proteins occurs rapidly enough for thin filament
structure to be maintained which allows the adult cardiac
myocyte to undergo sarcomere maintenance while maintaining the continual ability to produce force and motion.
These results and this model suggest that Tm proteins
nearest the Z-line are older than the Tm on the pointed
ends of the thin filament. The functional consequences of
this property of Tm replacement are unknown. However,
it is well known that in cardiac muscle there is a sarcomere
length dependence of Ca2+ activation where at longer sarcomere length the myofilaments are more sensitive to activating Ca2+ (Hibberd and Jewell, 1982
). Whether or not
structural, functional, or age differences in Tm along the
length of the thin filament contribute to or reflect properties of this phenomenon remains to be tested. In addition,
it is unknown how other contractile proteins of the contractile apparatus are replaced in fully differentiated cardiac myocytes. For example, it will be interesting in future studies to determine how the subunits of the troponin
complex are replaced. The components of this complex
have been shown to have different turnover rates in vivo
(Martin, 1981
). This suggests that a single troponin subunit
may either turnover while the other subunits remain attached to the thin filament (allowing different rates of total protein turnover), or that troponin subunits with longer
half-lives (TnC ~5 d) can reassociate with newly synthesized troponin subunits and rebind to the thin filament. Finally, another interesting outcome of this work will be to
determine if sarcomere maintenance of contractile proteins is altered under pathophysiological conditions such
as heart failure and aging.
| |
Footnotes |
|---|
Address correspondence to Dr. Joseph M. Metzger, 7730 Med Sci II, Department of Physiology, University of Michigan, 1150 W. Medical Center Drive, Ann Arbor, MI 48109-0622. Tel.: (734) 763-5844. Fax: (734) 936-8813. E-mail: metzgerj{at}umich.edu
Received for publication 2 February 1999 and in revised form 18 May 1999.
This research was funded by grants from the National Institutes of
Health (NIH) and the American Heart Association to J.M. Metzger and
NIH Training Grants to D.E. Michele. J.M. Metzger is an Established Investigator for the American Heart Association.
We thank Dr. Clare Gooding and Dr. Anne Murphy for their gifts of the
Tm and cTnI cDNAs, respectively, and Dr. Margaret Westfall for her
contribution to the designing of the primers for the cTnIFLAG mutagenesis. We thank the Tom Komorowski and the Morphology and Image
Analysis Core of the Michigan Diabetes Research and Training Center
for assistance and training with the confocal microscope.
| |
Abbreviations used in this paper |
|---|
Ab, antibody; KHB, Krebs-Henseleit buffer; MOI, multiplicity of infection; Tm, tropomyosin; TnC, troponin C; TnI, troponin I; TnT, troponin T.
| |
References |
|---|
|
|
|---|
| 1. | Auerbach, D., B. Rothen-Ruthishauser, S. Bantle, M. Leu, E. Ehler, D. Helfman, and J.-C. Perriard. 1997. Molecular mechanisms of myofibril assembly in heart. Cell Struct. Funct. 22: 139-146 [Medline]. |
| 2. |
Blanchard, E.M.,
K. Iizuka,
M. Christe,
D.A. Conner,
A. Geisterfer-Lowrance,
F.J. Schoen,
D.W. Maughn,
C.E. Seidman, and
J.G. Seidman.
1997.
Targeted
ablation of the murine alpha-tropomyosin gene.
Circ. Res.
81:
1005-1010
|
| 3. |
Dabiri, G.A.,
K.K. Turnacioglu,
J.M. Sanger, and
J.W. Sanger.
1997.
Myofibrillogenesis visualized in living embryonic cardiomyocytes.
Proc. Natl. Acad.
Sci. USA.
94:
9493-9498
|
| 4. | Dome, J.S., B. Mittal, M.B. Pochapin, J.M. Sanger, and J.W. Sanger. 1988. Incorporation of fluorescently labeled actin and tropomyosin into muscle cells. Cell Differ. 23: 37-52 [Medline]. |
| 5. |
Dlugosz, A.A.,
P.B. Antin,
V.T. Nachmias, and
H. Holzer.
1984.
The relationship between stress-fiber-like structures and nascent myofibrils in cultured
cardiac myocytes.
J. Cell Biol.
99:
2268-2278
|
| 6. |
Endo, M.,
Y. Nonomura,
T. Masaki,
I. Ohtsuki, and
S. Ebashi.
1966.
Localization of native tropomyosin in relation to striation patterns.
J. Biochem.
60:
605-608
|
| 7. | Eppenberger, M.E., I. Hauser, T. Bächi, M.C. Schaub, U.T. Brunner, C.A. Dechesne, and H.M. Eppenberger. 1988. Immunocytochemical analysis of the regeneration of myofibrils in long-term cultures of adult cardiac myocytes of the rat. Dev. Biol. 130: 1-15 [Medline]. |
| 8. | Helfman, D.M., C. Berthier, J. Grossman, M. Leu, E. Ehler, E. Perriard, and J.-C. Perriard. 1999. Nonmuscle tropomyosin-4 requires co-expression with other low molecular weight isoforms for binding to the thin filaments in cardiac myocytes. J. Cell. Sci. 112: 371-380 [Abstract]. |
| 9. |
Hibberd, M.G., and
B.R. Jewell.
1982.
Calcium- and length-dependent force
production in rat ventricular muscle.
J. Physiol. Lond.
329:
527-540
|
| 10. | Hitchcock-DeGregori, S.E. 1994. Structural requirements of tropomyosin for binding to filamentous actin. In Actin: Biophysics, Biochemistry and Cell Biology. J.E. Estes, and P.J. Higgins, editors. Plenum Press, NY. 85-96. |
| 11. | Imanaka-Yoshida, K., J.M. Sanger, and J.W. Sanger. 1993. Contractile protein dynamics of myofibrils in paired adult rat cardiomyocytes. Cell Motil. Cytoskelet. 26: 301-312 [Medline]. |
| 12. | Jac |