|
||
Original Article |
-Tubulinassociated Protein Family
Correspondence to: Michel Wright, IPBS-CNRS, 205 route de Narbonne, 31400 Toulouse, France. Tel:05-61-1755-17 Fax:05-61-1759-93 E-mail:wright{at}ipbs.fr.
| Abstract |
|---|
|
|
|---|
The role of the centrosomes in microtubule nucleation remains largely unknown at the molecular level.
-Tubulin and the two associated proteins h103p (hGCP2) and h104p (hGCP3) are essential. These proteins are also present in soluble complexes containing additional polypeptides. Partial sequencing of a 76- kD polypeptide band from these complexes allowed the isolation of a cDNA encoding for a new protein (h76p = hGCP4) expressed ubiquitously in mammalian tissues. Orthologues of h76p have been characterized in Drosophila and in the higher plant Medicago. Several pieces of evidence indicate that h76p is involved in microtubule nucleation. (1) h76p is localized at the centrosome as demonstrated by immunofluorescence. (2) h76p and
-tubulin are associated in the
-tubulin complexes. (3)
-tubulin complexes containing h76p bind to microtubules. (4) h76p is recruited to the spindle poles and to Xenopus sperm basal bodies. (5) h76p is necessary for aster nucleation by sperm basal bodies and recombinant h76p partially replaces endogenous 76p in oocyte extracts. Surprisingly, h76p shares partial sequence identity with human centrosomal proteins h103p and h104p, suggesting a common protein core. Hence, human
-tubulin appears associated with at least three evolutionary related centrosomal proteins, raising new questions about their functions at the molecular level.
Key Words:
-tubulin, centrosome, microtubule, cytoskeleton, nucleation
| Introduction |
|---|
|
|
|---|
MOST of the microtubules of the cytoskeleton are nucleated on specialized organelles called microtubule organizing centers (MTOCs)1. These centers show distinct morphological appearances in evolutionary distant organisms, but it is not yet clear whether these various aspects reflect intrinsic biochemical differences or result from the different organization of evolutionary conserved proteins.
The spindle pole body (SPB) of Saccharomyces has been analyzed extensively at the functional and structural levels. Included in the nuclear envelope (![]()
![]()
-tubulinrelated protein (Tub4p) (![]()
![]()
-Tubulin is present at the minus extremities of the microtubules, but does not participate in the overall structure of the microtubule walls (![]()
![]()
![]()
![]()
-tubulin is required for the nucleation process (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
-tubulin complex appears to be a precursor of the material involved in the nucleation of both intranuclear and cytoplasmic microtubules (![]()
The knowledge of the overall composition and structure of the centrosome is less advanced than in the case of the yeast SPB (![]()
![]()
-tubulin cytoplasmic complexes of vertebrates and Drosophila (![]()
![]()
![]()
![]()
-tubulin complex, the largest complexes obtained from vertebrate and Drosophila involve more than three proteins (![]()
![]()
![]()
-TuRC or
-tubulin ring complex) (![]()
![]()
/ß-tubulin heterodimers (![]()
![]()
-tubulin in Drosophila centrosomes suggests that the
-tubulin ring complexes constitute the microtubule nucleation sites of the pericentriolar material (![]()
-tubulin complexes exhibit a large size heterogeneity (![]()
![]()
![]()
-TuRC (![]()
-tubulin, these complexes contain other polypeptide chains with apparent molecular masses of 50, 76, 105, 135, and 195 kD in denaturing electrophoretic conditions (![]()
/ß-tubulin heterodimer (50 kD) is present in the Xenopus
-TuRC and in the complexes isolated from mammalian brain (![]()
![]()
![]()
![]()
![]()
![]()
-TuRCs (![]()
-tubulin complexes allowed us to characterize a ubiquitous centrosomal protein in human (h76p), Drosophila (d75p), and Medicago (m85p), which is a new member of the yeast and vertebrate Spc97p and Spc98p2 family.
| Materials and Methods |
|---|
|
|
|---|
Purification of the
-Tubulin Complexes
Preparations of sheep and pig brain microtubule proteins obtained by two cycles of assembly and disassembly were used to isolate
-tubulin complexes by immunoaffinity chromatography (![]()
-Tubulin complexes obtained from pig brain were used in all experiments involving mammalian complexes.
Microsequencing of the 76-kD Protein
Proteins from pig brain
-tubulin complexes were separated by one dimensional gel electrophoresis under denaturing conditions, blotted onto PVDF membrane (Problott, Perkin-Elmer), and visualized by Ponceau S (Sigma Chemical Co.). The sequence analysis of the 76-kD band, carried out using a gasliquid sequencer (model 467A; Applied Biosystems), allowed the determination of the first 20 amino acids of a single protein. In addition, the 76-kD band was excised from Coomassie bluestained gels, digested by porcine trypsin, and the resulting peptides were purified and sequenced as described (![]()
Cloning and Sequencing of the cDNA of Human 76p and of its Drosophila and Medicago Orthologues
The first 20amino-terminal amino acids of the 75-kD band from pig
-tubulin complexes were encoded by a human expressed sequence tag (EST) (AA115 396). The 5' and 3' sequences of this clone were used to obtain a full-length cDNA from a human neuroblastoma bank using a PCR approach. This cDNA was sequenced (big dye terminator on 373 DNA sequencer with internal nucleotides). The deduced 2-kb open reading frame (ORF) showed perfect matches with the peptide sequences obtained from purified 75- kD band. The Drosophila EST (accession number AA694820) that showed a significant similarity to h76p, allowed by genome walking the successive identification of one genomic (nucleotides 7310175475; ACC005113) and three additional EST (accession numbers AA536481, AA540317, and AA536269) clones coding for the Drosophila orthologue (d75p) of h76p. Sequences obtained from the previously identified EST and genomic clones, together with additional sequences experimentally obtained from the AA540317 (full-length) and AA694820 cDNA clones, allowed us to generate a full-length coding sequence for d75p. The gene coding for the d75p (AC005113) contains seven introns and eight exons (7310173169, 7322773371, 7343073715, 7377773936, 7399774503, 7456874940, 7499775270, and 7533775475). The full-length cDNA clone from Medicago was isolated by library screening using a radioactive probe corresponding to the 850-bp EcoRI insert fragment of the EST 660560 that encoded a polypeptide showing high homology with the h76p and d75p proteins. The probe was hybridized against 8 x 105 plaque-forming units of a Medicago truncatula root tip cDNA library (Dr. A. Niebl and Dr. P. Gamas, LBRPM, UMR CNRS 215, Castanet-Tolosan, France). Phage plaques were plated onto nitrocellulose membranes (Optitran BA-S-85; Schleicher & Schuell, Inc.) according to the manufacturer's instructions. Prehybridization, hybridization, and washings were performed according to ![]()
Recombinant h76p
The 2-kb ORF of the h76p (AA115396) was amplified by PCR using the 5' primer, 5' GCGCGCGAGCTCATCCACGAACTGCTCTTGGCT 3', and the 3' primer, 5' GCGCGCAAGCTTTCACATCCCGAAACTGCCCAG 3'. The PCR fragment was digested with the restriction enzymes SacI and HindIII and inserted into the plasmid pQE30 (Qiagen) resulting in a plasmid (pQE30-p76) coding for a h76p tagged with 6-His at the amino terminus. The bacterial vector pQE30-p76 was introduced in the M15(pREP4) Escherichia coli host strain and protein expression was induced by 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 4 h at 37°C. The insoluble fusion protein was purified either as inclusion bodies (![]()
10% of the proteins. Buffer exchange was performed through a prepacked Sephadex G-25M column (Pharmacia).
Transient Expression of GFP-h76p Fusion Protein in Mammalian Cells
The 2-kb h76p-ORF was amplified by PCR using the 5' primer, 5' GCGCGCAAGCTTATCCACGAACTGCTCTTGGCT 3', and the 3' primer, 5' GCGCGCAAGCTTTCACATCCCGAAACTGCCCAG 3'. The PCR product was digested with the restriction enzyme HindIII and inserted into the plasmid pEGFP-C3 (CLONTECH Laboratories). The resulting plasmid (pEGFP-C3-p76) expressed the h76p with the enhanced green fluorescent protein coding sequence fused at the amino terminus (GFP-h76p). Monkey kidney COS cells, cultured in DME (GIBCO BRL) with 7% FBS (Sigma Chemical Co.) in plastic flaskets (9 cm2) were transfected (50% efficiency) with 1 µg of plasmid pEGFP-C3-p76 using the DEAE dextran/chloroquine procedure (![]()
100 kD, recognized by antih76p and antiGFP antibodies (Figure 4, top). Comparison of the immunolabeling with a standard curve raised with recombinant h76p showed that the GFP-h76p represented
0.4% of total proteins (Figure 4, top), whereas the endogenous 76p remained below the detection limit, i.e., <0.003% of total proteins in control COS cells. Since the percentage of transfection was
50%, transfection resulted in an average expression
200-fold above the basal level. Alternatively, HeLa cells were transfected using the calcium phosphate procedure (![]()
|
|
|
|
Antibodies
Rabbit antibodies recognizing h76p were raised against h76p overexpressed in E. coli (R7629/30) and against three synthetic peptides linked to thyroglobulin (Sigma Chemical Co.) as described (![]()
![]()
-tubulin were raised, either in rabbits (R74, R75) or in guinea pigs (C3), against a 19amino acid peptide corresponding to the carboxy-terminal region of human
-tubulin (![]()
![]()
-tubulin (![]()
-tubulin (CVDEYKASESPDYIKWG), do not cross-react with vertebrate
-tubulin. A rat mAb (YL1/2) (![]()
-tubulin was used to reveal the
/ß-tubulin heterodimer. mAbs against neurofilament proteins were obtained from Dr. D. Paulin (Institut Pasteur, France). AntiGFP antibodies were purchased from CLONTECH Laboratories. Affinity-purified antibodies were used in all experiments involving immunoblotting or immunofluorescence labeling.
Immunofluorescence
The immunolocalization of h76p in PtK2 cells (![]()
-tubulin was performed with rabbit antibodies (R801) and guinea pig antibodies (C3), respectively. Staining of
-tubulin (R75) or microtubules (YL1/2) in COS cells overexpressing fluorescent GFP-h76p was performed after a 1-min permeabilization in a microtubule stabilizing medium and fixation in 3.7% formaldehyde (![]()
![]()
In Vitro Assembly of Xenopus Sperm Asters
Extracts were prepared using Xenopus oocytes arrested in the metaphase of the second meiotic division (![]()
![]()
-tubulin (R74) rabbit antibodies were used for depletion experiments. Schematically, 50 µl of protein ASepharose beads were saturated for 2 h at 4°C with 2 ml of a solution of casein at the concentration of 5 mg/ml. They were incubated overnight at 4°C with 150 µl of rabbit serum (R801, R74) diluted fourfold in PBS, and washed successively in PBS, PBS with 0.1% Triton X-100, PBS, and acetate buffer (100 mM potassium acetate, 2.5 mM magnesium acetate, pH 7.2). The oocyte extract (50 µl, 6080 mg/ml), diluted with 1 vol of acetate buffer containing an ATP-regenerating system and protease inhibitors, was centrifuged for 5 min at 10,000 g, mixed with the protein ASepharose beads, and incubated for 1 h at 4°C. After bead removal by centrifugation, the supernatant was used for microtubule assembly in the presence of permeabilized Xenopus spermatozoa (![]()
![]()
![]()
![]()
| Results |
|---|
|
|
|---|
The 76-kD Polypeptide Band of the
-Tubulin Complexes Isolated from Mammalian Brain Contains a New Evolutionary Conserved Protein
-Tubulin complexes were purified from mammalian brain by affinity chromatography with
-tubulin antibodies (![]()
-tubulin and the
/ß-tubulin heterodimer, the
-tubulin protein complexes obtained from pig and sheep brain contain four polypeptide bands (see Figure 2 A). The band migrating at 76 kD in pig brain
-tubulin complexes was isolated by SDS-PAGE, blotted and submitted to microsequencing. The terminal amino acid sequence xIHELLLALSGYPGSIFTxN was identified in a putative ORF at the 5' end of a human EST (accession number AA115395). The corresponding cDNA was obtained by PCR from a human neuroblastoma cDNA library and entirely sequenced. It contains a single ORF (h76p = hGCP4) coding for a polypeptide of 667 amino acids with a calculated mass of 76,090 and a pI of 6.14 (Figure 1). This ORF also contains the two sequences, xxEDTFAAExHR and xEILPTY, previously obtained from the tryptic digests of the 76-kD polypeptides from pig (sequence 1) and sheep (sequences 1 and 2).
Searches in databases also identified ESTs coding for apparented proteins in evolutionary distant organisms such as Drosophila (accession number AA694820), the moss Physcomytrella (accession number EJ225509), and the higher plant Medicago (accession number AA660560). A full-length cDNA sequence was first obtained for the Drosophila orthologue. The corresponding Drosophila gene contains eight exons coding for a protein of 650 amino acids (d75p). This protein exhibits
33% sequence identity with h76p, and shows comparable calculated mass (74,900) and pI (5.12). The presence of an orthologue of h76p in Medicago (m85p) was confirmed by the isolation and sequencing of the corresponding full length cDNA. It codes for a protein of 739 amino acids, with a calculated mass of 85,300 (m85p) and a pI of 6.23. m85p exhibits
34 and 31% sequence identity with its human and Drosophila counterparts, respectively. Several common amino acid motifs were identified between the three protein orthologues, particularly the conserved amino-terminal sequence (Figure 1).
The identity of the h76p with the major protein of the 76-kD band of pig brain
-tubulin complexes was further assessed by antibodies raised against recombinant h76p (R7629/30) and several peptide motifs of h76p: 233248 (R72), 303313 (R801), and the carboxy-terminal amino acids 651666 (R190) (Figure 2 A). The labeling specificity was checked by competition with the immunizing peptides. Moreover, h76p antibodies (R801) specifically immunoprecipitated
-tubulin from pig brain
-tubulin complexes in agreement with the presence of both proteins in the same complexes (Figure 2 B). The 76p was specifically recognized by R190 antibodies in mammalian cell extracts (PtK2 cells) in which it represents, similarly to
-tubulin,
0.02% wt/wt of the cellular proteins (Figure 2 C). Antibodies R801 and R190 (Figure 2 D) specifically labeled a single band at 76 kD in oocyte extracts (x76p), suggesting that the sequence of this protein was conserved in vertebrates. Moreover, x76p and
-tubulin were present in similar amounts and represented
0.02% wt/wt of the proteins of the oocyte extract (Figure 2 D).
The 76p Is a Minor Protein of the Purified
-TuRCs
Since h76p was associated to
-tubulin in mammalian protein complexes, it could be assumed that it was present in the fairly homogeneous
-TuRCs from Xenopus oocytes (![]()
![]()
-tubulin were revealed by immunoblotting. The distribution of x76p (R801 antibodies) was coincidental with the peak of
-tubulin (C3 antibodies). Both proteins were exclusively recovered in complexes larger than 19 S (Figure 3 A) corresponding to the
-TuRCs as defined by ![]()
-TuRCs by h76p antibodies (R190) and immunoblotting with
-tubulin antibodies (C3) further demonstrated that both proteins were present in the same complexes (Figure 3 B). However, this experiment did not exclude the possibility that a fraction of x76p assembled in complexes devoid of
-tubulin and cosedimented with the
-TuRCs. To check this possibility,
-tubulin from an oocyte extract (7 mg/ml) was immunoprecipitated with rabbit antibodies (R74). Despite the inability to analyze the immunoprecipitate with rabbit 76p antibodies, the experiment showed the disappearance of both
-tubulin (C3 antibodies) and x76p (R190 antibodies) from the supernatant (not shown). Hence, in oocyte extracts, most
-tubulin and x76p are expected to be present in
-TuRCs in an apparent ratio of
1 (Figure 2 D). In contrast, stoichiometry determinations based on Coomassie staining suggested that the 76-kD polypeptide band corresponded to a minor protein both in Xenopus (![]()
-tubulin complexes (![]()
-tubulin complexes and recombinant h76p as an internal standard, we confirmed that 76p was approximately fivefold less abundant than
-tubulin in preparations of pig brain
-tubulin complexes (Figure 3 C). Loss of 76p in some
-tubulin complexes and/or selective loss of some
-tubulin complexes during purification is a likely possibility. To assess whether all purified
-tubulin complexes contained h76p, mammalian
-tubulin complexes were sedimented and the resuspended pellet was repeatedly subjected to immunoprecipitation either with R801 or with R190 antibodies. In each case, the first cycle of 76p depletion removed some
-tubulin from the preparation, but further cycles failed to strongly deplete the supernatant from
-tubulin (Figure 3 D, M + R801 and M + R190). However, a similar result was obtained with the native
-TuRCs directly immunoprecipitated from a crude Xenopus oocyte extract (Figure 3 D, X + R190). Hence, both purified and native
-tubulin complexes are likely to be heterogeneous. The inaccessibility of the 76p in some
-tubulin complexes could account for these observations although two antibodies raised against distinct regions of 76p were used. Alternatively, the average stoichiometry of 76p in
-TuRCs could be different from the actual stoichiometry in individual
-TuRC.
Most of the purified
-tubulin complexes bind to microtubule minus extremities (![]()
![]()
-tubulin complexes, we investigated whether 76p could bind to microtubules. After incubation of pig brain
-tubulin complexes (
100 ng of
-tubulin) with taxol-stabilized microtubules (450 µg), free and bound
-tubulin complexes were readily separated by differential sedimentation (at 62,000 g for 5 min) and analyzed by SDS-PAGE and immunoblotting with
-tubulin (C3) and 76p (R801) antibodies (![]()
-tubulin complexes failed to sediment and both 76p and
-tubulin remained in the supernatant. The same result was observed when
-tubulin complexes were mixed with pure tubulin unable to assemble both at 0 and 37°C. In contrast, a definite amount of 76p and
-tubulin sedimented in the presence of microtubules assembled in the presence of taxol (not shown). These observations suggested the following: (1) 76p could bind directly or indirectly to microtubules; and (2) 76p neither acts as an inhibitor of the fixation of
-tubulin to microtubules nor is released from the complexes during their binding to microtubule.
The 76-kD Protein Is Localized to the Centrosome and Spindle Poles
The centrosomal localization of 76p was assessed by immunofluorescence staining with three polyclonal antibodies (R801, R190, and R629/30) using cold methanol-fixed PtK2 cells. In all cases, 76p colocalized with
-tubulin (Figure 4 A) to the centrosome, which appeared as a diplosome during interphase (Figure 4 B), and to the spindle poles at the different stages of mitosis (Figure 4, EJ and L). Both in interphase and mitosis, the labeling raised by h76p antibodies was specific as shown by the absence of staining when the antibodies were preincubated with the immunizing peptide (Figure 4 C). Observation of the immunofluorescent figures showed that the amount of 76p to the centrosome transiently increased during mitosis. The difficulty to exactly determine centrosome limits prevented the accurate determination of the overall fluorescence (average fluorescence x area), and led us to choose the maximal centrosomal fluorescence as a quantitative parameter (Figure 4, bottom). The maximal fluorescence, which did not vary significantly in interphase, increased
6-fold from prophase to prometaphase/metaphase and decreased thereafter to its interphase level in late telophase. A similar variation has been previously reported for
-tubulin (![]()
-tubulin (![]()
![]()
As for
-tubulin (![]()
-tubulin (![]()
-tubulin (![]()
![]()
The subcellular localization of 76p was observed in methanol-fixed cells, but no specific immunostaining was obtained using other fixation procedures. Neither formaldehyde- and glutaraldehyde-fixed PtK2 cells nor permeabilized cells with and without formaldehyde fixation showed a centrosomal staining when probed with the different h76p antibodies, whereas in all cases
-tubulin antibodies decorated the centrosome. To confirm the centrosomal localization of h76p, a fusion protein between GFP and h76p (GFP-h76p) was transiently overexpressed in COS cells. The 103-kD fusion protein was specifically detected in protein extracts from transfected cells by immunoblotting with both h76p (R801) and GFP antibodies (Figure 5 A). Since 50% of the cells were transfected, the average overexpression was
200-fold as judged with a range of recombinant h76p. In interphase cells, the GFP-h76p was present at the centrosome where it colocalized with
-tubulin (Figure 5 D), whereas in mitotic cells the GFP-h76p localized at the spindle poles and was absent from the mitotic spindle (Figure 5B and Figure C). Hence, the presence of the GFP moiety at the amino terminus of h76p did not modify its localization to the interphase and mitotic centrosomes. Since the transfection method used in PtK2 cells induced multipolar mitoses (Figure 5), we repeated these experiments applying another method to HeLa cells. Overexpression of h76p in HeLa cells (not shown) confirmed its immunolocalization and also failed to induce evident modifications of the microtubule cytoskeleton morphology. However, 72 h after transfection, 80% of HeLa cells expressing GFP-h76p exhibited a nuclear fragmentation characteristic of apoptosis (Figure 5E and Figure F), whereas only 12% were observed in cells expressing GFP. This suggests that h76p overexpression could be deleterious to cells by analogy with toxic effects due to Spc97p and Spc98p overexpression in yeast (![]()
![]()
|
The
-TuRCs Containing 76p Are Necessary for In Vitro Nucleation of Microtubule Asters
It has been previously demonstrated that the
-TuRCs present in Xenopus oocyte extracts (![]()
![]()
![]()
![]()
-tubulin. The function of 76p (Figure 6 B, left) was compared with
-tubulin (Figure 6 B, right) using permeabilized spermatozoa incubated at 22°C in an oocyte extract and challenged for their ability to nucleate microtubule asters. About 8590% of spermatozoa nucleated a microtubule aster when incubated in a competent oocyte extract (Figure 6 B, diamond). When the extract was partially depleted with antibodies against either
-tubulin (R74) or h76p (R801), only 1719% and 010% of the basal bodies assembled a microtubule aster, respectively (Figure 6 B, open circle). These inhibitions were specific since they did not occur when the immunodepletion was conducted in the presence of the respective immunizing peptides (
76 and 83%, respectively; Figure 6 B, open triangle), preimmune antibodies (
84 and 72%, respectively; Figure 6 B, closed circle) or antibodies that are unrelated to Xenopus centrosomal proteins (
79%; Figure 6 B, closed inverted triangle). Moreover, addition of mammalian
-tubulin complexes to
-tubulin or 76p-depleted oocyte extracts restored their capacity to induce asters on sperm basal bodies (
77 and 78%; Figure 6 B, square).
|
It was likely that 76p and
-tubulin were recruited by the sperm basal bodies. The recruitment kinetics of these two proteins, followed in the presence of 5 µM nocodazole during a 20-min incubation period (Figure 6 C), paralleled the assembly of microtubule asters (Figure 6 B). The specificity of the recruitment of
-tubulin and 76p was further studied after a 20-min incubation period (Figure 6 D). Barely detectable in permeabilized spermatozoa (Sp) (Figure 6 D, lane 1), both
-tubulin and 76p were revealed when the spermatozoa were incubated in a crude oocyte extract (Figure 6 D, lane 2, Sp + E). The same amounts of
-tubulin and 76p were observed in spermatozoa incubated in an oocyte extract treated either with h76p antibodies (R801) incubated in the presence of the immunizing peptide or with R801 preimmune antibodies (Figure 6 D, lanes 4 and 5). Partial immunodepletion of the oocyte extract with h76p antibodies (R801) appeared highly efficient, and resulted in a severe drop in the accumulation of 76p and to a less extent of
-tubulin in incubated spermatozoa (Figure 6 D, lane 3). These observations demonstrated that 76p, like
-tubulin, was recruited to the sperm basal bodies and that the recruitment was independent of the presence of microtubules as observed during mitosis. The quantity of 76p in permeabilized spermatozoa and spermatozoa incubated in an oocyte extract was quantified by immunoblotting by comparison with a range of recombinant h76p (Figure 6 E)
0.45 ng (± 0.01, n = 4) and
4 ng (±0.5, n = 4) of 76p were observed per 106 spermatozoa before and after incubation in an oocyte extract, respectively. This
9-fold increase of 76p in nucleation-competent spermatozoa strongly suggests that this protein participates to the maturation of the basal bodies as previously suggested for
-tubulin and the Xenopus orthologue (Xgrip109) of h104p (![]()
![]()
![]()
Since the stoichiometry of 76p in native
-TuRCs could be variable, 76p could act as a limiting factor in the nucleation of asters especially after its immunodepletion. This hypothesis was strengthened by addition of recombinant h76p to a partially x76p-depleted extract (Figure 6 B, closed triangle). Although the 76p-depleted extract promoted the assembly of
010% asters, addition of recombinant h76p partially restored their formation to
50%. In contrast, addition of recombinant h76p to a partially
-tubulindepleted extract failed to restore the capacity of the basal bodies to nucleate asters:
19 and 21% without and with recombinant h76p, respectively. These observations suggested that recombinant h76p could complement a 76p-depleted extract, but not a
-tubulindepleted extract. Therefore, it is likely that 76p does not act directly in aster nucleation, but participates in the assembly of active centrosomes. It is possible that recombinant h76p could bind to the
-TuRCs still present in the partially x76p-depleted Xenopus extract and, thus, restore the nucleating activity. But the capacity of recombinant h76p to restore aster nucleation in a partially x76p-depleted extract (
50%) was lower than the capacity of mammalian
-tubulin complexes (
78%) although the amount of recombinant h76p was
4,000-fold higher than the amount of 76p added when mammalian
-tubulin complexes were used. The presence of inactive recombinant h76p in the preparation could account for this difference. Alternatively, some other limiting factors from the 76p-depleted extract could be necessary to recover complete nucleation.
| Discussion |
|---|
|
|
|---|
Soluble
-tubulin complexes are expected to constitute the functional unit of the MTOCs (![]()
-tubulin. The h76p was initially characterized by microsequencing from mammalian brain
-tubulin complexes. The amino-terminal and internal amino acid sequences as well as the mass distribution of the peptides resulting from tryptic digestion (not shown) revealed only the 76p in the electrophoretic band of the pig brain
-tubulin complexes migrating at 76 kD. The multiple polypeptide bands observed in the 76-kD range in Xenopus
-tubulin complexes (![]()
-tubulin complexes both by microsequencing and immunoblot (not shown).
Identification of numerous human and murine ESTs homologous to 76p (accession numbers AA790714, T33250, AA190050, AA352362, W27984, AA115395, A1025270, and AA893682) reveals that 76p mRNA is present in various tissues (skin, mammary glands, liver, heart, retina, colon, testis, and placenta) and could be ubiquitously expressed in animal cells, as are
-tubulin and the two other
-tubulinassociated proteins, h103p (hGCP2) and h104p (hGCP3). In somatic cells, 76p, like
-tubulin (![]()
0.02% of the total cellular proteins. It is not only present in soluble Xenopus
-TuRCs and heterogeneous mammalian
-tubulin complexes, but like
-tubulin, h103p and h104p, is a bona fide centrosomal protein. This is demonstrated by immunofluorescence staining of 76p in PtK2 cells and mature Xenopus sperm basal bodies, and the localization of GFP-h76p fusion protein in COS cells. Moreover, like
-tubulin (![]()
![]()
4 x 104 molecules of 76p per centrosome was present in sperm basal bodies incubated in an oocyte extract, a value similar to the number of molecules of
-tubulin per Xenopus centrosome (![]()
-tubulin (![]()
![]()
![]()
Besides its centrosomal location, 76p associates in vitro with a microtubule similar to
-tubulin, h103p, and h104p (![]()
![]()
-tubulin and the
/ß-tubulin heterodimers and neither dissociates before the binding of the
-tubulin complexes to the centrosome nor inhibits their binding. The amounts of 76p (this report),
-tubulin (![]()
![]()
![]()
-tubulin complexes or recombinant h76p. This observation confirmed that, in addition to
-tubulin (![]()
![]()
-TuRC, 76p (this report) and the Xenopus orthologue (Xgrip109) of h104p (![]()
In purified
-tubulin complexes, 76p is at least fivefold less abundant than
-tubulin, in agreement with previous quantifications of the 76-kD band by Coomassie staining (![]()
![]()
-tubulin complexes during purification could account for this observation since equivalent quantities of
-tubulin and 76p are observed in the native
-TuRCs present in Xenopus oocyte extracts. But the number of 76p in
-tubulin complexes could be also heterogeneous as suggested by several observations. First, using two different antibodies, we failed to immunoprecipitate all
-tubulin in preparations of mammalian
-tubulin complexes and in Xenopus oocyte extracts. Second, addition of recombinant h76p to an x76p-depleted Xenopus oocyte extract partially restored the capacity of basal bodies to nucleate asters.
Orthologues to human 76p were cloned from insects (d75p) and angiosperms (m85p) (Figure 1), and are likely present in mosses (EST, AJ225509). The identity between the three sequenced orthologue proteins varies from
31 to 34%. Therefore, the 76p proteins seem to generally occur in eukaryotic cells. The identification of a 76p orthologue in higher plants is particularly of note. The exact nature of the MTOCs remains poorly understood in plants. However,
-tubulin has been identified in a variety of plants and found to localize at numerous microtubule nucleation sites (![]()
![]()
-tubulin (![]()
Alignments based on sequence homologies and on hydrophobic cluster analysis (![]()
-tubulin in common protein complexes (![]()
![]()
![]()
![]()
![]()
![]()
23%) or h104p (
27%) were comparable with the identity observed between h103p and h104p (
33%), suggesting that this region corresponds to the core of these three
-tubulinassociated proteins (Figure 7). Hence, it is likely that these proteins originate from a unique gene family that diverged early in the evolution of eukaryotic cells. Identities between h76p, h103p, and h104p could possibly imply some common functional properties such as the positioning of
-tubulin at the MTOCs (![]()
![]()
![]()
![]()
-tubulin through specific interactions with different docking proteins and possibly specify the nucleation of different microtubule arrays as observed for Spc98p at the inner plaque of the yeast spindle pole body (![]()
-tubulin complexes together with the analysis of Drosophila d75p mutants could shed some light on the function of h76p, and are currently under investigation.
|