|
||
Original Article |
Correspondence to: H. Okazawa, Department of Neurology, Faculty of Medicine, University of Tokyo, 7-3-1, Hongo, Bunkyo-ku, Tokyo 113, Japan. Tel:81-3-3815-5411 Fax:81-3-5800-6548 E-mail:okazawa-tky{at}umin.u-tokyo.ac.jp.
| Abstract |
|---|
|
|
|---|
Presenilin 1 (PS1) is the causative gene for an autosomal dominant familial Alzheimer's disease (AD) mapped to chromosome 14. Here we show that QM/Jun-interacting factor (Jif)-1, a negative regulator of c-Jun, is a candidate to mediate the function of PS1 in the cell. We screened for proteins that bind to PS1 from a human embryonic brain cDNA library using the two-hybrid method and isolated one clone encoding the QM/Jif-1 gene. The binding of QM/Jif-1 to full-length PS1 was confirmed in vitro by pull-down assay, and in vivo by immunoprecipitation assays with human samples, including AD brains. Immunoelectronmicroscopic analysis showed that QM/Jif-1 and PS1 are colocalized at the endoplasmic reticulum, and the nuclear matrix in human brain neurons. Chloramphenicol acetyltransferase assays in F9 cells showed that PS1 suppresses transactivation by c-Jun/c-Jun but not by c-Jun/c-Fos heterodimers, consistent with the reported function of QM/Jif-1. By monitoring fluorescent recombinant protein and by gel mobility shift assays, PS1 was shown to accelerate the translocation of QM from the cytoplasm to the nucleus and to thereby suppress the binding of c-Jun homodimer to 12-O-tetradecanoylphorbol-13- acetate (TPA)-responsive element (TRE). PS1 suppressed c-junassociated apoptosis by retinoic acid in F9 embryonic carcinoma cells, whereas this suppression of apoptosis is attenuated by mutation in PS1. Collectively, the novel function of PS1 via QM/Jif-1 influences c-junmediated transcription and apoptosis.
Key Words: Alzheimer's disease, presenilin-1, c-jun, cell death, QM/Jif-1
MUTATIONS in the presenilin 1 (PS1)1 gene have been shown to influence the intracellular metabolism of ß-amyloid (Aß) and increase the ratio of Aß1-42 peptides, which appears to be more fibrillogenic than Aß1-40 in patient plasma as well as in brains of transgenic mice (for reviews see ![]()
![]()
![]()
![]()
![]()
In addition to the gained function of mutant genes, PS1 is physiologically indispensable for embryonic morphogenesis. PS1-/- mice exhibited abnormal patterning of the axial skeleton and spinal ganglia and developed cerebral cavitation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Functional analyses of PS1 still remain controversial. PS1 was shown to participate directly in the cleavage of APP (![]()
![]()
![]()
![]()
Therefore, it is necessary to further characterize molecules interacting with PS1 in order to understand the mechanism underlying this complex and wide spectrum of cellular functions for the PS1 molecule. In this study, we found that QM/Jun-interacting factor (Jif)-1 (![]()
![]()
| Materials and Methods |
|---|
|
|
|---|
Two-Hybrid cDNA Cloning
cDNA encoding full-length PS1 was amplified from human hippocampal mRNA (Clontech) by reverse transcriptase PCR using primers F, 5'-AAAGAATTCATGACAGAGTTACCTGCACCGT-3' (sequence data available from EMBL/GenBank/DDBJ under accession no.
L42110; nucleotides [nt] 249270) and R, 5'-AAACTCGAGCCATGGGATT- CTAACCGC-3' (nt 16771660), and subcloned between EcoRI and XhoI sites of pEG202LexA fusion plasmid. After confirming that cotransfection of the pEGPS1 and pJG4-5 plasmids does not show nonspecific binding, ~5 x 105 clones were screened from a human embryonic brain cDNA library (provided by Dr. Roger Brent, Harvard Medical School, Boston, MA). A second screening was performed with both SG-HWUX-gal and SG-HWUL plates. Positive clones were subcloned into pBluescript KS+ (Stratagene) and sequenced by using an automatic sequencer (Applied Biosystems, Inc.).
Immunoprecipitation
100 mg of each cerebral cortex tissue was suspended in 1 ml of lysis buffer (10 mM Tris-HCl, pH 7.8, 1% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin), incubated at 4°C for 10 min, and disrupted by repeated aspiration through a 21-gauge needle. Cellular debris was removed by centrifugation at 10,000 g for 10 min. Aliquots of cell lysates were incubated with various antibodies for 1 h at 4°C, then precipitated with protein Gagarose (Oncogene Science). AntiNH2-terminal antibody (
N) and anti-loop antibody (
L) were used finally at 1:200 dilution. Anti-QM (C-17) polyclonal antibody (Santa Cruz Biotechnology) was used at 1:1,000 dilution.
N antibody is specific for amino acids 2180 of human PS1 (![]()
L is a polyclonal antiserum that reacts with epitopes in the hydrophilic loop domain (amino acids 263407) of human and mouse PS1 (![]()
Pull Down Assay
Expression vectors of various forms of PS1 as well as glutathione S-transferase (GST)-QM fusion proteins were constructed as follows. Full-length PS1 cDNA was amplified with primers F182 (5'-AAACTCGAGTCTATACAGTTGCTCCAATGAC, nt 232254) and R182 (5'-AAATCTAGACCATGGGATTCTAACCGCA, nt 16771660) from human hippocampal mRNA, and subcloned between XhoI and XbaI sites of pCIneo mammalian expression vector (Promega). The structure and sequence were confirmed by DNA sequencing and restriction site analyses. For pCImPS1 carrying a mutation Met
Leu at codon 146 associated with early-onset familial AD, site-directed mutagenesis was performed with Transformer Site-directed Mutagenesis kit (Clontech) according to the commercial protocol.
For vectors expressing GST fusion proteins in Escherichia coli, QM cDNA was subcloned between BamHI and EcoRI pGEX3X (Amersham Pharmacia Biotech) by using PCR with synthetic primers to adjust the reading frame. Fusion proteins linked to deleted QM (see Fig 2 c) was constructed similarly by using PCR. PS1 protein was synthesized and radiolabeled with [35S]methionine (NEN) by in vitro transcription and translation with TNT T7/T3coupled reticulocyte lysate system (Promega). Interaction between PS1 and GST-QM proteins was performed according to the reported method (![]()
|
|
Immunoelectronmicroscopy
5 mm3 of tissue was obtained from the cerebral cortex of a 37-yr-old woman 24 h after her death by loss of blood, and fixed with 4% paraformaldehyde. Sections for electronmicroscopic immunocytochemistry were postfixed in 1% osmium tetroxide, stained with 2% uranyl acetate, dehydrated using graded alcohol and propylene oxide, and embedded in Eponate 12 resin. 40-µm sections were stained by rat mAb against PS12180 (![]()
![]()
Chloramphenicol Acetyltransferase Assay
Transfection was performed as described previously (![]()
![]()
![]()
Enhanced Green Fluorescent Protein Fusion Protein Expression Vectors
Expression vectors of fluorescent proteinQM fusion proteins were constructed by inserting various forms of QM cDNAs into pEGFPN1 (Clontech). Full-length QM cDNA was amplified by RT-PCR from human amygdala mRNA with the primers QMF (AACGAATTCCCATGGGCCGCCGCCCCGCCCGTT) and QMR (AATGGATCCGTGAGTGCAGGGCCCGCCA), and subcloned between EcoRI and BamHI sites of pEGFPN1.
c-Jun NH2-terminal Kinase Activity Assay
The effect of PS1 on c-Jun NH2-terminal kinase (JNK) activities was analyzed by transfecting 6 µg of T7-tagged JNK1 with 10 µg of pCIPS1 or pBS-KS as control into F9 cells. JNK1 protein was recovered by immunoprecipitation with mouse mAb against T7 epitope (Invitrogen). After the Sepharose resin was washed five times with lysis buffer containing 20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 50 mM ß-glycerophosphate, 0.1 mM Na3VO4, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 10% glycerol, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml aprotinin, the proteins were recovered with SDS sample buffer and analyzed by Western blotting with antiT7-Tag antibodies.
Retinoic Acidinduced Apoptosis
To make stable cells expressing antisense c-jun, pCIneo (Promega) containing the full-length c-jun cDNA at the reverse orientation was constructed and transfected into F9 cells. They were selected in
-medium (Sigma Chemical Co.) with 300 µg/ml G418 for 2 wk. Stable cells expressing normal or mutant PS1 were similarly made by transfecting pCIPS1 and pCImPS1. 1 x 105 F9 or stable cells were cultured in
-medium: 10% FBS with 1 µM all-trans retinoic acid (Sigma Chemical Co.) for 48 h. All the cells were collected and their genomic DNA were extracted and separated on 3% Nusieve-agarose gel (FMC BioProducts).
For analysis of the effect of deletion constructs of QM on apoptosis, 1 x 105 F9PS1 cells were transiently transfected with 20 µg of each expression vector described below using SuperFect (Qiagen) in a 10-cm tissue culture dish. 24 h after transfection, cells were treated with 1 µM all-trans retinoic acid (Sigma) for an additional 48 h. All the cells were collected and the percentage of cell death was estimated by trypan blue dye exclusion.
Deletion Constructs of QM/Jif-1
QM/Jif-1 cDNA fragments were amplified with RT-PCR from human hippocampal mRNA (Stratagene). The primers used were F1 (AAACTCGAGCCTGGTGTCGCCATG; sequence data available from EMBL/GenBank/DDBJ under accesion no.
M64241; nt 3044), R1 (AAAGAATTCAATTCGGGCAGCCTCCA, nt 251235), F2 (AAAGAATTCCGCATCAACAAGATGT, nt 333348), R2 (AAATCTAGAAGCCCTCATGAGTGCA, nt 691676), and R3 (AAATCTAGAACATC-TTGTTGATGCG, nt 348333). Different portions of QM cDNA were amplified with F1 and R3 for
1 or with F1 and R1 for
2, digested with XhoI and XbaI or with XhoI and EcoRI, and subcloned into corresponding sites of pCIneo vector (Promega), respectively. For
3, two cDNA fragments amplified with F1/R1 or F2/R2 were digested with XhoI/EcoRI or with EcoRI/XbaI, respectively, then subcloned between XhoI and XbaI sites of pCIneo.
| Results |
|---|
|
|
|---|
Identification of QM/Jif-1, a Negative Regulator of c-Jun, as a Binding Protein to PS1
We have investigated the function of PS1 by isolating the molecules that interact with PS1. We screened a human embryonic brain library using the yeast two-hybrid system. After double second screens using leucine-deficient plates and X-gal plates, we finally judged six clones showing strong interaction to be positive. In our experience with the two-hybrid system, this number of positive clones was small compared with other baits. Among them, we found a clone identical to QM/Jif-1. This molecule was isolated originally as a putative Wilms's tumor suppressor gene (![]()
![]()
![]()
![]()
This clone (PS309-4) lacked an NH2-terminal portion of 43 amino acids and encoded a variant Ser202Asn (Fig 1 a). QM/Jif-1 does not possess a leucine zipper but might compose a C2H2-type zinc finger (Fig 1 a). Retransformation of EGY48 yeast cells by pEGPS1 and pJGPS309-4 plasmids showed high ß-galactosidase activities in independent yeast colonies (Fig 1 b).
To determine the binding domain of PS1 molecule to QM/Jif-1, we performed deletion analysis of PS1 by two-hybrid assay. cDNAs corresponding to various regions of the PS1 molecule were subcloned into the pEG vector and cotransfected with pJG309-4 into yeast cells. Interestingly, any partial sequence of PS1 did not bind strongly to QM/Jif-1. Instead, full-length PS1 showed a strong interaction with QM/Jif-1 (Fig 1 c). This finding corresponds well to the results of Western blot analysis using human brains described below.
In Vivo Interaction between QM/Jif-1 and PS1
To verify the interaction between QM and PS1 in vivo, we performed immunoprecipitation assay with human brains, including those of familial and nonfamilial AD patients. Approximately 50 kD full-length PS1 was detected in the precipitates by
N and by
L from normal, disease control (amyotrophic lateral sclerosis), nonfamilial AD, and PS1-linked AD brains (Fig 2 a), whereas we could not observe clear bands corresponding to the cleaved PS1 fragments. This result in human brain, together with the results from two-hybrid deletion analyses (Fig 1 c), suggest that multiple regions in the full-length structure of PS1 are necessary for tight interaction with QM/Jif-1. This idea might have some relationship to the recent finding that NH2- and COOH-terminal PS1 fragments reassociate and form a stable complex (![]()
![]()
Interestingly, the band was visible but very weak in lanes 6 and 7 loaded with samples from PS1-linked AD patients (Fig 2 a). Compared with the PS1 bands in Western blot analysis using the same brain samples (Fig 2 b), it is not due to difference of the PS1 protein amounts among brain samples. Instead, it could be due to the difference of residual neurons where QM and PS1 may interact, among samples, or due to the difference in affinity of QM to normal and mutant PS1. In the reverse immunoprecipitation assay, we detected QM in precipitates by
N as well as by
L (Fig 2 c), reconfirming the interaction between PS1 and QM/Jif1 in vivo. We performed immunoprecipitation with nonimmune sera and with several nonspecific antisera using the same brain samples, but did not find QM or PS1 in the precipitates (data not shown).
PS1 and QM/Jif-1 Colocalize in Cortical Neurons
To observe the interaction between QM and PS1 in the brain morphologically, we performed immunohistochemical analyses. As QM expression has not been reported previously, we confirmed that the QM message is widely expressed in the brain by Northern blot analysis (Fig 3). At the light microscopic level, anti-QM polyclonal antibody stained the cytoplasm of neurons in the mouse cerebral cortex (Fig 4 a). To further characterize subcellular localization of the QM protein, we observed the mouse brain sample with electronmicroscopy and found that regions very close to tubular membrane structures, which possessed features of smooth endoplasmic reticulum, were predominantly stained (Fig 4b and Fig c). This subcellular localization of QM was exactly like that of PS1 reported to date (![]()
|
|
Next, we asked whether the QM and PS1 proteins are colocalized in the human brain neurons. Immunohistochemical analysis was performed with secondary antibodies conjugated to different sizes of gold particles and with the brain of a 37-yr-old woman who died due to loss of blood. We observed that the 5-nm grain of PS1 and 10-nm grain of QM were located very close to each other at the edge of smooth membrane structures in the cytoplasm of cortical neurons (Fig 4 d). Most of those structures seemed to be smooth endoplasmic reticulum, whereas some of them possessed the features of Golgi apparatus (data not shown). Fewer grains were observed also in the nucleus (Fig 4 e). Although the immunoreactivity was further reduced in the formaldehyde-fixed and paraffin-embedded tissues of nonfamilial or PS1-linked AD brains, we repeatedly found that these two grains were colocalized at membrane structure in the cytoplasm (Fig 4, fi).
PS1 Suppresses the Action of c-jun Homodimer
Next, we investigated the biological significance of the interaction between QM/Jif-1 and PS1. Jif-1 was isolated as a protein binding to c-Jun from a cDNA library screened with biotinylated c-Jun (![]()
![]()
![]()
To test this hypothesis, we performed cotransfection chloramphenicol acetyltransferase (CAT) assays with c-jun or c-fos expression vectors as the first effector plasmid, normal or mutant PS1 expression vectors as the second effector plasmid (Fig 5 a), and human collagenase (-517/-42) TKCAT vector containing TRE as reporter plasmid. We used F9 embryonic carcinoma cells in the assays because they possess almost no activated protein (AP)-1 activity (![]()
![]()
![]()
|
Among these possibilities, we obtained the simplest and clearest outcome. c-jun or c-jun/c-fos transactivated the CAT gene expression (Fig 5 b) as expected. The transactivation by c-Jun homodimer was suppressed by normal PS1 as well as mutant PS1, whereas the transactivation by c-Jun/c-Fos heterodimer was not affected by adding PS1 expression vectors (Fig 5, a and b). This suppressive effect was considered to be specific, because overexpression of a multipass transmembrane protein, glucose transporter 1 (GLUT1), which is known to move from the endoplasmic reticulum to the Golgi apparatus, did not suppress CAT activity (Fig 5 b). The weak transactivation by c-Fos, which might have been induced with a weak endogenous c-Jun activity, was not influenced by either normal or mutant PS1. These observations corresponded very well with the interacting behavior of QM to AP-1 molecules reported previously (![]()
To examine whether the effect of PS1 is mediated by TRE, we changed the reporter plasmid to those that contained only TRE (Fig 5 a). As expected, PS1 reproduced suppression of the c-Junmediated transactivation in collagenase 1x TRE CAT and metallothionein IIa 1x TRE CAT (Fig 5 c). These results supported our hypothesis that PS1 affects gene regulation by c-jun through TRE. Interestingly, by using 1x TRE CAT plasmids, we observed more clearly that the suppression of c-Juninduced transactivation was weaker in mutant PS1 than in normal PS1 (Fig 5 c).
PS1 Represses Transactivation by junD but Not by junB
Second, we tested whether PS1 affects transcriptional regulation by the other c-jun family members forming an AP-1 complex. Expression of junB and junD enhanced transcription from collagenase 1x TRE CAT reporter plasmid (Fig 5 d). Transactivation by junD was clearly suppressed by expression of normal and mutant PS1, whereas transactivation by junB was not affected (Fig 5 d). In this case, suppression of junD-mediated transactivation by normal PS1 was not remarkably different from that by mutant PS1 (Fig 5 d), in contrast to our observations with c-junmediated transactivation (Fig 5b and Fig c). In the CAT assays described above, we confirmed that expression of the c-Jun protein was not influenced by cotransfecting PS1, and that expression of normal and mutant PS1 proteins was equivalent (Fig 5 e). We summarized results from all the CAT assays described above with a histogram showing mean fold transactivations (Fig 5 f).
PS1 Promotes Translocation of QM/Jif-1 to the Nucleus
From the data described above, we hypothesized that PS1 somehow promotes translocation of the QM protein from the cytoplasm to the nucleus, inhibits the binding of c-Jun homodimer to TRE, and thereby suppresses transactivation by c-jun. We used a fluorescent protein (enhanced green fluorescent protein [EGFP]) fusion reporter plasmid to observe how intracellular transport of the QM protein is modulated by PS1, and observed that translocation of the fusion protein to the nucleus is actually accelerated by cotransfecting PS1 (Fig 6 a). On the other hand, coexpression of mutant (Met146Leu) PS1 did not remarkably promote the nuclear translocation.
|
It is interesting to note that the effects of PS1 on transcription and on protein transport were remarkable although the expression level of PS1 was not as high as that of PS1 (Fig 5 e), or as the endogenous expression level of QM/Jif-1 (data not shown). Considered with the function of PS1 assisting the nuclear transport of QM, transfected PS1 molecule might be recycled efficiently in cells, leading to the remarkable effect on c-Jun function via QM protein translocated to and accumulated in the nucleus.
Next, we performed gel mobility shift assays by using nuclear extracts prepared from F9 cells expressing AP-1 transcription factors with or without PS1. We found that PS1 suppresses the binding of c-Jun homodimer to TRE and very weakly suppresses that of JunD homodimer but not that of c-Jun/c-Fos heterodimer or JunB homodimer (Fig 6 b). Furthermore, normal PS1 suppressed the binding to TRE more efficiently than mutant PS1 (Fig 6 b). These findings are consistent with the results in CAT assay (Fig 5, af) and support the idea that the nuclear translocation of QM/Jif-1 is promoted by normal PS1 thereby inhibiting the binding of c-Jun homodimer to TRE.
We tested another possibility that PS1 inhibits JNK and thereby suppresses transactivation by c-jun (for review see ![]()
Mutation Attenuates Inhibition of c-junMediated Apoptosis by PS1
c-jun had been characterized as a protooncogene promoting cellular proliferation, whereas recent data indicate that c-jun is involved in some types of apoptosis. Expression of c-jun dominant negative mutants protects sympathetic neurons against cell death induced by NGF withdrawal, and the overexpression of c-jun itself triggers apoptosis in sympathetic neurons (![]()
![]()
![]()
![]()
![]()
Considering these previous data, we examined whether PS1 affects c-junmediated apoptosis. We used F9 cells for this analysis, since retinoic acid treatment induces apoptosis (![]()
![]()
|
The Putative Zinc Finger Domain Is Essential for Interaction with PS1
At the end of this study, we investigated the role of the putative zinc finger domain (zif) of QM/Jif-1 in interaction with PS1, in transcriptional regulation, and in apoptosis. First, we made various deletion constructs of QM/Jif-1 (Fig 8 a) and tested their binding to PS1 by pull-down assay. Normal or mutant (Met146Leu) PS1 radiolabeled with [35S]methionine by in vitro transcription/translation were interacted with GST fusion proteins of QM in vitro and pulled down by glutathione Sepharose 4B. Full-length QM interacted with normal PS1, whereas deletion constructs lacking zif did not bind to PS1 (Fig 8 b), indicating that this region is essential for interaction. Mutant PS1 binds to the GST-QM fusion proteins similarly. However, the ratio between the input and the pulled-down amounts was lower in mutant PS1 (60%) than in normal PS1 (95%).
|
Next, we tested whether deletion of zif affects transcriptional regulation. As QM/Jif-1 is abundantly expressed in all the cell lines, we designed a dominant negative experiment. We selected F9PS1 cells in which transfected QM is translocated to the nucleus. Eukaryotic expression vectors containing the deletion constructs of QM were cotransfected with c-jun, and QM expression vectors into F9PS1 cells. Transfection of full-length QM suppressed c-juninduced transactivation (Fig 8 c, lanes 2 and 3).
1 antagonized this suppression by QM. The CAT activities in cotransfection of
1 (Fig 8 c, lanes 4 and 5) was higher than those in c-juninduced transactivation (Fig 8 c, lane 2), suggesting that
1 antagonized endogenous QM in addition to transfected QM. This dominant negative effect was not observed in the other constructs without zif that cannot interact with PS1 (Fig 8 c, lanes 69). Therefore,
1 probably inhibits binding of QM to PS1 in a competitive manner and represses the function of QM, since
1 transported to the nucleus does not have a suppressive effect on c-Jun. Consistently, translocation to the nucleus of the GFP fusion protein was observed in
1 but not in the other deletion constructs lacking zif (Fig 8 d). Without transfecting c-jun expression vector, transactivation by
1 itself was not observed in F9PS1 cells, which do not express c-jun (data not shown).
Finally, we tested the role of zif in the c-junassociated apoptosis. F9PS1 cells were transfected with the vectors expressing deleted QM/Jif-1. Transfection of
1 increased the percentage of cell death induced by retinoic acid treatment, whereas the other constructs did not affect the apoptosis (Fig 8 e). This result again showed the dominant negative effect of
1 on apoptosis. Collectively, it was concluded that zif is essential for the interaction of QM with PS1 and for the effects of QM on c-Jun derived from the interaction.
| Discussion |
|---|
|
|
|---|
This study showed that PS1 binds to a negative cofactor of c-Jun, QM/Jif-1, and that PS1 regulates the functions of c-jun in transcription and cell death. Promotion of the nuclear translocation of QM/Jif-1 by PS1 seems to be the underlying mechanism that connects the first and second conclusions. A specific point in our results is that QM/Jif-1 binds to a full-length PS1. It was reported that most PS1 molecules are cleaved into two fragments which reassociate to form a heterodimer (![]()
![]()
![]()
So far, more than five molecules, including APP (![]()
![]()
![]()
![]()
![]()
Activation of c-jun, especially that mediated by JNK, has been suggested to participate in various types of cell death, including TNF- or Fas-induced apoptosis (![]()
![]()
![]()
![]()
![]()
![]()
However, there remain debates on the role of c-jun and JNK in the in vivo apoptosis. Although double gene disruption of Jnk1 and Jnk2 leads to severe dysregulation of apoptosis during development at specific regions in the brain, Jnk3 does not affect this apoptosis (![]()
![]()
The functions of normal and mutant PS1 in cell death reported so far are still difficult to combine (for review see ![]()
![]()
Suppression of c-Jun homodimer by PS1 might lead to a different outcome in signaling pathways other than the c-junmediated apoptosis examined in this study. For example, neurotrophins bind to tyrosine kinasetype membrane receptors and activate c-Jun through the mitogen-activated protein (MAP) kinase pathway. Many other trophic factors, including fibroblast (FGF), epidermal (EGF), platelet-derived (PDGF), and hepatocyte growth factors (HGF), induce similar signaling cascades and promote cell survival. In such a condition where the activation of c-Jun mainly contributes to survival, PS1 might promote apoptosis. Like neurotrophins which transduce survival and death signalings via the high affinity and low affinity receptors, respectively (for review see ![]()
In other words, our results might have proposed another type of explanation for why PS1 induces diverse effects on the cell fate. The PS1/QM/c-Jun cascade leads to the opposite outcome, survival or death, depending on the final effect of c-Jun, which is influenced by cellular conditions. Although it is not yet known which factors define the attitude of c-Jun in cells, other types of signaling cascades induced by PS1, including calcium release from endoplasmic reticulum (![]()
![]()
In the AD brains, which usually degenerate for more than several years, it is possible that both c-junassociated and c-junnonassociated neuronal deaths occur in various situations. Although apoptosis itself is a rather rapid process in a single neuron, it occurs in numerous neurons of the brain at random and so the mass degeneration of the brain proceeds gradually. Therefore, we are speculating that c-junmediated apoptosis influenced by PS1 might be an additive factor to modify neuronal fate in the AD brain, and could function in parallel with the amyloid deposition promoted by PS mutations as well as the pathogenic mechanisms mediated by other binding proteins.
| Footnotes |
|---|
I. Imafuku and T. Masaki contributed equally to this work. ![]()
| Acknowledgements |
|---|
|
|
|---|
We thank Dr. Roger Brent for allowing us to use the two-hybrid system and human embryonic brain cDNA library, Dr. A.I. Levey (Emory University School of Medicine, Atlanta GA) for
N and
L PS1 mAbs, Drs. S.S. Sisodia and G. Thinakaran (University of Chicago, Chicago, IL and Johns Hopkins University, Baltimore, MD) for providing
L, Drs. T. Asano and K. Inukai (University of Tokyo, Tokyo, Japan) for pCAGGS-GLUT1, and Dr. K. Kamakura (National Defense Medical College, Saitama, Japan) for support in immunohistochemistry. We are grateful to Dr. Gary Lewin (Max-Delbruck Center for Molecular Medicine, Berlin, Germany) for critical reading of the manuscript and for his useful advice.
This work was supported by grants (07558233 and 10670574) from The Ministry of Education, Culture and Sports of Japan for H. Okazawa.
Submitted: 21 January 1999
Revised: 30 August 1999
Accepted: 31 August 1999
1.used in this paper: Aß, ß-amyloid; AD, Alzheimer's disease;
L, anti-loop antibody;
N, antiNH2-terminal antibody; AP, activated protein; APP, amyloid precursor protein; CAT, chloramphenicol acetyltransferase; EGFP, enhanced green fluorescent protein; GLUT1, glucose transporter 1; GST, glutathione S-transferase; Jif, Jun-interacting factor; JNK, c-Jun NH2-terminal kinase; nt, nucleotide(s); PS1, presenilin 1; RT, reverse transcriptase; TRE, 12-O-tetradecanoylphorbol-13-acetate (TPA)-responsive element
| References |
|---|
|
|
|---|