Original Article

Integrin 2ß1 Mediates Isoform-specific Activation of p38 and Upregulation of Collagen Gene Transcription by a Mechanism Involving the 2 Cytoplasmic Tail

Correspondence to: Jyrki Heino, MediCity Research Laboratory, University of Turku, Tykistökatu 6A, FIN-20520 Turku, Finland. Tel:358-2-333-7005 Fax:358-2-333-7000 E-mail:jyrki.heino{at}utu.fi.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

Two collagen receptors, integrins 1ß1 and 2ß1, can regulate distinct functions in cells. Ligation of 1ß1, unlike 2ß1, has been shown to result in recruitment of Shc and activation of the Ras/ERK pathway. To identify the downstream signaling molecules activated by 2ß1 integrin, we have overexpressed wild-type 2, or chimeric 2 subunit with 1 integrin cytoplasmic domain in human osteosarcoma cells (Saos-2) lacking endogenous 2ß1. The chimeric 2/1 chain formed a functional heterodimer with ß1. In contrast to 2/1 chimera, forced expression of 2 integrin resulted in upregulation of 1 (I) collagen gene transcription in response to three-dimensional collagen, indicating that the cytoplasmic domain of 2 integrin was required for signaling. Furthermore, signals mediated by 2ß1 integrin specifically activated the p38 isoform, and selective p38 inhibitors blocked upregulation of collagen gene transcription. Dominant negative mutants of Cdc42, MKK3, and MKK4 prevented 2ß1 integrin–mediated activation of p38. RhoA had also some inhibitory effect, whereas dominant negative Rac was not effective. Our findings show the isoform-specific activation of p38 by 2ß1 integrin ligation and identify Cdc42, MKK3, and MKK4 as possible downstream effectors. These observations reveal a novel signaling mechanism of 2ß1 integrin that is distinct from ones previously described for other integrins.

Key Words: collagen, integrin, cytoplasmic domain, p38 MAPK

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

INTEGRIN type receptors bind extracellular matrix (ECM)¹ molecules and mediate cell adhesion, migration, and invasion during development, tissue repair, tumor invasion, and metastasis. They also act in concert with growth factor or cytokine receptors to regulate cell proliferation, differentiation, and survival (Hynes 1992 ; Clark and Brugge 1995 ). The relatively short cytoplasmic domains of the integrin and ß subunits do not have any intrinsic enzymatic activity, but integrin signaling is achieved by coupling signaling molecules, such as tyrosine kinases, to the cytoplasmic and transmembrane domains of the integrin subunits (Yamada and Miyamoto 1995 ). The ß cytoplasmic domains share conserved regions, whereas the cytoplasmic domains have highly divergent amino acid sequences (Laflamme et al. 1997 ). Integrins activate signaling pathways that are either common to all integrins or heterodimer specific (Giancotti 1997 ). Early integrin-triggered signaling events seem to be mediated by the cytoplasmic domains of the ß subunits. These include the tyrosine phosphorylation of the focal adhesion kinase (FAK) (Schaller et al. 1994 ) and recruitment of components of the actin-based cytoskeleton, such as -actinin and talin (Horwitz et al. 1986 ; Otey et al. 1990 ). In the next step, a large number of proteins with enzymatic activity, like kinases and GTPases, are recruited to the sites of adhesion. Activation of these signaling proteins is mediated both by the ß subunits and specifically by individual subunits (Howe et al. 1998 ).

The functions of cytoplasmic domains of various integrins are distinct. Cytoplasmic domains of 5 and L are not required for cell adhesion unlike those of 2 and 4. In the context of cell adhesion and migration, some of the cytoplasmic domains seem to be interchangeable (Kassner and Hemler 1993 ), whereas signaling events specific for each individual integrin heterodimer may be triggered by the cytoplasmic domains (Z. Zhang et al. 1995 ; Sastry et al. 1996 ).

Four members of the integrin family are known to bind collagens, namely 1ß1, 2ß1, 3ß1, and 10ß1 (Camper et al. 1998 ). 1ß1 and 2ß1 are considered to be the two major collagen binding integrins, whereas 3ß1 seems to function as an assisting receptor (DiPersio et al. 1995 ). The recently identified integrin 10ß1 is expressed on chondrocytes, but little is known about its biology (Camper et al. 1998 ). 1ß1 and 2ß1 are concomitantly expressed by many cell types but they may regulate different functions. Three-dimensional ECM culture systems provide means to study cell–matrix interactions in a more natural environment than the traditional monolayer culture (Grinnell 1994 ). The studies with three-dimensional collagenous matrices have shown that ligation of 2ß1 triggers MMP-1 expression (Langholz et al. 1995 ; Riikonen et al. 1995a ) and induces collagen gel contraction (Chan et al. 1992 ; Riikonen et al. 1995b ). In fibroblasts, contact to collagen also leads to the activation of protein kinase (PK) C- and NFB and that correlates with the upregulation of 2ß1 integrin and MMP-1 gene expression (Xu and Clark 1997 ), suggesting that these phenomena are mediated via 2ß1. On the other hand, 1ß1 integrin mediates downregulation of collagen 1(I) mRNA levels both in vitro and in vivo (Langholz et al. 1995 ; Riikonen et al., 1995; Gardner et al. 1999 ). A subset of integrins, including 1ß1, have been shown to activate the mitogen-activated protein kinase (MAPK) extracellular signal-related kinase (ERK) via recruitment of Shc and activation of Ras (Wary et al. 1996 ; Mainiero et al. 1997 ; Pozzi et al. 1998 ), suggesting that 1ß1 integrin is the collagen receptor that regulates cell proliferation in collagenous matrices. In contrast, 2ß1 appears to be unable to recruit Shc and activate this specific signaling pathway.

We have previously observed that overexpression of 2ß1 integrin prevents 1ß1-mediated downregulation of collagen 1(I) mRNA levels when cells are brought into the contact with collagen (Riikonen et al. 1995a ), but the molecular mechanism of this phenomenon has been unclear. To study the structural requirements of signaling via the distinct collagen receptors, we constructed a chimeric chain composed of the extracellular and transmembrane domains of 2 and the cytoplasmic domain of 1. Using this construct, we show here that the upregulation of collagen 1(I) mRNA levels is due to active signaling requiring the cytoplasmic domain of 2 subunit.

We have recently shown that in normal dermal fibroblasts three-dimensional collagen activates three distinct classes of MAPKs, i.e., ERK, c-jun NH₂-terminal kinase (JNK), and p38 (Ravanti et al. 1999 ). Ligation of 1ß1 has been shown to activate the ERK kinase pathway, but 2ß1 has not been previously linked to a specific MAP kinase pathway. Here, we report that the 2 cytoplasmic domain–dependent regulation of type I collagen mRNA levels requires p38 activity. We also show that the ligation of 2ß1 leads to the activation of p38 MAPK, especially its p38 isoform. The activation is dependent on the 2 chain cytoplasmic domain and the function of the downstream effectors Cdc42, MKK3, and MKK4 is required. These results indicate a crucial role for the p38 pathway in integrin 2ß1 signaling and provide novel insight on molecular mechanisms of integrin-specific signal transduction.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

Reagents
Herbimycin A, bisindoylmaleimide, KT5720, KT5723, SB 203580, PD 98059, and SKF 86002 were obtained from Calbiochem-Novabiochem Corp. Cycloheximide was obtained from Sigma Chemical Co. (R)-(+)-perillyl alcohol (POH) was obtained from Aldrich and anisomycin was obtained from Boehringer Mannheim. 2 integrin cDNA corresponding to nucleotides 1–4559 in the published sequence (Takada and Hemler 1989 ) and the X2C5PFNeo plasmid (Kawaguchi and Hemler 1993 ) were provided by Dr. M. Hemler (Dana Farber, Boston, MA). The pAWneo2 expression vector was provided by Dr. A. Weiss (University of California San Francisco, San Francisco, CA) (Ohashi et al. 1985 ). The oligonucleotides used were purchased from Kebo Lab. The glutathione-S-transferase (GST)–tagged ATF2 (residues 1–109) (Gupta et al. 1995 ), the pRSV-MKK3(ala) and pcDNA-MKK4(ala) expression plasmids (Raingeaud et al. 1996 ; Whitmarsh et al. 1997 ) were provided by Dr. R. Davis (University of Massachusetts, Worcester, MA), and flag-tagged p38 isoform expression vectors (New et al. 1998 ) were provided by Dr. J. Han (Scripps Research Institute, La Jolla, CA). The pCEV29RhoA^Asn19, pCEV29Rac1^Asn17, and pCEVCdc42^Asn17 were provided by Dr. J.C. Lacal (CSIC, Madrid, Spain). Bacterial expression of GST-ATF2 was done as described (Smith and Johnson 1988 ). The c-Jun protein was provided by Dr. E. Coffey (Åbo Akademi University, Turku, Finland). Bacterial expression of GST-ATF2 was done as described (Smith and Johnson 1988 ). Antibody against 2 integrin, 12F1 (Pischel et al. 1987 ) was provided by Dr. V. Woods (University of California, Medical Center, San Diego, CA). Polyclonal antisera against 1 integrin cytoplasmic tail (AB1934) was purchased from Chemicon International, Inc., and antibody against 1 integrin used in flow cytometry, SR-84, was a gift from Dr. W. Rettig (Boehringer Ingelheim, Germany).

Cell Culture
Human osteosarcoma cell line Saos-2 was obtained from the American Type Culture Collection. The cell cultures were maintained in DME supplemented with heat inactivated 10% FCS (GIBCO-BRL), 2 mM glutamine, 100 IU/ml penicillin-G, and 100 µg/ml streptomycin.

Plasmid Constructs and Stable Transfections
The 2 integrin expression construct was prepared as described previously (Riikonen et al. 1995a ). The mutant 2 subunit, in which the cytoplasmic tail has been replaced with the corresponding 1 integrin sequence, was prepared in the following way. A silent point mutation (nucleotide 3488 in the published sequence; Takada and Hemler 1989 ) that introduces a new NheI recognition site was made with the Altered sites II in vitro mutagenesis system (Promega) according to the manufacturer's instructions. The mutant oligo used was ACCAGAGCTAGCAGCAAAAGG. The 2 cDNA was digested with NheI and SacI cleaving the region corresponding to the 2 cytoplasmic tail. The 1 DNA was obtained by annealing sense and antisense synthetic nucleotides corresponding to nucleotides 3506–3543 in the published 1 sequence (Briesewitz et al. 1993 ) flanked with corresponding 2 sequences; antisense oligo (TTTTGCTGCTAGCTCTGGTTGCAATTTTATGGAAGCTCGGATTCTTCAAAAGACCA-CTGAAAAAGAAAATGGAGAAATGAGAGCTCAGTAGCTG), sense oligo (TCAGCTACTGAGCTCTCATTTCTCCATTTTCTTTTTCAGTGGTCTTTTGAAGAATCCGAGCTTCCATAAAATTGCAACCAGAGCTAGCAGCAAAA). This synthetic DNA fragment was digested with NheI and SacI restriction enzymes and ligated with the cleaved 2 cDNA. The correctness of the construct was checked by sequencing. Stable transfections were performed with the calcium polybren/DNA method on confluent 60-mm dishes. Incubation with 5 µg DNA and 5 µg polybren in 1 ml 10% FCS/DME per dish was carried out for 6 h, agitating the dishes once an hour. DMSO (30% in FCS) shock was done for 3 min, cells were washed twice with PBS, and culture medium was added. Neomycin analogue G418 (Life Technologies, Inc.) was added to the culture medium in a concentration of 400 mg/ml. G418-resistant cell clones were selected for 2–3 wk, isolated, and analyzed for their expression of 2 integrin. Control cells were transfected with the pAWneo2 plasmid only. Transfected cells were cultured in 10% FCS/DME containing 2 mM glutamine, 100 IU/ml penicillin-G, 100 µg/ml of streptomycin and 200 mg/ml G418.

Collagen Gels and Gel Contractions
Collagen gels were prepared from bovine dermal collagen, which contains 95% type I collagen and 5% type III collagen (Cellon). 8 vol of Cellon were mixed with 1 vol of 10x concentrated DME and 1 vol of 10x concentrated NaOH (0.05 M) in Hepes buffer (0.2 M) and kept on ice. Cells were trypsinized, resuspended in 1/10 gel volume culture media DME supplemented with 10% FCS, mixed into neutralized Cellon solution, and transferred into 6-well plates. The collagen was allowed to polymerize for 2 h at 37°C, after which the culture media containing 10% FCS was added, the gels were detached from the sides of the wells, and incubation was continued for the times indicated. Cells were also cultured on plastic as a monolayer in culture media containing 10% FCS. In experiments involving inhibitors, the cells were pretreated with the inhibitor for 30 min at room temperature before mixing the cells with the neutralized Cellon solution, also supplemented with the inhibitor at the concentrations indicated. After polymerization, culture media containing 10% FCS and the inhibitor was added and the gels were detached from the sides of the dishes. Incubation was continued for 48 h. When studying collagen gel contraction, cell culture wells were photographed after 48 h and the surface areas of the gels were measured from the prints.

Immunofluorescence
The cells grown on immunofluorescence glass slides (CML) covered or uncovered with collagen film (Cellon) were rinsed with PBS and fixed with methanol at -20°C for 5 min. The cells grown inside collagen gels were excised from culture wells, embedded in OCT compound (Tissue-Tek; Miles Scientific), and frozen in isopentane chilled with liquid nitrogen. Sections of 10-µM thickness were cut and picked up onto microscope slides and treated as described above. The slides containing the fixed samples were incubated in 2% BSA in PBS and monoclonal anti–CD49b antibody (Chemicon International Inc.) was added to the same solution and incubated 30 min at room temperature. After rinsing, the cells were incubated with anti–mouse–FITC conjugate (Dako A/S) for 30 min and mounted before observation and photography. For staining of the actin filaments, plastic coverslips (Nunc) were coated with PBS containing 16 µg/ml type I collagen overnight at 4°C and blocked with 1% BSA in PBS for 1 h at 37°C. Cells were allowed to adhere and spread on collagen coated coverslips for 24 h in DME. Coverslips were washed once with PBS and fixed with 2% paraformaldehyde, permeabilized with 0.5% Triton X-100 in PBS for 10 min, and incubated with rhodamine-conjugated phalloidin (Sigma Chemical Co.) 1:1,000 in PBS for 30 min. Cells were washed with PBS and mounted before observation and photography.

Northern Blot Hybridizations
Total cellular RNA was isolated using the Qiagen RNeasy kit. Total RNA was separated in formaldehyde-containing agarose gels, transferred to nylon membranes (Zeta-probe; Bio-Rad Laboratories), and hybridized with ³²P-labeled (Amersham) cDNA probes. The following cDNAs were used: human 2 integrin (Takada and Hemler 1989 ), human collagen 1(I) (Makela et al. 1988 ), human collagen 2(I) (Makela et al. 1990 ) and 28S (a gift from R. Penttinen, University of Turku), and rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Fort et al. 1985 ).

Flow Cytometry
Cells were grown to early confluence, detached with trypsin-EDTA, and trypsin activity was inhibited by medium supplemented with serum. Cells were washed with PBS, pH 7.4, and then incubated with PBS containing 10 mg/ml BSA, 1 mg/ml glycine, and 0.02% NaN₃ for 20 min at 4°C. Cells were collected by centrifugation, exposed to saturating concentration of mAb against 2 integrin (12F1) or 1 integrin (SR-84) in BSA/PBS (BSA concentration 1 mg/ml) containing NaN₃ for 30 min at +4°C, and stained with rabbit anti–mouse IgG coupled to fluorescein (1:20 dilution; Dako A/S) for 30 min at 4°C. Cells were washed twice with PBS containing NaN₃ and suspended in the same buffer. To measure the amount of 2 integrin on the cell surfaces, the fluorescent excitation spectra were analyzed by using a FACScan apparatus (Becton Dickinson). Control samples were prepared by treating the cells without primary antibodies.

Immunoprecipitation of Integrin from Metabolically Labeled Cells
Cells were metabolically labeled with 100 µCi/ml of [³⁵S]methionine (Tran[³⁵S]-label, ICN Biomedicals Inc.) for 16 h in methionine-free minimum essential medium. Cell monolayers were rinsed on ice with a solution containing 150 mM NaCl, 1 mM CaCl₂, 1 mM MgCl₂, and 25 mM Tris-HCl, pH 7.4, and then detached by scraping. Cell pellets were obtained by centrifugation at 500 g for 5 min. Cells were solubilized in 200 µl of the same buffer containing 100 mM N-octyl-ß-D-glucopyranoside (Sigma Chemical Co.) on ice with occasional vortexing. Insoluble material was removed by centrifugation at 10,000 g for 5 min at 4°C. Radioactivity in cell lysates was counted and an equal amount of radioactivity was used in immunoprecipitation assays. Triton X-100 (0.5% vol/vol) and BSA (0.5 mg/ml) were added to the supernatants, which were precleared by incubation with 50 µl of packed protein A–Sepharose (Pharmacia LKB Biotechnology Inc.). Supernatants were immunoprecipitated with antiintegrin antibody (12F1 or AB1934) for 12 h at 4°C followed by incubation with secondary antibody (rabbit anti–mouse, DAKO), when 12F1 was used. Immune complexes were recovered by binding to protein A–Sepharose and washing the beads four times with 25 mM Tris-buffered isotonic saline, pH 7.4, containing 0.5% Triton X-100 and 1 mg/ml BSA and twice with 0.5 M NaCl and 25 mM Tris-HCl, pH 7.4. The immunoprecipitates were analyzed by electrophoresis on SDS-containing 6% polyacrylamide gels under nonreducing conditions followed by fluorography.

Transcriptional Nuclear Run-on Analyses
The cells were lysed with NP-40 (ICN) and the nuclei were isolated by centrifugation (12,000 g) for 3 s at 4°C. The nuclei were incubated in the presence of 100 µCi of [-³²P]UTP (3,000 Ci/mmol, NEN) for 30 min at room temperature as described previously (Banerji et al. 1984 ). Radiolabeled RNA was hybridized with 2 µg of nitrocellulose-fixed plasmids: cDNAs for human 1(I) collagen, human 2(I) collagen, GAPDH, and pBluescript (Stratagene). The hybridization and washing conditions used were as described previously (Sistonen et al. 1992 ). Quantitation was performed with GS-250 Molecular Image System (Bio-Rad Laboratories) and the results were corrected for the levels of GAPDH transcripts in the same samples.

Cell Spreading Assays
The coating of a 96-well immunoplate (Maxi Sorp; Nunc) was done by exposure to 0.2 ml of PBS, pH 7.4, containing 0.1 µg/cm² (1.64 µg/ml) type I collagen (from lathyric rat skin, Boehringer Mannheim) for 12 h at 37°C. Residual protein absorption sites in all wells were blocked with 1% BSA in PBS for 1 h at 37°C. BSA was also used to measure the nonspecific binding. Cells were detached by using 0.01% trypsin and 0.02% EDTA. Trypsin activity was inhibited by washing the cells with 1 mg/ml of soybean trypsin inhibitor (Sigma Chemical Co.). In cell spreading assays, cells were suspended in DME with 50 mM cycloheximide (Sigma Chemical Co.), transferred into each well, and incubated for 35 min at 37°C. The wells were washed with PBS and fixed with 8% formaldehyde and 10% sucrose in PBS for 30 min. The total number of cells attached per one microscopic field and the percentage of spread cells were counted. A spread cell was characterized as one having a clearly visible ring of cytoplasm around the nucleus.

Assay of MAPK Activation
The activation of ERK1 and 2, JNK/SAPK, and p38 MAPK was determined by Western blotting using antibodies specific for the phosphorylated, activated forms of the corresponding MAPKs (New England Biolabs). The control blots for the total (phosphorylated and nonphosphorylated forms) protein levels were done by using antibodies recognizing the corresponding MAPKs (p38, ERK2, New England Biolabs; JNK1, Santa Cruz Biotechnology). Saos cell clones were either grown in monolayer for 24 h or seeded in collagen gels as described earlier. Once polymerized, the gels were detached from the dish and incubated for the time indicated. The cells were released from the gels as described above and lysed in 100 µl of Laemmli sample buffer. Cells grown in monolayer were washed once with warm PBS and lysed in 100 µl of Laemmli sample buffer. The positive control treatment for the JNK Western blot was done by treating cells in suspension with 10 µg/ml anisomycin (Boehringer Mannheim). The samples were sonicated, fractionated by 10% SDS-PAGE, and transferred to a Hybond ECL membrane (Amersham Corp.). Western blotting was performed as described previously (Reunanen et al. 1998 ), with phosphospecific antibodies in dilution 1:1,000. Specific binding of antibodies was detected with peroxidase-conjugated secondary antibodies and visualized by enhanced chemiluminescence (ECL) detection system (Amersham).

In Vitro p38 and JNK Kinase Assay and Western Blot Analysis of Flag-tagged Protein
Subconfluent Saos cell clones plated on 60-mm dishes were transfected using 4 µl of Fugene 6 transfection reagent (Boehringer Mannheim) and 2 µg of either eukaryotic expression vector alone (pcDNA3; Invitrogen Corp.) or the same vector containing the flag-tagged p38 isoform (New et al. 1998 ). Cotransfection of dominant negative signaling proteins was done by using 12–16 µl of Fugene 6, 3–8 µg of empty expression vector or the same vector containing the effector mutant and 2 µg of flag-tagged p38. 36 h after transfections, the cells were treated with collagen gel for 3 h as described earlier or left untreated. Cells were solubilized with RIPA buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 1 mM EGTA, 1 mM sodium orthovanadate, 20 mM sodium fluoride, 0.5 mM DTT, 1 mM PMSF in PBS, pH 7.4) supplemented with leupeptin, antipain, and pepstatin, 2 µg/ml each. The extracts were centrifuged 3,000 rpm for 15 min at 4°C. 1 µg of M2 antibody (Eastman Kodak Co.) conjugated to protein G–Sepharose (Pharmacia-LKB Biotechnology) was used for immunoprecipitation. The immunoprecipitates were washed twice with RIPA buffer, once with LiCl wash buffer (500 mM LiCl, 100 mM Tris, pH 7.6, 0.1% Triton X-100, 1 mM DTT) and once with kinase buffer (20 mM MOPS, pH 7.2, 2 mM EGTA, 10 mM MgCl₂, 0.1% Triton X-100, 1 mM DTT). The kinase assay was initiated with 2 µg GST-ATF2 as substrate and 50 mM MgCl₂, 25 µM ATP, 3 µCi -[³²P]ATP in a final volume of 50 µl. The reactions were terminated after 30 min at 37°C by the addition of Laemmli sample buffer. The phosphorylation of substrate protein was examined after SDS-PAGE by autoradiography. For Western blotting, samples of lysed cells were fractionated by 10% SDS-PAGE and transferred to Hybond ECL membrane (Amersham Corp.). Western blotting was performed as described previously (Reunanen et al. 1998 ), with M2 antibody (Eastman Kodak Company) in dilution 1:750. Specific binding of antibodies was detected with peroxidase conjugated secondary antimouse antibody and visualized by the ECL detection system (Amersham).

The JNK kinase assay was done as described in Westermarck et al. 1998 with some modifications, namely the antibody used was anti-JNK1 (Santa Cruz Biotechnology) and the immunoprecipitation was done with protein G–Sepharose. The cells were brought into suspension, counted, and diluted so that equal number of cells from both clones were used. The cells were then either lysed immediately, treated with anisomycin for 10 min or seeded inside collagen for 3 h.

Immunoprecipitation of FAK and Western Blot Analysis
The cells were brought into suspension, counted, and diluted so that equal number of cells from both clones were used. The cells were either lysed immediately or allowed to adhere to fibronectin (1 µg/cm² coated on a 60-mm dish overnight at +4°C and blocked with 0.1% heat-inactivated BSA for 1 h at +37°C) or seeded inside collagen for 1 h. The assay was done as described previously (Elenius et al. 1997 ). The antibody used for immunoprecipitation was polyclonal anti-FAK (Upstate Biotechnology Inc.). The filter was first blotted with antiphosphotyrosine (4G10; Upstate Biotechnology Inc.), stripped according to manufacturer's instructions, and reprobed with anti–FAK antibody. Alternatively, total cell lysates were fractionated by SDS-PAGE and the filter was first blotted with an antibody mixture detecting all the phosphorylated forms of FAK (Biosource, Hopkinton, MA), following stripping and re-probing with anti-FAK antibody.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Acknowledgements References

Chimeric 2/1ß1 Integrin Functions like the Wild-type 2ß1 Receptor in the Formation of Focal Contacts
Initially, we made stable transfectants expressing wild-type 2 or chimeric 2/1 subunit using Saos-2 cells, which have endogenous 1ß1 but no 2ß1 (Vihinen et al. 1996 ). Flow cytometric analysis using anti–2 mAb (Figure 1 B) confirmed that both the wild-type and the chimeric receptor were expressed on the surface of the transfected cells. Based on the flow cytometric measurements, we selected cell clones with similar expression levels of wild-type 2 or chimeric 2/1 integrin to be used in the experiments (Figure 1 B). Also, the cell clones used in the experiments and not shown in the Figure 1 B were tested. In addition, we measured the expression levels of 1ß1 from both mock-transfected and 2-transfected cells to ensure that the 2 cDNA transfections did not alter the expression of the endogenous 1ß1. The average levels of 1 integrin on four independent single cell clones tested were 60.8 ± 3.8 (arbitrary units) in mock-transfected cells and 68.3 ± 8.6 in 2-transfected cells. The corresponding values for 2 integrin were 13.5 ± 0.7 (represents negative background level fluorescence) and 362 ± 54. Immunoprecipitation experiments were performed to confirm that the chimeric 2/1 subunit was associated with the endogenous ß1 subunit to form a typical heterodimeric ß complex. The chimeric structure of the heterodimer was verified using an antibody recognizing the 1 cytoplasmic tail (not shown).

View larger version (16K): [in this window] [in a new window]   Figure 1. (A) The cDNA constructs used in the transfections. (B) Flow cytometry analysis showing surface expression of 2 integrin subunit. The stable transfected cell clones were exposed to saturating concentration of monoclonal antibody against 2 integrin (12F1). Bound antibody was detected with FITC-conjugated rabbit anti–mouse IgG.

Deletion of the 2 cytoplasmic domain has been shown to result in ligand-independent recruitment of the integrin to preformed focal contacts (Kawaguchi et al. 1994 ). To study if swapping of the 2 cytoplasmic domain to the significantly shorter 1 tail results in indiscriminate integrin recruitment into focal adhesion sites formed by other integrins, we studied both wild-type 2 and chimeric 2/1 in Saos-2 cells spread on serum proteins. Both clones showed a diffuse staining pattern indicating that the receptors do not localize to focal contacts ligand independently (Figure 2 A, a and b). When these clones were allowed to adhere to and spread on collagen in serum-free conditions both wild-type and chimeric receptors were able to form focal contacts (Figure 2 A, c and d) indicating that the 2 chain cytoplasmic tail can be replaced with the corresponding 1 sequence without affecting cellular localization of the receptor. Also, the formation of actin stress fibers on collagen was similar in both clones (Figure 2 B). In cells cultured inside three-dimensional collagen, no aberrant clusters of integrins were seen and both receptors showed a diffuse staining pattern (Figure 2 A, e and f).

View larger version (108K): [in this window] [in a new window]   Figure 2. Characterization of the cellular location of 2 and 2/1 integrin and formation of actin stress fibers. Stable Saos-2 transfectants were either grown in DME 10% FCS on immunofluorescence glass slides, plated on collagen coated glass slides, and allowed to adhere for 4 h in DME (serum-free) or grown inside a three-dimensional collagen gel for 48 h. (A) After incubation, the cells were fixed and stained for 2 integrin by using mAb followed by FITC-labeled rabbit anti–mouse antibody. Cells were washed, mounted, and examined on a microscope: (a) 2 clone 47 and (b) 2/1 clone 18 on serum-derived fibronectin and vitronectin; (c) 2 clone 47 and (d) 2/1 clone 18 on collagen; (e) 2 clone 47 and (f) 2/1 clone 18 inside collagen gel; and (g) vector clone as a negative control. (B) Cells were stained for actin using fluorescein-conjugated phalloidin (a) 2 clone 47 and (b) 2/1 clone 18 on collagen.

2 Cytoplasmic Tail Is Required for Fast Spreading on Collagen and Collagen Gel Contraction
Cell adhesion to type I collagen was studied to determine the effect of swapping the tails on the adhesive properties of the integrin. Adhesion mediated by the chimeric 2/1ß1 receptor was found to be equivalent to that of the wild-type receptor (Figure 3 A). Both the wild-type 2-transfected cells and the 2/1 chimera–transfected cells adhered to collagen at the early time point studied (1 h) more efficiently than the mock-transfected cells. When studying focal contact formation by 2 wild-type and chimeric 2/1–transfected clones, we noticed that even though cell adhesion to collagen was not influenced by the replacement of the 2 cytoplasmic tail with the 1 tail, the efficiency of the clones to spread on collagen was somewhat different. The cells expressing 2 wild-type receptor spread faster than cells expressing 2/1 chimeric receptor, so that after 30 min on collagen 61.5 ± 6% of adherent 2-transfected cells had spread, whereas only 43 ± 8.3% of adherent 2/1–transfected cells had spread (Figure 3 B). At this early time point, mock-transfected cells expressing only 1ß1 had just begun to adhere and virtually no spreading was seen. At later time points (i.e., 2 h and later), also the mock-transfected cells spread efficiently on collagen. Since both 2 wild-type and 2/1 chimeric receptor were expressed at similar levels on the cell surface (Figure 1 B), the small difference seen in cell spreading may indicate that the cytoplasmic tail of 2 functions in linking the integrin to the cytoskeleton in a manner promoting spreading on collagen. Therefore, we wanted to study the ability of 2 cytoplasmic tail to mediate cytoskeleton-dependent events and assayed the ability of 2- and 2/1–transfected cells to contract collagen gels. As expected, vector control cells, having endogenous 1ß1 but no 2ß1, showed very weak contraction during the 72-h experiment (area of the gel 1.8 ± 0.35-fold reduced), whereas wild-type 2ß1-expressing cells contract the gel efficiently (area of the gel 4.0 ± 1.0-fold reduced) (Figure 3 C). The cytoplasmic tail of 2 seemed to be essential for linkage of the integrin to the cytoskeletal machinery since the cells expressing chimeric 2/1 failed to contract the collagen gel (Figure 3 C).

View larger version (23K): [in this window] [in a new window]   Figure 3. Cell–collagen interaction of stable transfected human osteosarcoma Saos-2 expressing wild-type 2 integrin, chimeric 2/1 integrin or empty vector. The data shown are the mean values ± SD of a representative experiment done in triplicate. (A) Cell adhesion to type I collagen was studied. 10,000 cells were suspended in DME (serum-free), then transferred into wells coated with indicated concentrations of type I collagen. After 1 h the nonadherent cells were washed out and the adherent ones were stained with crystal violet. Cell-bound stain was dissolved and measured spectrophotometrically. (B) Cell spreading on type I collagen and fibronectin was studied. 10,000 cells were suspended in DME with 50 µM cycloheximide, and then transferred into wells coated with different matrixes. After 30 min the nonadherent cells were washed out and the adherent ones were fixed. The percentage of spread cells was counted. (C) The ability of various collagen receptor integrins to mediate collagen gel contraction was tested using stable transfected clones of human osteosarcoma Saos-2 cells (mock-, 2-, or 2/1–expressing clones). 5 x 105 cells were seeded inside a collagen gel, the polymerized gel was detached from the sides of the dish and the cells were cultured for 3 d in DME 10% FCS. The gels were photographed and surface areas of the gels were measured.

Integrin 2 Cytoplasmic Tail Is Required for the Upregulation of Collagen 1(I) and 2(I) Gene Expression at the Transcriptional Level
Overexpression of the wild-type 2 in Saos-2 cells resulted in upregulation of the mRNA levels of both collagen 1(I) (1.4–4.3-fold) and 2(I) (3.3-fold) in response to three-dimensional collagen matrix. To test the generality of this observation, all together three independent single cell clones overexpressing 2ß1 were tested (not shown). In contrast, vector control cells showed a downregulation ranging from 0.8 to 2.4-fold for collagen 1(I) mRNA (Figure 4a and Figure b). Interestingly, the chimeric receptor failed to mediate upregulation of the collagen mRNAs in response to three-dimensional collagen matrix as seen with the Northern blot hybridization of total RNA isolated from two single cell clones pooled together. The mRNA levels of collagen 1(I) in cells expressing the chimeric receptor were downregulated by 1.5–1.8-fold in response to collagen compared with the average 3.6-fold upregulation seen in cells expressing the 2 wild-type receptor (Figure 4a and Figure b). Also, expression of collagen 2(I) was downregulated in the 2/1–transfected cells. These results were again confirmed to be reproducible with RNA from a third independent single cell clone (not shown). Altogether, cells transfected with the chimera responded to collagen identically to the mock-transfected cells. Integrin 1ß1 is known to function as a negative regulator of collagen (Langholz et al. 1995 ; Riikonen et al. 1995a ). The transmembrane region of this receptor has been suggested to signal through interaction with caveolin (Wary et al. 1996 ), whereas the possible signaling function of 1 cytoplasmic domain cannot be excluded. In the 2/1–transfected cells, no further reduction of collagen levels was seen when compared with the mock-transfected cells having endogenous 1ß1 integrin, suggesting that the short 1 cytoplasmic tail is not alone sufficient to regulate collagen gene expression. To test this further, we transfected Saos-2 cells with the X2C5PFNeo plasmid coding for 2 subunit with 5 cytoplasmic tail (Kawaguchi and Hemler 1993 ). Again, similarly as both the mock-transfected and the 2/1–transfected cells, collagen mRNA levels were decreased in response to collagen (not shown).

View larger version (94K): [in this window] [in a new window]   Figure 4. Effect of matrix on the expression level of collagen 1(I) and collagen 2(I) mRNAs, transcriptional regulation and mRNA stability of collagen 1(I) in Saos-2 cells expressing either wild-type 2 or chimeric 2/1 integrin. Mock-, 2-, and 2/1–transfected cells were cultured in a monolayer (M) or inside collagen gel (C) for 48 h. Total RNA was isolated, separated by electrophoresis, and transferred to filters. Specific mRNA levels were analyzed with corresponding cDNA probes. 28S ribosomal RNA was used as a control. (A) Autoradiograms of a representative experiment and (B) quantitative analysis of an identical separately performed experiment was done by an image analyzer. (C) Nuclear run-on assay was performed with nuclei from Saos-2 cells grown either in monolayer or inside three-dimensional collagen gels 48 h before harvest. Nascent 32P-labeled RNA was hybridized to nitrocellulose filter-immobilized cDNA probe. Quantitative analysis was performed with an image analyzer system. The values for the collagen 1(I) gene transcription were corrected to GAPDH transcription in the same sample. The data shown are mean ± range of a representative experiment done in duplicate. (D) mRNA stability assay using actinomycin. Cells were cultured for 24 h before adding actinomycin D (6.4 µg/ml) either inside collagen gel or in monolayer. Total RNA was isolated from cells after 8 h. Autoradiograms from Northern blot analysis using collagen 1(I) cDNA and 28S cDNA as control are shown. Quantitative analysis of the experiment was done with an image analyzer system.

To assess the contribution of increased transcription of collagen 1(I) on this elevation seen in mRNA levels, we performed nuclear run-on experiments. Nuclei were isolated from 2- or 2/1–transfected cells grown either in monolayer or in three-dimensional collagen gel for 48 h. The rate of the collagen gene transcription was compared with that of GAPDH. A 1.8-fold increase of transcription was seen in 2-transfected clones cultured in three-dimensional collagen when compared with the rate of transcription in cells grown in monolayer (Figure 4 C). In contrast, cells transfected with the chimeric 2/1 chain showed a 1.5-fold decrease in transcription rate (Figure 4 C). Even though the increased transcription rate of collagen 1(I) gene accounted for most of the upregulation seen in 2ß1-overexpressing clones, we also wanted to investigate the stability of the mRNAs. We used actinomycin D to block transcription in cell clones grown in monolayer and in collagen gels. Type I collagen mRNAs seem to have relatively long half-lives (>8 h) in Saos-2 cells transfected with wild-type 2, but no obvious difference was seen between the various culture conditions. Both in monolayer and in three-dimensional matrix collagen, mRNA levels were reduced by ~50% after 8 h treatment with actinomycin D (Figure 4 D).

2ß1 Integrin-mediated Upregulation of Collagen 1(I) Expression in Three-Dimensional Collagen Requires p38 MAP Kinase Pathway
To identify the downstream components of 2ß1-mediated upregulation of collagen gene expression, we tested specific inhibitors at concentrations sufficient to inhibit various signaling kinases (Alessi et al. 1995 ; Dudley et al. 1995 ; Broberg and Heino 1996 ). The cells were exposed to inhibitors before seeding them inside collagen. Of the various compounds tested, the p38 inhibitor, SB203580, showed the most potent inhibition of collagen 1(I) gene expression (5.5-fold) in 2ß1-overexpressing cells grown in three-dimensional collagen gel (Figure 5 A). The compounds that showed some inhibition (about twofold) included tyrosine kinase inhibitor herbimycin A, PKG inhibitor KT5823, PKA inhibitor KT5720, and Ras farnesylation inhibitor (R)-(+)-Perillyl alcohol (POH), whereas MEK inhibitor PD98059 had no effect. High concentrations of the PKC inhibitor bisindolylmaleimide resulted in downregulation of collagen mRNA levels (twofold at 5 µM and 4.1-fold at 20 µM concentrations), but this effect was seen in both 2- and mock-transfected cells and was therefore considered to be nonspecific. In addition, phosphatidyl-inositol-3-kinase (PI-3K) inhibitor, wortmannin treatment resulted in a slight reduction of collagen 1(I) mRNA in 2-transfected cells (not shown) and this effect was smaller in vector-transfected cells (Figure 5 A). The small effects of various inhibitors suggest that corresponding signaling proteins might participate in integrin signaling, but this hypothesis was not studied further. Another specific inhibitor targeting the p38 MAP kinase pathway, SKF86002, was tested to confirm the result obtained with SB203580. Treatment with this compound also resulted in concentration-dependent inhibition of 2ß1-mediated upregulation of collagen 1(I) mRNA levels (6.1-fold at 10 µM and 9.5-fold at 20 µM). 20 µM SB203580 was a potent inhibitor of collagen mRNA levels in 2-transfected cells inside collagen (Figure 5 B), but it had no effect on mRNA levels in mock-transfected cells inside collagen (Figure 5 A) or 2-transfected cells in monolayer (Figure 5 C), excluding the possibility that the compound could function as a general downregulator of collagen gene expression.

View larger version (116K): [in this window] [in a new window]   Figure 5. Effects of different signaling pathway inhibitors on the expression level of collagen 1(I) and collagen 2(I) mRNAs. Cells were cultured in a monolayer or inside collagen gel for 2 d in the presence of inhibitors indicated (20 µM SB203580, 40 µM PD98059, 35 nM herbimycin A, 150 nM KT5723, 100 nM KT5720, 100 µM and 500 µM (R)-(+)-Perillyl alcohol (POH), 10 and 20 µM SKF86002). Total RNA was isolated, separated by electrophoresis, and transferred to filters. Specific mRNA levels were analyzed with corresponding cDNA probes. 28S ribosomal RNA was used as a control. (A) Cells from two separate single cell 2 clones 45 and 47 were pooled together for the study, autoradiograms are shown. (B) The effect of SB203580 on the expression level of collagen 1(I) mRNA was studied with mock-transfected clones 3 and 15, and 2 clones 45 and 47 cultured inside collagen gel for 48 h, quantitative analysis of the expression levels relative to collagen gel control levels are shown. The data are mean of two separate experiments each with a different single cell clone ± range. (C) Autoradiogram showing the effect of SB203580 on the expression level of collagen 1(I) mRNA in 2 clone 47 grown in a monolayer for 48 h.

Three-dimensional Collagen Gel Induce Isoform Specific Activation of p38 in Saos-2 Cells and the Efficient Activation Requires 2 Cytoplasmic Tail
The ability of the selective p38 inhibitors, SB203580 and SKF86002, to inhibit 2 cytoplasmic tail–dependent upregulation of collagen mRNA levels lead us to study how p38 activity is regulated in response to collagenous matrix in these cells. We examined the activation of p38 by using a phosphospecific antibody that recognizes phosphorylated p38 and p38ß isoforms. The cells expressing wild-type 2 showed a marked activation (fivefold) already at 2 h after seeding the cells inside collagen. The activation gradually decreased during the next 12 h, but remained at levels threefold higher than the 0 h time point (Figure 6 A). To study whether this activation was due to signaling via the 2ß1, we analyzed the levels of phosphorylated p38 in cells expressing chimeric 2/1 chain. In three separate experiments using different single cell clones, the wild-type 2-expressing cells showed in average 2.3-fold higher levels of active p38 2 h after seeding the cells inside collagen gel than cells expressing chimeric 2/1 chain. Protein levels of p38 remained constant at all time points, as shown with the control antibody recognizing both activated and inactivated forms of p38ß (Figure 6 B). At a later (24 h) time point, the p38 activation persisted and 2-transfected cells showed a higher level of activation than the cells expressing chimeric 2/1 chain (Figure 6 C). To confirm this difference in the levels of active p38 at the 24-h time point, the experiment was repeated five times using four or five parallel samples and two individual single cell clones of both transfections. In all experiments, p38 was activated in response to three-dimensional collagen and, in cells expressing the wild-type 2 chain, the levels were on average 1.9-fold higher (range, 1.3–3.5-fold). The difference in levels of active p38 between the 2 and 2/1 cells were found to be statistically significant when the results of all five experiments were combined together (two-way analysis of variance; P < 0.0001). Finally, to confirm that this difference is the result of signals dependent on the 2 cytoplasmic tail in response to collagen, we tested the levels of active p38 in the same cell clones when grown in monolayer. The overall levels of active p38 were relatively low and no significant difference between the clones was detected (Figure 7 D).

View larger version (60K): [in this window] [in a new window]   Figure 6. The regulation and isoform-specific activation of p38 by 2ß1 integrin in response to matrix. (A) Cells from two separate 2 single cell clones (45 and 47) were pooled together and seeded in collagen gel and incubated for different periods of time, as indicated. The levels of activated p38 and p38ß (p38-P) were determined by Western blot analysis using a phosphospecific antibody for p38 and ß, antibody recognizing all forms of p38 was used as a control. The levels of activated p38 were quantitated by using an image analyzer system and are shown relative to the levels of total p38 present in each sample. (B) To test the role of the 2 cytoplasmic tail, the experiment was done with 0 h in the 2-h time points using both 2-transfected clones (45 and 47) and 2/1–transfected clones (12 and 2). The levels of activated p38 were quantitated by using an image analyzer system and are shown relative to the levels of total p38 present in each sample. The data are mean of three separate experiments with different single cell clones ± SD. Autoradiogram of a representative experiment done in duplicate showing p38-P levels at 2-h time point is shown. (C) Levels of active p38 after 24 h culture of cells inside collagen gel. The data shown are mean ± SD of a representative experiment done in quadruplicate. **, P < 0.001. (D) Activation of p38 in 2 and 2/1–transfected Saos-2 cells grown on a monolayer. Cells from two separate 2 cell clones (45 and 47) or 2/1 clones (2 and 12) were pooled together and grown in a monolayer for 24 h. (E) Equal numbers of stable transfected Saos-2 cells were transiently transfected with flag-tagged p38 isoforms (, ß2, , or ) and treated and assayed for p38 kinase activity. The levels of phosphorylated ATF-2 were quantitated using an image analyzer system and are shown as levels of ATF-2 phosphorylation with background correction (signal from control transfected cells subtracted). 2 clone 45 and 2/1 clone 12 were transfected with either the control vector or the p38 isoforms indicated (F) 2 clones (45 and 47) and 2/1 clones (2 and 12) were transfected with control vector, p38, or p38ß2. Expression of the two flag-tagged isoforms was checked with Western blot analysis using flag-tag recognizing antibody M2.

View larger version (12K): [in this window] [in a new window]   Figure 7. The effect of p38 inhibitors SB203580 and SKF86002 on the various p38 isoforms. Equal numbers of stable transfected Saos-2 cells were transiently transfected with flag-tagged p38 isoforms (, ß2, , or ). 36 h after transfection, the cells were detached from the plate and seeded inside collagen gel. After 3 h of incubation, the cells were collected and lysed, and flag-tagged p38 was immunoprecipitated. Before adding the ATF-2 protein as a substrate to the kinase reaction the inhibitors or DMSO (control) were added. Levels of phosphorylated ATF-2 are shown.

To date, the p38 MAP kinase group is known to include five isoforms: p38 (Lee et al. 1994 ), p38ß (Jiang et al. 1996 ), p38ß2 (Enslen et al. 1998 ), p38 (Cuenda et al. 1997 ), and p38 (Jiang et al. 1997 ; X.S. Wang et al. 1997 ). To study whether 2ß1 cytoplasmic tail could specifically activate some isoform of p38, we overexpressed various forms of flag-tagged p38 kinases (New et al. 1998 ) in Saos cell stable clones expressing either wild-type 2 or chimeric 2/1. The transfected cells were seeded inside a collagen gel, after 3 h the cells were collected, flag-tagged p38 was immunoprecipitated, and an in vitro kinase assay was performed. As seen in Figure 6 E, p38 isoform was activated efficiently in 2-transfected cells (activity 0.47 units; arbitrary units = densitometric units - background), whereas in 2/1–transfected cells the activity was 0.03. No activation of p38ß2 was detected (2 clone 45 = 0.04 and 21 clone 12 = 0.02). p38 showed high activity in both cell clones (2 clone 45 = 0.24 and 2/1 clone 12 = 0.32) and p38 activity was high in both clones (2 clone 45 = 0.64 and 2/1 clone 12 = 0.23). The results were confirmed with two individual 2- or 2/1–expressing clones (Figure 6 F). The expression levels of the transiently transfected kinases in various clones were equal as shown by Western blot analysis done by using antibody against the flag-tag.

The Effect of p38 Inhibitors SB203580 and SKF86002 on the Various p38 Isoforms Expressed in 2-Transfected Saos-2 Cells
As seen in Figure 6E and Figure F, p38 was activated only in 2-transfected cells and no activation of p38ß2 was seen. However, equally high activity of p38 was seen in both 2- and 2/1–transfected cells and the p38 activity was higher in 2 cells than in 2/1 cells. To study which of these activated kinases are relevant to the 2-mediated upregulation of collagen, shown to be inhibited by chemical inhibitors (SB203580 and SKF86002), we tested the effect of these inhibitors in an in vitro kinase assay. 2-transfected Saos-2 cells were transiently transfected with flag-tagged p38 isoforms (, ß2, , or ), the cells were treated with collagen and the kinase activity of each isoform was measured in the presence or absence of the inhibitory compound. In accordance with previously published experimental data and recent structural evidence (Kumar et al. 1997 ; Whitmarsh et al. 1997 ; Lisnock et al. 1998 ) the inhibitor SB203580 had no effect on the and isoforms of p38 (Figure 7). Previously, SKF86002 has been shown to inhibit p38 (Lee et al. 1994 ) and we show here that it has no effect on the and isoforms. From these results we can conclude that it is the p38 isoform that is essential in the 2ß1 integrin–dependent upregulation of collagen.

Collagen Gel Induces Transient Activation of ERK1 and 2 but not JNK/SAPK in Both the 2- and 2/1–Transfected Cells
We have recently shown that seeding dermal fibroblasts inside three-dimensional collagen gels results in activation of ERK1 and 2, JNK/SAPK, and p38 MAPKs (Ravanti et al. 1999 ). Therefore, we examined also the activation of ERK1 and 2 and JNK/SAPK in both 2- and 2/1–transfected Saos-2 cells by Western blot analysis of cellular proteins, using phosphospecific antibodies to detect activated forms of these MAP kinases. The levels of activated ERK2 were increased 2 h after seeding the cells inside collagen (3-fold in 2 and 1.5-fold in 2/1 cells) and they increased further (up to 4-fold in 2 and 7-fold in 2/1 cells) at 6 h time point. This activation in response to the collagen gel was transient in both clones since no phosphorylated ERK1 or 2 was detected at 12-h time point. Protein levels of ERK2 remained constant at all time points, as shown with the antibody recognizing all forms of ERK2 (Figure 8 A). Low levels of ERK1 were also detected at 2-, 4-, and 6-h time points. No induction in the levels of phosphorylated JNK/SAPK was seen in these cells in response to three-dimensional collagen. Some activated JNK/SAPK was seen at 0-h time point, immediately after trypsinization but no active protein was detected inside collagen gel. Treatment with anisomycin was used as a positive control for JNK activation. Protein levels of JNK1 remained constant at all time points, as shown with the antibody recognizing all forms of JNK1 (Figure 8 B). The results with the phosphospecific antibodies were confirmed with a JNK in vitro kinase assay. Endogenous kinase was immunoprecipitated with anti–JNK1 antibody recognizing also JNK2 and 3 and recombinant c-Jun protein was used as a substrate (Figure 8 C).

View larger version (22K): [in this window] [in a new window]   Figure 8. Regulation of ERK and JNK MAPKs in response to collagen gel. Cells from two separate 2 or 2/1 single cell clones (45, 47 and 2, 12) were pooled together and either lysed immediately (0 h sample) or seeded in collagen gel and incubated for different periods of time, as indicated. (A) The levels of activated ERK1 and 2 (ERK1-P and ERK2-P) were determined by Western blot analysis using a phosphospecific antibody for ERK1 and 2 and an antibody recognizing all forms of ERK2 was used as a control. The levels of activated ERK1 and 2 were quantitated using an image analyzer system and are shown relative to the levels of total ERK2 present in each sample. (B) The levels of activated JNK1 and 2 were determined by Western blot analysis using a phosphospecific antibody for JNK1 and 2, and an antibody recognizing all forms of JNK1 was used as a control. The positive control treatment (+) was 10 min anisomycin (10 µg/ml). For the kinase assay, equal numbers of stable transfected Saos-2 cells (2 or 2/1) were either lysed immediately after trypsinization, treated with collagen for 3 h or anisomycin (10 µg/ml) for 10 min, and the JNK kinase activity was assayed.

Three-dimensional Collagenous Matrix Fails to Activate FAK
Ligation of integrins leads to activation of FAK. To check whether FAK would play a role in the activation of p38 in response to three-dimensional collagen, we allowed both 2- and 2/1–transfected cells to interact with collagen gels for 1, 2, or 3 h. (Figure 9 or not shown). The polymerization of the collagen gel takes place in 1 h, so shorter time points could not be studied. No phosphorylated FAK was detected in cells treated with collagen, in contrast to cells from both clones adhering to fibronectin (Figure 9). Some phosphorylation of FAK was seen in cells lyzed immediately after trypsinization. The experiment was repeated with similar results by using antibodies recognizing all phosphorylated forms of FAK (Figure 9). In the lower panel of Figure 9 phosphorylated FAK is the upper band. The lower band seen in all samples could not be recognized by anti–FAK antibody and its identity is unknown.

View larger version (56K): [in this window] [in a new window]   Figure 9. Three-dimensional collagenous matrix fails to activate FAK in Saos-2 cells. Cells from two separate 2 or 2/1 single cell clones (45, 47 and 2, 12) were pooled together and either lysed immediately (0 h sample), seeded in collagen gel, or allowed to adhere to fibronectin for 1 h. FAK was immunoprecipitated and immunoplotted with an antiphosphotyrosine antibody (4G10). Alternatively, cell lysates were fractionated on SDS-PAGE and immunoblotted with phosphospecific FAK antibody. The blots were reprobed with anti–FAK antibody to show the levels of FAK protein. Note that in the lower panel the anti-phospho FAK antibody recognizes two bands, but it is the upper one that comigrates with the band recognized with the anti–FAK antibody. The origin of the lower band is unknown.

Effect of Inhibitors of GTPases and MAPKKs on 2ß1-mediated Activation of p38
To investigate possible downstream effectors of 2ß1 integrin in the activation of p38, we used dominant negative mutants of the Rho family GTPases and the p38 upstream kinases, MKK3 and MKK4. The effector mutants or an empty vector in control cells were cotransfected with the flag-tagged p38 into the 2-expressing cells and, 36 h after transfection, the cells were exposed to three-dimensional collagen and an in vitro p38 kinase assay was performed. Of the Rho family GTPases Cdc42 seemed essential for 2ß1-mediated signaling since dominant negative Cdc42 constantly resulted in an inhibition of p38 activity (Figure 10 B). Similar inhibition was not seen when the cells were transfected with wild-type Cdc42, used as a control. In three separate experiments, 4 µg/plate dominant negative Rac slightly decreased p38 activity (75 ± 12% of control) and mutant RhoA was only somewhat more effective (70 ± 27% of control). The experiment was also repeated with higher plasmid concentration (8 µg/plate) and p38 activity was unaltered in dominant negative Rac transfected cells (116% of control). Mutant RhoA showed some inhibition (66% of control). Again, dominant negative Cdc42 was the most efficient (17% of control). The dominant negative forms of the MAPK kinases known to function upstream of p38, namely MKK3 and MKK4, both had an inhibitory effect. Dominant negative MKK3 inhibited p38 activity by 90–91% and dominant negative MKK4 by 76–90% (Figure 10). These results indicate that the activity of Cdc42 and the MAPK kinases MKK3 and MKK4 are necessary for the 2ß1 integrin-mediated p38 activation.

View larger version (63K): [in this window] [in a new window]   Figure 10. A possible role for RhoA, Cdc42, MKK3, and MKK4 in integrin 2ß1-mediated activation of p38. Equal numbers of stable 2-transfected Saos-2 cells were transiently cotransfected with flag-tagged p38 (2 µg) and the dominant negative form of the protein indicated (4 µg). The cells were treated and assayed for p38 kinase activity. The possible effect of the cotransfected plasmid on p38-flag expression was checked with Western blot analysis of the cell lysate using flag-tag recognizing antibody M2. An autoradiogram of a representative experiment is shown. (B) Various concentrations of dominant negative (DN) Cdc42 were tested in cotransfections with 2 µg of p38-flag. Each experiment was repeated 2 to 4 times and mean values ± SEM are shown. Transfection of wild-type (wt) Cdc42 was used as a control.

	Discussion

Top