|
||
Original Article |
Correspondence to: Michele Solimena, Department of Internal Medicine, Section of Endocrinology, Yale University School of Medicine, 330 Cedar Street, New Haven, CT 06520. Tel:(203) 737-1037; Fax: (203) 737-2812
| Abstract |
|---|
|
|
|---|
We report the identification of ßIV spectrin, a novel spectrin isolated as an interactor of the receptor tyrosine phosphatase-like protein ICA512. The ßIV spectrin gene is located on human and mouse chromosomes 19q13.13 and 7b2, respectively. Alternative splicing of ßIV spectrin generates at least four distinct isoforms, numbered ßIV
1ßIV
4 spectrin. The longest isoform (ßIV
1 spectrin) includes an actin-binding domain, followed by 17 spectrin repeats, a specific domain in which the amino acid sequence ERQES is repeated four times, several putative SH3-binding sites and a pleckstrin homology domain. ßIV
2 and ßIV
3 spectrin encompass the NH2- and COOH-terminal halves of ßIV
1 spectrin, respectively, while ßIV
4 spectrin lacks the ERQES and the pleckstrin homology domain. Northern blots revealed an abundant expression of ßIV spectrin transcripts in brain and pancreatic islets. By immunoblotting, ßIV
1 spectrin is recognized as a protein of 250 kD. AntißIV spectrin antibodies also react with two additional isoforms of 160 and 140 kD. These isoforms differ from ßIV
1 spectrin in terms of their distribution on subcellular fractionation, detergent extractability, and phosphorylation. In islets, the immunoreactivity for ßIV spectrin is more prominent in
than in ß cells. In brain, ßIV spectrin is enriched in myelinated neurons, where it colocalizes with ankyrinG 480/270-kD at axon initial segments and nodes of Ranvier. Likewise, ßIV spectrin is concentrated at the nodes of Ranvier in the rat sciatic nerve. In the rat hippocampus, ßIV
1 spectrin is detectable from embryonic day 19, concomitantly with the appearance of immunoreactivity at the initial segments. Thus, we suggest that ßIV
1 spectrin interacts with ankyrinG 480/270-kD and participates in the clustering of voltage-gated Na+ channels and cell-adhesion molecules at initial segments and nodes of Ranvier.
Key Words: chromosome 19, diabetes, neuropathies, secretion, signal transduction
| Introduction |
|---|
|
|
|---|
The spectrins were originally identified as rod-shaped molecules that are part of the lattice-like cytoskeleton underneath the erythrocyte membrane (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The spectrin molecule is a tetramer that consists of two
and two ß subunits. A tight association between the NH2-terminal domain of an
subunit and the COOH-terminal domain of a ß subunit forms a heterodimer, which assembles into a tetramer through a head-to-head association. The most distinctive feature of both subunits is the presence of multiple repeats, each consisting of
106 residues that assemble to form a three-helix bundle (![]()
![]()
spectrins include 20 spectrin repeats, two of which are less conserved, an SH3 motif between spectrin repeats 9 and 11, and a COOH-terminal domain with two EF-hand motifs. ß spectrins, on the other hand, contain 17 spectrin repeats in between an actin-binding domain at the NH2 terminus and a pleckstrin homology (PH)1 domain towards the COOH terminus.
Until recently, four genes encoding two
spectrins (
I and
II) and two ß spectrins (ßI and ßII) were known in mammals.
I
1 and ßI
1 spectrin are primarily expressed in erythrocytes, whereas
II
1 and ßII
1 spectrin have a wide tissue distribution and are particularly abundant in the brain (![]()
![]()
![]()
![]()
2 spectrin is highly expressed in muscle and brain (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Besides with
spectrins, ß spectrins interact directly with many additional proteins, including actin, protein 4.1, and ankyrins (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Here we report the cloning and characterization of a novel human spectrin, termed ßIV spectrin, which was isolated in a two-hybrid screening in yeast as an interactor of the autoantigen of type I diabetes ICA512 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| Materials and Methods |
|---|
|
|
|---|
Antibodies
ßIV spectrin antisera were raised against two synthetic peptides corresponding to amino acids 22372256 (specific domain antiserum, SD) and 25422559 (COOH-terminal domain antiserum, CT) of human ßIV spectrin, respectively. Both peptides were coupled to keyhole limpet hemocyanin through an added cysteine at their NH2 terminus and were injected into rabbits to generate polyclonal antisera. Both antisera were affinity purified on their corresponding peptides that had been covalently linked to ECH-Sepharose beads (Amersham Pharmacia Biotech). Fractions of the antisera were eluted with 0.2 M glycine (pH 3.0), collected and dialyzed with Tris buffer, pH 7.5. The specificity of these antisera and affinity purified antibodies was tested by Western blot on Triton X-100 extracts from COS cells expressing a partial fragment of ßIV spectrin (residues 20682559), termed B8.
The following antibodies were from commercial sources: rabbit antiLexA antiserum and mouse antiV5 antibody (Invitrogen), mouse monoclonal antibody against ankyrin G 480/270-kD (Zymed Laboratories), mouse monoclonal antibody against glucagon (Sigma-Aldrich), mouse monoclonal antibody against myelin basic protein (Sternberger Monoclonal Antibodies), antirabbit and antimouse goat IgG antibodies conjugated to Alexa 488 or Alexa 568 (Molecular Probes, Inc.). A mouse monoclonal antibody against hemagglutinin (HA) was a kind gift of R. Collins (Cornell University, Ithaca, NY). Affinity-purified antibodies against the cytoplasmic or the ectodomain of ICA512 have been described previously (![]()
![]()
Two-Hybrid Screening in Yeast
A yeast two-hybrid screening was executed according to the protocol of ![]()
pLexA-ICA512cyt, pLexA-ICA512cyt AD/DA, and pLexA-PHOGRINcyt were independently transformed into the yeast strain L40 [partial genotype MATa trp1 leu2 his3 LYS2::(lexAop)-HIS3 URA3::(lexAop)-lacZ GAL4] and AMR70 [partial genotype: MAT
his3 lys2 trp1 leu2 URA3::(lexAop)-lacZ GAL4]. Expression of the LexA-fusion proteins (baits) in yeast cells was verified by Western blotting using the anti-LexA antiserum (1:1,000). L40 cells expressing pLexA-ICA512cyt were cotransformed with 500 µg of a human adult brain cDNA library in pACT2 (Clontech) that included an in-frame HA tag (Clontech). Double transformants were selected for His+ and LacZ+ phenotypes. After purging of the bait plasmid, L40 His+ LacZ+ cells were mated separately with AMR70 cells transformed with the following baits: LexA-ICA512cyt, LexA-ICA512cyt AD/DA, LexA-PHOGRINcyt, LexA-lamin, and LexA-MSS4. Since lamin and MSS4 are proteins unrelated to ICA512, they were not expected to share interactors with ICA512. Accordingly, only those pACT2 plasmids that reconstituted His+ auxotrophy with LexA-ICA512 cyt, but not LexA-lamin or LexA-MSS4, in the mating assay were isolated and their cDNA inserts characterized by sequence analysis. The stringency conditions of the mating assay were increased by adding 3-amino-1,2,4-triazole (3-AT) (Sigma-Aldrich) to the plate media at concentrations ranging from 0 to 10 mM. To assess expression of bait and prey proteins in the mating assay, diploid cells were lysed by incubation for 10 min in 0.2 N NaOH/0.5% ß-mercaptoethanol on ice. Lysates were incubated with 10% trichloroacetic acid for 30 min on ice, and then spun for 10 min at 10,000 g at 4°C. After precipitation in 100% acetone, the proteins were resuspended in 2% SDS sample buffer (New England Biolabs, Inc.) to a final concentration of 200400 µg/OD. Protein concentration in tissue extracts was determined using the BCA assay procedure (Pierce Chemical Co.). 100 µg protein from each lysate was run on 12% SDS-PAGE and blotted with anti-HA (1:10) and anti-LexA (1:1,000) antibodies followed by 125I-Protein A (105 cpm/ml) and autoradiography.
Cloning of ßIV Spectrin
Cloning of the full length ßIV spectrin cDNA from adult human brain was performed using standard molecular procedures (![]()
-32P-dCTP] (3,000 Ci/mmol; Amersham Pharmacia Biotech) using the Random Prime Labeling Kit (Amersham Pharmacia Biotech). This probe was used to screen 2 x 106 independent phage clones of a
gt11 human brain cDNA library (Clontech) on nitrocellulose filters. Three independent phages were isolated whose sequences partially overlapped that of the original clone. Six additional screenings, each of 2 x 106 phages from a
gt10 human cerebellum cDNA library (Clontech), yielded 20 independent phages. Contig alignment of their inserts led to the assembly of 7,779-bp cDNA. The remaining 1,010 bp at the 5' end ßIV spectrin were cloned by PCR on a human brain Marathon-Ready cDNA library (Clontech) according to the manufacturer protocol using the following reverse primer: 5'-CTCCCGAGGCACAAAGAGGCGACG.
A 444-bp cDNA fragment of ßIV spectrin was amplified by PCR from mouse pancreatic islet cDNA (gift of Dr. R. Flavell, Yale University) using the following primers: (5' primer: GGCTCAGAATAAGGAGTGGCTGGAGAAGAT; 3' primer: AACGGCTCGAGCAGGCGCACCAGGCGC). Computer-assisted analysis of all cDNAs was performed using the following software programs: BLAST (![]()
Chromosomal Localization
Human and mouse BAC clones encompassing the ßIV spectrin gene were isolated at Genome Systems according to established protocols (![]()
![]()
Expression of ICA512 and ßIV Spectrin in COS Cells and Coimmunoprecipitations
A full-length human ICA512 construct in the mammalian expression vector pRC/RSV (Invitrogen) has been described previously (![]()
![]()
1.5 x 107 cells) was used per immunoprecipitation. Insoluble material was removed by centrifugation at 15,000 g for 10 min at 4°C. Triton X-100 soluble material was precleared with 125 µl of 50% slurry protein G sepharose beads (Amersham Pharmacia Biotech). Next, extracts were incubated overnight at 4°C with 10 µl of a monoclonal antibody against the cytoplasmic domain of ICA512 or 50 µl of the ßIV-SD antibody. 100 µl of a 50% slurry protein G sepharose beads was added to each sample and incubated for 1 h on ice. Beads were pelleted by centrifugation, washed three times with 2% Triton X-100 in homogenization buffer without protease inhibitors, and then resuspended in 100 µl of 1x SDS sample buffer. 20 µl of each immunoprecipitate was separated on a 8% SDS-polyacrylamide gel, transferred on nitrocellulose, and immunoblotted with the following antibodies: antiICA512 ectodomain (1:1,000), antiHA (1:10), and antißIV-SD (1:250). Immunoreactivity was detected with alkaline phosphataseconjugated goat antimouse (Sigma-Aldrich) or antirabbit IgG (Roche) (1:5,000).
Northern Blotting
A nitrocellulose filter with
2 µg polyA+ RNA from various human tissues (Multi Tissue Northern blot; Clontech) was hybridized with an
-32P-dCTPlabeled probe including nucleotides 62026526 within the predicted open reading frame of ßIV spectrin. The hybridization was performed according to the manufacturer's instructions. After x-ray exposure for 5 d, the blot was stripped by immersion in boiling water containing 0.5% SDS and rehybridized with a probe specific for human ß-actin provided by the manufacturer.
10 µg polyA+ RNA was purified with an Oligotex Direct mRNA kit (Qiagen) from
4 x 104 human pancreatic islets kindly provided by the JDF Human Islet Distribution Centers at the University of Miami (Miami, FL), and Washington University (St. Louis, MO).
2 µg polyA+ RNA was separated on a 1% agarose gel containing 5% formaldehyde, blotted overnight on nitrocellulose by capillarity and hybridized with a probe including nucleotides 18052356 in the open reading frame of human ßIV spectrin. The autoradiography was developed after a 5-d exposure.
Transfection of ß-Spectrin Constructs in CHO Cells
The cDNAs encoding the carboxy termini of human ßI
2, ßII, ßIII, and ßIV
1 spectrin were amplified by PCR using the following templates: a partial clone of human ßI
2 spectrin cDNA (![]()
1 spectrin (5' primer: GCACCATGCGGATGGCAGAAACGGTGGAC, 3' primer: TTTCTTTTTGCCAAAAAGGCTGAACCGCTT) and ßIII spectrin (5' primer: GCACCATGGGACAACAGAGACTTGAGCAC, 3' primer: CTTGTTCTTCTTAAAGAAGCTGAA); our partial clone B8 for ßIV spectrin (GCACCATGGTGCGGCCACGACCGGAGCGCCAGGAG, 3'primer: CTTCCTGCGCCCGCTGGCCCTGCGATCTCCGCCTTCCC). All cDNAs were subcloned upstream of the V5 epitope tag into pcDNA3.1/V5-His-TOPO/lacZ (Invitrogen) and transfected into CHO cells using the Lipofectin reagent (Life Technologies, Inc.) as described previously (![]()
Biochemical Procedures on Human Islets and Rat Brain Tissues
Approximately 2.5 x 104 purified human pancreatic islets were sonicated on ice in 200 µl homogenization buffer (HB; 10 mM HEPES, pH 7.4, 5 mM EDTA, 1 mM EGTA, 1 mM NaCl, 1 mM PMSF, 10 mM benzamidine, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A, 1 µg/ml antipain). The islet lysates were then solubilized in 2% SDS sample buffer to a final protein concentration of
2.5 mg/ml. SDS insoluble material was removed by centrifugation.
Brain tissues were collected from adult rats, 15- (E15) and 19- (E19) d-old rat embryos and 1- (P1) and 10- (P10) d-old newborn rats. Tissues were homogenized on ice in HB (1:10 wt/vol). Post-nuclear supernatant (PNS) was obtained by centrifugation at 1,000 g for 10 min and solubilized in 2% SDS sample buffer to a final concentration of
1.2 mg/ml. PNS proteins (40 µg/lane) were separated by 6% SDS-PAGE and immunoblotted with ßIV-SD (1:500) or ßIV-CT (1:500) antibodies, followed by peroxidase-conjugated goat antirabbit IgG (1:5,000; Sigma-Aldrich) and enhanced chemiluminescence (Amersham Pharmacia Biotech). As controls, PNS proteins from adult rat brain were blotted with the preimmune rabbit sera as well as with ßIV spectrin antibodies that had been preincubated with 100 µg of the corresponding antigenic peptide.
High-speed pellet (HSP) and high-speed supernatant (HSS) from PNS of adult rat brain were obtained by centrifugation at 100,000 g for 1 h at 4°C. The HSS was collected, while the HSP was brought back to the original volume in HB containing 1% Nonidet P-40 (Boehringer) and 0.5% deoxycholic acid (Sigma-Aldrich). The HSP was solubilized for 2 h at 4°C and centrifuged at 100,000 g for 1 h. After the recovery of the soluble fraction, the HSP insoluble fraction was resuspended and sonicated in an equal volume of HB. PNS, HSS, and HSP soluble and insoluble fractions were dissolved in SDS sample buffer, separated by 6% SDS-PAGE, and blotted with the affinity purified ßIV-CT and ßIV-SD antibodies.
For alkaline phosphatase treatment, adult rat brain tissue was homogenized in HB without EDTA and EGTA. 300 µl of the resulting PNS (
1.8 mg/ml) was incubated with 50 U of calf-intestine alkaline phosphatase (Roche) in phosphatase buffer for 1 h at 37°C. Alternatively, subcellular fractions of rat brain were prepared as described above, and then treated with alkaline phosphatase before SDS-PAGE and immunoblotting.
In Situ Hybridization
35S-labeled riboprobes were prepared with a transcription kit (Promega) using as a template a partial cDNA of ßIV spectrin (bp's 63848792) that had been subcloned into pBluescript SK and KS vectors (Stratagene) as a HindIII-XbaI fragment. The antisense and control sense cRNAs were transcribed in the presence of 35S-UTP (Amersham Pharmacia Biotech) from the XbaI-linearized SK plasmid and the HindIII-linearized KS plasmid, respectively. In situ hybridization on cryosections of rat brain (10 µm) was performed as previously described (![]()
Immunocytochemistry
Males Sprague-Dawley rats (150175 g) were fixed by trans-cardiac perfusion with 1% paraformaldehyde in 120 mM sodium phosphate buffer. Tissues of interest were collected, fixed for an additional 3 h, and then infiltrated with 30% sucrose in PBS. Tissues from rats at days E15, E19, and P10 were collected, fixed in 1% paraformaldehyde for 3 h, and then infiltrated with 30% sucrose. Teased fibers from rat sciatic nerve were prepared and fixed with 1% paraformaldehyde as previously described (![]()
![]()
![]()
| Results |
|---|
|
|
|---|
The COOH-terminal Region of a Novel ß Spectrin Binds the Cytoplasmic Domain of ICA512
ICA512 belongs to the receptor protein tyrosine phosphatase (RPTP) family, but does not display phosphatase activity towards conventional PTP substrates, because its cytoplasmic PTP homology domain differs in two critical residues from that of active PTPs. Specifically, in ICA512, the catalytic aspartate of conventional PTPs is replaced by an alanine (A877, Fig 1 A), while an aspartate (D911) rather than the obligatory alanine is present at position +2 from the catalytic cysteine of active PTPs. The replacement of A877 and D911 with aspartate and alanine, respectively, is sufficient to confer PTP activity to the corresponding ICA512 mutant (ICA512 AD/DA) (![]()
|
L40 yeast cells were cotransformed with LexA-ICA512cyt fused to the DNA binding protein LexA and a human brain cDNA library fused to the Gal4 activation domain in pACT2 as a source for preys. Screening of 107 L40 transformants led to the isolation of
540 colonies positive for the expression of both the reporter genes HIS3 and ß-galactosidase. One of the preys that overcame histidine auxotrophy when expressed with LexA-ICA512cyt (Fig 1 B) was a novel peptide of 493 amino acids whose last 149 residues were >40% similar to the COOH-terminal region of various ß spectrins. This polypeptide, termed B8 (Fig 2 A), also bound to a PTP active mutant of ICA512cyt (ICA512cyt AD/DA) and to the cytoplasmic domain of the ICA512-related protein, PHOGRIN (PHOGRINcyt) (![]()
|
The ability of ICA512 to bind B8 was further investigated by coimmunoprecipitations from extracts of COS cells cotransfected with the cDNAs encoding for full-length ICA512 and HA-tagged B8 (Fig 1 F). In these cells, pro-ICA512 accumulates as a triplet of
110 kD, while the ICA512 transmembrane fragment (ICA512 TMF) generated by the cleavage of the protein's ectodomain represents a minor species (![]()
60 kD in transfected COS cells, but not in mock-transfected COS cells. The size of this protein corresponds to the predicted size of HA-tagged B8. The same protein was also immunoprecipitated from cotransfected COS cells using a monoclonal antibody directed against the cytoplasmic domain of ICA512. These data confirmed the interaction between the two proteins revealed by the two-hybrid assay.
Cloning of Human ßIV Spectrin
Screenings of human brain cDNA libraries by filter hybridization and PCR allowed the contig assembly of an 8,789-bp cDNA, including a 5'-untranslated region of 179 bp and a 3'-untranslated region of 933 bp with a polyadenylation signal and a polyA tail (Genbank No. AF082075) (Fig 2 A). By fluorescence in situ hybridization, this new gene, termed ßIV spectrin, was localized on human chromosome 19q13.13 and on the synthenic region on mouse chromosome 7b2 (not shown). Through BLAST analysis, we matched the cDNA of ßIV spectrin to a genomic sequence from human chromosome 19 in the High Throughput Genomic Sequence database (Genbank No. AC021625). Comparison of this genomic sequence, which corresponds to a first draft of 34 unordered pieces, with the cDNA of ßIV spectrin revealed that the latter is generated from 36 exons (Fig 2 B). All exons, except for exon 17, are found in this genomic sequence and are flanked by canonical donor/acceptor intron sites. This genomic region still contains many gaps of unknown length, which may account for the apparent absence of the exon 17 (bp's 38194021) found in the cDNA sequences.
A high degree of similarity was found between portions of the ßIV spectrin cDNA and another genomic sequence of 100 unordered pieces from chromosome 16 (Genbank No. AC009140.4). This genomic draft contains 18 sequences that are bounded by donor/acceptor intron sites and are very conserved with 18 exons of ßIV spectrin (exons 1, 811, 13, 1517, 19, 25, 26, 28, 29, 32, 3436) (not shown). This genomic draft, however, did not appear to include the remaining exons of ßIV spectrin. Our cDNA contig for ßIV spectrin and the genomic sequence on chromosome 19 only differed in three base pairs, possibly because of polymorphism or sequencing artifacts. In contrast, six of the ßIV spectrin-related exons on chromosome 16 contained many base substitutions, deletions, or insertions compared with the related exons in ßIV spectrin. These data confirmed that our cDNA contig was entirely derived from the ßIV spectrin gene on chromosome 19. They also suggested, on the other hand, that a gene closely related to ßIV spectrin resides on chromosome 16. Cloning and characterization of this gene, provisionally termed ßVI spectrin, is in progress.
The conceptual translation of the ßIV spectrin cDNA corresponds to a protein of 2,559 amino acids with a predicted molecular weight of
288 kD and an isoelectric point of
5.9. The putative starting methionine of ßIV spectrin is not in the context of a Kozak sequence, but it is preceded in the 5'-untranslated region by an in-frame stop codon. The domain structure of ßIV spectrin closely resembles that of other ß spectrins (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
spectrin (![]()
![]()
The region of 294 residues between the repeat 17 and the PH domain is specific for ßIV spectrin as it shows no similarity with regions present in other ß spectrins. This domain is rich in prolines (15% of the residues), is very basic (pI: 10.5), and contains a motif of five residues (ERQES) that is repeated four times within a stretch of 90 residues (residues 22202309, henceforth defined as ERQES domain). An identical motif was not found in any other protein in public databases. The ERQES domain is highly charged (55.5% charged residues) because of its high content in glutamate (23.3%), glutamine (8.8%), and arginine (26.6%). The presence of only two aspartates (2.2%) and the absence of asparagines and lysines, however, indicates that there is a strong bias toward specific residues in this region. The equal spacing of 13 residues between the ERQES repeats 13 further suggests the repetitive nature of this domain. Interestingly, the sequence corresponding to the third ERQES repeat and the four following residues (ERQESAEHE) is 77% identical to the sequence ERLEKAEHE within spectrin repeats 1 of human ßII (residues 397405) and ßIII (residues 400408) spectrin (Fig 2 E). The motif ERLEKAEHE is part of a domain that associates ßII spectrin with membranes, presumably via proteinprotein interaction (![]()
![]()
ßIV spectrin contains numerous putative SH3 binding sites (Fig 2 D). Two of these proline-rich motifs (residues 18591864 and 24052411) are adjacent to putative membrane association domains. Specifically, the first of these motifs precedes the putative B helix in repeat 15, which may act as an ankyrin-binding site, while the second motif precedes the PH domain. The PH domain of ßIV spectrin is very conserved with the corresponding domains in ßI
2, ßII, and ßIII spectrins and is therefore likely to bind phosphoinositides, such as phosphatidylinositol 4,5 bisphosphate (![]()
ßIV Spectrin Is Alternatively Spliced
Our data indicated that ßIV spectrin undergoes alternative splicing. Specifically, one cDNA clone of
2.4 kb contained an insert of 88 bp between exon 17 and 18, which was not present in overlapping cDNA clones (Fig 2 F). This insert was also found in the ßIV spectrin gene, where it is flanked by canonic donor and acceptor splice sites at its 5' and 3' ends. Insertion of this exon, termed 17B (Fig 2B and Fig f), introduces a stop codon in the open reading frame of ßIV spectrin, thereby causing its termination in spectrin repeat 9. The conceptual translation of this cDNA corresponds to a polypeptide of 1,302 amino acids with a predicted molecular weight of
145 kD. In a different reading frame, on the other hand, exon 17B encodes for a methionine that is preceded by a stop codon in exon 17 and is in frame with the remaining COOH-terminal portion of ßIV spectrin (Fig 2B and Fig f). Recognition of this methionine as a novel initiation site for translation would generate an additional polypeptide of 1,307 amino acids with an expected molecular weight of
149 kD. It is conceivable that the inclusion of exon 17B gives rise to a bicistronic mRNA, whose translation produces two different ßIV spectrin proteins. Based on the established nomenclature for spectrins (![]()
1 spectrin, and hence we will refer to these two variants as ßIV
2 and ßIV
3 spectrin (Genbank No. AY004226).
In an additional clone, an insert of 315 bp (exon 30B) followed exon 30 (Fig 2B and Fig f). This insert encodes 42 amino acids and a stop codon, contains a polyadenylation site, and was found in the ßIV spectrin gene, where it is flanked by canonic 5' and 3' splice sites. The isoform including this exon corresponds to a polypeptide of 2,149 amino acids (expected molecular weight:
242 kD), which contains the calponin-homology domain and all 17 spectrin repeats, but lacks the specific domain and the PH domain (Fig 2 F). This isoform has been termed ßIV
4 spectrin (Genbank No. AY004227). A search in publicly available databases revealed the presence of a partial cDNA clone (Genbank No. AL133093) of 1,444 bp from human testis that is 100% identical to ßIV spectrin in the region corresponding to nucleotides 48506082, but differs from it in the remaining 211 bp at the 3' end. This divergent sequence encodes 30 residues, followed by a stop codon and a polyA stretch of 109 bp. On chromosome 19, however, the 102 bp preceding the polyA stretch are found immediately after exon 27 of ßIV spectrin, where they are not preceded by a canonic 5' splice site. Furthermore, this sequence does not contain a polyadenylation signal. Thus, this clone includes a part of the intron following exon 27.
Expression of ßIV Spectrin mRNAs
The expression of ßIV spectrin was analyzed by Northern blotting on polyA+ RNA from various human tissues using a 324 bp probe within the region encoding for the specific domain common to ßIV
1 and ßIV
3 spectrin. This probe hybridized with three transcripts of
9.0,
5.1, and
3.1 kb, all of which were predominantly expressed in brain (Fig 3 A). The relationship of these transcripts with ßIV spectrin was suggested by their detection with a distinct probe derived from the 3' untranslated region of ßIV spectrin (not shown). A mRNA of
9.0 kb is in good agreement with the size of the ßIV
1 spectrin cDNA. Both the
9.0 and the
5.1 kb transcripts were also detected in various regions of the rat brain, including cerebellum, thalamus, midbrain, medulla, frontal, and posterior cortex and hippocampus (data not shown). Weaker signals for the
9.0-kb transcript were detected in human skeletal muscle and kidney, while the
5.1-kb transcript was barely detectable in pancreas (Fig 3 A). Since pancreatic islets account for only
3% of the pancreas weight, we directly assessed the expression of ßIV spectrin on polyA+ RNA isolated from purified human pancreatic islets. In pancreatic islets, as in brain, the ßIV spectrin probe hybridized with three transcripts of
8.5,
4.2, and
2.3 kb (Fig 3 C). The expression of ßIV spectrin in pancreatic islets was confirmed by the amplification by PCR from mouse islets of a product whose cDNA (Genbank No. AF203696) was 98% identical to nucleotides 42234665 of human ßIV spectrin.
|
ßIV Spectrin Proteins in Brain and Pancreatic Islets
We further analyzed by Western blotting the expression of ßIV spectrin in brain and pancreatic islets, tissues that are enriched in ICA512. To this end, we used two affinity-purified antibodies directed against peptides encoding amino acids 22372256 in the specific domain (ßIV-SD) and 2542-2559 at the COOH terminus (ßIV-CT) of ßIV
1 spectrin. These peptides were chosen on the basis of their predicted antigenicity and because they share no significant homology with sequences in other
and ß spectrins. Both antibodies reacted by Western blotting with the ßIV spectrin fragment B8 transiently expressed in COS cells (Fig 1 F, and not shown). The ßIV-CT antibody recognized two proteins of
250 and 160 kD in rat brain PNS and total extracts of purified human islets (Fig 4 A), while it detected an additional protein of
140 kD in rat brain only (Fig 4A and Fig B). Preincubation of the ßIV-CT antibody with the antigenic peptide blocked its binding to these three proteins, supporting their relationship with ßIV spectrin (Fig 4 A). Taking into account the aberrant electrophoretic mobility displayed by all known spectrins (![]()
![]()
![]()
250-kD protein might correspond to ßIV
1 spectrin, which has a predicted molecular weight of
288 kD. The identity of the
160- and
140-kD proteins remains to be established. Accordingly, we will provisionally refer to these proteins as ßIV spectrin 160 and 140. The ßIV-SD antibody produced a similar immunoblot pattern (Fig 4 B), consistent with the possibility that the
250-,
160-, and
140-kD proteins originate from the ßIV spectrin gene. The ßIV-SD antibody, however, recognized much less prominently ßIV spectrin 160 in brain, and even less in islets (Fig 4 B). The peptide used to raise the ßIV-SD antibody is located within the ERQES domain and contains several optimal consensus sites for serine phosphorylation. We asked therefore whether the limited reactivity of the ßIV-SD antibody toward ßIV spectrin 160 could result from the phosphorylation of its epitope within this protein. Evidence that treatment of rat brain PNS with alkaline phosphatase dramatically enhanced the reactivity of the ßIV-SD antibody toward ßIV spectrin 160 (Fig 4 B) corroborated this hypothesis. The labeling of ßIV
1 spectrin and ßIV spectrin 140, on the other hand, was unaffected. As expected, the reactivity of the ßIV-SD antibody was completely blocked by the incubation with its immunogenic peptide (Fig 4 B).
|
ßIV Spectrins Have Different Biochemical Properties
Upon subcellular fractionation of brain homogenates, both ßIV
1 spectrin and ßIV spectrin 140 were recovered in the HSP, while ßIV spectrin 160 was distributed between the HSS and the HSP (Fig 5 A). Virtually all ßIV
1 spectrin partitioned in the HSP detergent-insoluble material (Fig 5A and Fig B). ßIV spectrin 160 and 140, on the other hand, were found in both the HSP detergent soluble and insoluble fractions (Fig 5A and Fig B). Notably, the pools of ßIV spectrin 160 in the HSS and HSP detergent soluble fraction did not react with the ßIV-SD antibody (Fig 5 B), unless these fractions were preincubated with alkaline phosphatase (Fig 5 C). These data suggest that phosphorylation of the ERQES domain is associated with the solubilization of ßIV spectrin 160 and its dissociation from membranes. Treatment of the PNS with alkaline phosphatase did not affect the subcellular distribution of ßIV
1 spectrin, but allowed an increased recovery of ßIV spectrin 140 in the HSP-soluble fraction (Fig 5 D). This treatment also resulted in a shift of most of ßIV spectrin 160 from the HSP to the HSS (Fig 5 D). Taken together, these results suggest that the interaction of ßIV spectrins with cytoskeletal and/or membrane proteins is modulated by phosphorylation.
|
Localization of ßIV Spectrin in Pancreatic Islets
To rule out the possibility that our anti-ßIV spectrin antibodies would recognize other ß spectrins by immunocytochemistry, both antibodies were employed for the staining of CHO cells transiently transfected with V5-tagged COOH-terminal domains of ßI
2 (amino acids 21172328), ßII
1 (21402365), ßIII (amino acids 21542390), or ßIV
1 spectrin (22222559). All four spectrin fragments were recognized by the anti-V5 mouse monoclonal antibody and partitioned, albeit to a different extent, between the cytosol and the nucleus of transfected cells (Fig 6 A). Conversely, the ßIV-CT (Fig 6 A) and ßIV-SD (not shown) antibodies only stained CHO cells expressing the COOH-terminal region of ßIV
1 spectrin.
|
The tissue and intracellular distribution of ßIV spectrin was then investigated by confocal microscopy using the ßIV-CT antibody. In rat pancreas, ßIV spectrin immunoreactivity was restricted to pancreatic islets. Like ICA512, ßIV spectrin was detected in both the insulin-secreting ß cells as well as in the surrounding
cells that secrete glucagon (Fig 7, AF). In ß cells, there was a fine punctate staining throughout the cytoplasm (not shown). A more intense cytoplasmic labeling was observed in the
cells (Fig 7, AF), often in correspondence of rod-like perinuclear structures of several micrometers in length (Fig 7 G). These organelles did not significantly overlap with secretory granules, as shown by double labeling for glucagon (Fig 7 H). The specificity of this staining was suggested by its complete disappearance when the ßIV-CT antibody was preincubated with its antigenic peptide (Fig 7. I). ß Spectrins are known to associate with various intracellular compartments, including the Golgi complex, endosomes, and lysosomes (![]()
![]()
![]()
cells. There was no significant colocalization of ßIV spectrin with
-adaptin and TGN38, two markers of the trans-Golgi network, with the endosomal markers transferrin receptor and early endosomal antigen-1 or with the lysosome marker lgp120 (not shown). Thus, the identity of the ßIV spectrin-immunoreactive structures in pancreatic islets remains to be established.
|
ßIV Spectrin Is Present at the Axon Initial Segments and Nodes of Ranvier in the Central and Peripheral Nervous System
In brain, expression of ßIV spectrin was first examined by in situ hybridization on adult rat brain sections using an antisense riboprobe corresponding to the partial ßIV spectrin clone B8. The highest levels of expression were detected in the cell bodies of large myelinated neurons, such as pyramidal neurons of the hippocampus, granule cells of the dentate gyrus, and Purkinje cells of the cerebellar cortex (Fig 8). No signal was detected in nonneuronal cells, including glial and endothelial cells. Likewise, no signal was detected on sections incubated with the corresponding control sense riboprobe (not shown).
|
By immunocytochemistry on rat brain sections, the ßIV-CT antibody produced a strong labeling of pyramidal neurons in the cerebral cortex and the hippocampus, granule cells of the dentate gyrus, and Purkinje cells in the cerebellum (Fig 9, and data not shown). This immunolabeling was most prominent in the axon initial segments (Fig 9A, Fig D, and Fig G) and nodes of Ranvier (D and H), while no staining was observed in the myelinated internodal segments, as visualized with an antibody against myelin basic protein (Fig 9B and Fig C). A fine granular staining reminiscent of the labeling observed in pancreatic islets was appreciable in the perikarya of Purkinje cells (Fig 9 A). No immunoreactivity was detected in dendrites, axon terminals, glial cells, or blood vessels. The specificity of this labeling was supported by the absence of staining in sections incubated with the corresponding rabbit preimmune serum (not shown) and by the ability of the antigenic peptide to compete with endogenous ßIV spectrin for the binding of the ßIV-CT antibody (not shown). Immunocytochemistry on dissociated myelinated fibers from the rat sciatic nerve showed that, like in the central nervous system, ßIV spectrin is concentrated at the nodes of Ranvier in the peripheral nervous system (Fig 9 I).
|
Previous studies demonstrated that, in neurons, the ankyrinG 480/270-kD isoform (also known as ankyrin3) is selectively concentrated at initial segments and nodes of Ranvier (![]()
![]()
![]()
![]()
The ßIV Spectrin Isoform Localized at the Axon Initial Segments Is ßIV
1 Spectrin
Next, we investigated the expression of ßIV spectrin during brain development. By Western blotting, ßIV
1 spectrin was first detected at embryonic day 19 and its expression level progressively increased until adult age (Fig 10). ßIV spectrin 140 appeared only after birth and, similar to ßIV
1 spectrin, it was maximally expressed in the adult. ßIV spectrin 160, instead, was already present at embryonic day 10, and its level appeared constant throughout development. These data further suggested that ßIV spectrin 160 is not a proteolytic fragment of ßIV
1 spectrin.
|
The expression of ßIV spectrin during brain development was also investigated by immunocytochemistry (Fig 11). A weak immunoreactivity for ßIV spectrin was detectable in the neurons of the developing hippocampus at embryonic day 15, but there was no staining reminiscent of axon initial segments (Fig 11 A). By embryonic day 19, however, the initial segments were clearly labeled both in the cortex and the hippocampus (Fig 11 B). Many more initial segments positive for ßIV spectrin were present by postnatal day 10 in both regions (Fig 11 C, and data not shown), with maximum immunoreactivity in the adult brain (D). Taken together, these data suggested that ßIV
1 spectrin is the specific isoform localized at axon initial segments.
|
| Discussion |
|---|
|
|
|---|
In this study, we have identified a novel spectrin gene in human, termed ßIV spectrin, that is localized on chromosome 19q13.13. The longest product of this gene, termed ßIV
1 spectrin, includes 36 exons and corresponds to a protein of 2,559 amino acids, whose domain structure closely resembles that of other ß spectrins (for review, see ![]()
![]()
![]()
1 spectrin contains two calponin-homology domains at its NH2 terminus and may therefore associate with F-actin and protein 4.1. Similar to other ß spectrins, it may also interact with ankyrin through spectrin repeat 15 and with an
spectrin via its partial spectrin repeat 17, whereas its COOH-terminal PH domain could bind phospholipids. ßIV
1 spectrin also contains a specific domain between its partial spectrin repeat 17 and the PH domain. This very basic domain includes several putative SH3 binding sites and a unique ERQES domain in which there is a sequence of significant similarity with a motif within the membrane association domain of ßII and ßIII spectrin (![]()
![]()
1 with other proteins.
The apparent size of the ßIV
1 spectrin transcript was
9.0 kb in brain and
8.5 kb in pancreatic islets. In both tissues, however, ßIV
1 spectrin was detected as a protein of 250 kD. The small discrepancy in the size of the transcripts may result therefore from tissue-specific differences in the untranslated region or from variations in the laboratory procedures, as the blot of human islets was prepared in our laboratory, while the blot including the brain sample was acquired from a commercial source.
Similar to other ß spectrins, the ßIV spectrin gene undergoes alternative splicing. Specifically, we have identified three ßIV spectrin splice variants in addition to ßIV
1 spectrin. Two of these isoforms, ßIV
2 and ßIV
3 spectrin, originate from one messenger that contains an additional exon (exon 17B) between exons 17 and 18 of ßIV
1 spectrin. The predicted amino acid sequences of ßIV
2 and ßIV
1 spect