|
||
Article |
Address correspondence to Harald Hirling, Faculté des Sciences de la Vie, EPFL, Lausanne 1015, Switzerland. Tel.: 41-21-693-5363. Fax: 41-21-693-5369. E-mail: harald.hirling{at}epfl.ch
| Abstract |
|---|
|
|
|---|
Key Words: recycling; SNARE; transferrin; development; 1A75
| Introduction |
|---|
|
|
|---|
Internalization and insertion of membrane proteins in a temporally and spatially ordered manner is extremely important during neuronal differentiation and in adult neurons. Endosomal organelles have been identified in growth cones of developing neurons (Dailey and Bridgman, 1993; Diefenbach et al., 1999). The role of endosomal protein recycling for signal transduction during development has been shown in a number of cases, including the cell adhesion molecule L1 (Kamiguchi and Lemmon, 2000) and the high-affinity nerve growth factor receptor TrkA (Grimes et al., 1996). Likewise,
-aminobutyric acid receptors (Wan et al., 1997) are recruited from internal compartments during insulin stimulation in adult neurons. In addition, recent studies indicate a rapid alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA) receptor cycling through endosomes during synaptic transmission and plasticity (Carroll et al., 1999; Beatti et al., 2000; Ehlers, 2000; Lin et al., 2000), and a switch between different AMPA receptor subunits during synaptogenesis (Pickard et al., 2000; Zhu et al., 2000).
Endosomal trafficking implies docking and fusion of transport vesicles. This depends on SNARE (Rothman, 1994). Syntaxin 13 is a SNARE localized to REs (Prekeris et al., 1998; Tang et al., 1998; Hirling et al., 2000). Antibody blocking of syntaxin 13 in permeabilized cells inhibited transferrin (Tf) release, suggesting that it acts on a recycling compartment (Prekeris et al., 1998). Such antibodies also inhibited in vitro EE fusion, and syntaxin 13 forms a complex with the Rab5 effector proteins EEA1 and Rabaptin-5 (McBride et al., 1999). We have previously identified syntaxin 13 from early postnatal brain as a copurifying band on an antiSNAP-25 immunocolumn. We have also shown that syntaxin 13 is strongly expressed in developing brain and enhances neurite outgrowth in PC12 cells (Hirling et al., 2000), suggesting an important role of the endocytic pathway during neuronal development.
Despite the morphological characterization of endosomes in neurons and their importance in receptor cycling, little is known about specific neuronal proteins involved in this process. The strong expression of syntaxin 13 during development and its outgrowth-enhancing effect prompted us to search for syntaxin 13binding proteins from developing brain. Here we describe that neuron-enriched endosomal protein of 21 kD (NEEP21) is in a complex with syntaxin 13. NEEP21 has previously been cloned as a neuron-enriched, developmentally regulated membrane protein called 1A75 (Sutcliffe et al., 1983) or p21 (Saberan-Djoneidi et al., 1998) whose function has been unknown. We now show that it localizes to Rab4-positive endosomes in the somatodendritic neuronal compartment. Its overexpression accelerates, whereas down-regulation strongly delays Tf and L1 recycling. Finally, we also show that upon N-methyl-D-aspartate (NMDA) stimulation of hippocampal neurons, AMPA receptors are internalized into NEEP21-positive compartments, and that recycling of AMPA receptors is delayed by NEEP21 down-regulation.
| Results |
|---|
|
|
|---|
|
Analysis of the NEEP21 primary sequence suggested a hydrophilic NH2-terminal domain (aa 184), one transmembrane region (aa 85103), and a hydrophilic COOH-terminal domain (aa 106185) (Saberan-Djoneidi et al., 1998). To analyze its membrane orientation, membrane fractions of nontransfected PC12 cells, or cells transfected with either full-length NEEP21-EE (aa 1185), its NH2 terminus (aa 1106), or its COOH terminus (aa 77185), were analyzed using antibodies recognizing the NH2 (anti-NEEP21) or COOH terminus (anti-EE) (Fig. 2 A). Without trypsin digestion, anti-NEEP21 recognized endogenous NEEP21 (arrow) as well as transfected full-length protein (arrowhead) and the NH2 terminus (asterisk). In addition, a potential degradation product at
17 kD was detected. Upon trypsin digestion, endogenous and transfected full-length proteins were not detectable, whereas the 17-kD band and an additional degradation band appeared. In contrast, the transfected NH2 terminus was detectable at the same size before or after digestion (asterisk). The weaker bands after digestion can be explained by organelles that did not stay sealed upon cell breakage. Trypsin incubation in the presence of detergent, which lyses organelle membranes, erased all bands (Fig. 2 A). These data indicated that the NH2-terminal domain is protected by membranes. In cells transfected with full-length NEEP21-EE (arrowhead) or its COOH terminus (
), anti-EE recognized both proteins, but no protected fragments remained after digestion with or without detergent (Fig. 2 A). Taken together, these results suggested that the COOH terminus is oriented toward the cytosol, whereas the NH2 terminus is on the lumenal side of organelle membranes. Because no labeling was observed in anti-NEEP21 immunostainings in the absence of detergent (unpublished data), it is unlikely that a significant fraction is localized to the plasma membrane. To analyze whether a NEEP21 mutant lacking the NH2-terminal lumenal tail is able to form a complex with syntaxin 13, COS-7 cells were cotransfected with mycsyntaxin 13 and either full-length NEEP21-EE or aa 77185-EE. Indeed, anti-EE coprecipitated in both cases syntaxin 13 (Fig. 2 B).
|
P14 (Fig. 2 C). This pattern is also similar to the one of syntaxin 13 (Hirling et al., 2000). In contrast, synaptic vesicle protein (SV)2 increased during the first two postnatal weeks. To correlate this developmental profile with differentiation in dissociated neurons, we investigated NEEP21 levels in cortical neuronal cultures at different stages (Fig. 2 D). SV2 increased during the investigated 3 wk, whereas NEEP21 was already strongly detected on day 2, and started to decline at around day 14. We also confirmed the reported neuronal expression of NEEP21 mRNA (Sutcliffe et al., 1983; Saberan-Djoneidi et al., 1998) at the protein level using extracts of mouse cortical neuron and astrocyte cultures (unpublished data). Together, these data indicate that NEEP21 is strongly expressed in neurons during maturation and synapse formation.
NEEP21 is detected in Tf- and Rab4-positive, wortmannin-sensitive endosomes
Next, we analyzed the localization of NEEP21 by immunofluorescence. In differentiated PC12 cells, endogenous (Fig. 3 A) as well as transfected EE-tagged (Fig. 3 D) NEEP21 localized to puncta in the cell body and along neurites. There is a significant colocalization with the less regularly shaped mycsyntaxin 13-labeled organelles (Fig. 3, B, overlay in C, and compare inserts in AC). Overlap between transfected NEEP21-EE (Fig. 3 D) and trans-Golgi network (TGN)38 (Fig. 3 E) is limited to the perinuclear region. Due to the coprecipitation with syntaxin 13, we tested for an endosomal localization of NEEP21. We internalized Tf as a marker of the endosomal recycling pathway. PC12 cells with prebound surface FITC-labeled Tf were incubated for 3 or 15 min to allow Tf endocytosis (Fig. 3, H and K). At 3 min, labeled peripheral endosomes colocalized rarely with NEEP21 puncta (Fig. 3, G and overlay in I), whereas at 15 min, the majority of signals indicated colocalization (Fig. 3, J, K, and overlay in L). Because at 3 min Tf should localize to endocytic vesicles transported to or fusing with EEs, NEEP21 is primarily associated with Tf-positive compartments beyond the transport to EEs. To analyze whether NEEP21 also localizes to late endosomes, we costained PC12 cells for NEEP21 (Fig. 3 M) and lysobisphosphatidic acid (LBPA) (Fig. 3, N and overlay in O), a phospholipid enriched in late endosomes (Kobayashi et al., 1998). No colocalization was observed, ruling out a late endosomal localization of NEEP21. These results indicate that NEEP21 localizes to EEs or REs.
|
|
|
SNAP, Rab11, and Rab4 were not affected. Therefore, we used the antisense plasmid to analyze the effect of NEEP21 suppression on receptor cycling.
|
In an equivalent assay using peroxidase-conjugated Tf (HRP-Tf), we confirmed the accelerated internalization upon NEEP21 transfection. We used the rat pancreatic ß cell line HIT-T15 because of its high transfection efficiency, and a low binding of human Tf to nontransfected control cells. When HRP activity was measured in cell lysates, we found that cells overexpressing NEEP21 (Fig. 6 E, gray bars) had significantly more Tf internalized at 3 min (20.64% vs. 13.25%; P < 0.001), as well as at 8 min (32.67% vs. 21.64%; P < 0.001), than the vector-transfected cells (black bars).
To verify whether cycling of other, unrelated membrane proteins is also modulated in PC12 cells by NEEP21, we tested recycling of the neuronal adhesion molecule L1 (Kamiguchi and Lemmon, 2000). Costaining shows significant colocalization of internal L1 in NEEP21-positive endosomes (Fig. 6 F, arrowheads). By surface labeling using an extracellularly binding anti-L1 antibody on PC12 cells (preblocked at 0-min time point), we found that antisense transfection (Fig. 6 G, white bars) significantly retarded reinsertion of L1 into the plasma membrane compared with GFP transfection (black bars; P < 0.01 at 45, 60, and 120 min). There was a marginal acceleration by overexpression at 30 and 60 min (gray bars; P < 0.012). These results indicate that NEEP21 is essential for correct receptor cycling in PC12 cells. It also suggests that it might act on a large range of different receptors.
NEEP21 is a somatodendritic protein involved in AMPA receptor cycling
We next analyzed the localization of NEEP21 to specific neuronal domains using markers of the somatodendritic compartment (MAP2), axons (Tau, SNAP-25), and SVs (SV2, synaptophysin). NEEP21-positive puncta were present in the cell body and processes (Fig. 7, A, D, G, J, and M), which in all cases were positive for MAP2 (Fig. 7, B and overlay in C). In contrast, fibers outlined by Tau (Fig. 7 E) and SNAP-25 (Fig. 7 H) did not overlap with NEEP21. This shows that NEEP21 localizes to the somatodendritic compartment of neurons. To rule out that the NEEP21-labeled structures were presynaptic boutons, we costained for SV2 (Fig. 7 K) and synaptophysin (Fig. 7 N). Although the signals were clearly segregated, the processes outlined by NEEP21 were often surrounded by the synaptic vesicle markers. This is evident in the selected areas of Fig. 7, J and K, and M and N, which are enlarged in the overlays, L and O, respectively. This suggests that there are synapses onto NEEP21-containing dendrites.
|
|
| Discussion |
|---|
|
|
|---|
NEEP21, also called 1A75 (Sutcliffe et al., 1983), p21 (Saberan-Djoneidi et al., 1998), or D4S234 (Carlock et al., 1996), as well as the highly homologous p19 (Saberan-Djoneidi et al., 1995), are proteins of so far unknown function, strongly enriched in neurons. NEEP21 is 98.4% identical between mouse and human, and 99.5% between rat and mouse. Two EST sequences (AJ394144 and AJ393704) indicate the existence of a chicken homologue 88% identical to human NEEP21. A predicted
-helix between aa 164181 in its cytosolic COOH-terminal tail might be involved in protein complex formation. The 24-kD protein calcyon, which regulates dopamine receptors D1 (Lezcano et al., 2000), is 37% identical to NEEP21. It has the same membrane orientation as we determined here for NEEP21.
NEEP21 significantly colocalized with syntaxin 13, Rab4, TfR, and internalized Tf, but not with a late endosome marker. In addition, overexpression or down-regulation of NEEP21 modulated Tf cycling. Therefore, we conclude that NEEP21 is mainly localized to an early endosomal population. Its colocalization with the TGN marker TGN38 in the perinuclear region might be due to either NEEP21 during biosynthesis, or its presence in perinuclear endosomes close to Golgi compartments (Gruenberg and Maxfield, 1995), or a subpopulation of NEEP21 localized to TGN. Similar to our staining, Saberan-Djoneidi et al. (1998) identified NEEP21/p21 in a punctated staining in the juxtanuclear region and in the periphery of neurons. Although double labeling was not performed, the authors interpreted the staining as Golgi complex.
Using double labelings and drug treatments, we analyzed in detail the NEEP21 localization along the endosomal pathway. Rab5 is involved in endocytosis (McLauchlan et al., 1998) and vesicle fusion on EEs (Gorvel et al., 1991), Rab4 in trafficking from EE to the plasma membrane (van der Sluijs et al., 1992) and presumably also to REs (Nagelkerken et al., 2000), and Rab11 in trafficking through REs (Ullrich et al., 1996). Recent data from imaging in living cells (Sonnichsen et al., 2000) and from immunoisolation of endosomal populations (Trischler et al., 1999) suggest a wortmannin-sensitive Rab5/Rab4 domain and a BFA-sensitive Rab4/Rab11 domain along the endosomal pathway. We found here that NEEP21 colocalized significantly with Rab4-positive endosomes, whereas little overlap was observed with Rab5- and EEA1-labeled endosomes in PC12 cells. In addition, wortmannin, but not BFA, relocalized NEEP21, together with TfR in primary neurons. Together with the delayed colocalization with Tf, we propose that NEEP21 localizes mainly to a Rab4-positive domain on EE involved in transport to RE or to the plasma membrane. The GTPase-deficient mutant Rab5Q79L causes enlarged endosomes by an increased fusion of endocytosed vesicles with EE (Stenmark et al., 1994). NEEP21, located primarily to a Rab4-domain of EE, would obviously be affected by Rab5Q79L-induced EE enlargement.
Syntaxin 13 was detected on tubular RE (Prekeris et al., 1998) which could be enriched using an anti-Rab11 antibody, whereas lower amounts were also detected in antiRab5-enriched endosomes (Trischler et al., 1999). Moreover, syntaxin 13 has been identified in a complex with the Rab5-effectors Rabaptin-5 and EEA1 (McBride et al., 1999). Therefore, syntaxin 13 might act on REs and EEs, where it could interact with NEEP21. Although we did not detect EEA1 or Rabaptin-5 in anti-NEEP21 immunoprecipitations (IPs) (unpublished data), this does not rule out that NEEP21 is involved in the formation of the labile EEA1/Rabaptin/syntaxin 13 complex (McBride et al., 1999).
Overexpression of NEEP21 caused a significant acceleration of Tf cycling, whereas antisense-mediated down-regulation lead to an inhibition of recycling. In light of the described NEEP21 localization, faster decrease of internal Tf upon overexpression is most probably an accelerated recycling of Tf to RE or to the plasma membrane. This could indirectly stimulate earlier steps of the cycle causing faster internalization. Upon NEEP21 down-regulation, Tf might correctly internalize into EEs, but an inhibited transport to the plasma membrane or to REs might retain Tf for longer time in endosomal compartments.
In contrast to other known endosomal proteins, NEEP21 has only been detected in neurons and, at a lower level, in testis (Sutcliffe et al., 1983; Saberan-Djoneidi et al., 1998). Therefore, it is probably not engaged in ubiquitous endosomal trafficking. In primary neurons, NEEP21 localized to processes positive for a dendritic marker, but negative for axonal markers. Consequently, the function of NEEP21 must be specific to endosomal trafficking of somatodendritic membrane proteins of neurons. Recent studies have proven the importance of AMPA receptor internalization for the expression of long-term depression, a form of synaptic plasticity (Carroll et al., 1999; Beatti et al., 2000). The endocytosed receptors are detected in syntaxin 13 (Lin et al., 2000) and Rab4-positive (Ehlers, 2000) compartments. We found here that among the three stimuli applied, NMDA resulted in the strongest colocalization between the AMPA receptor subunit GluR2 and NEEP21. In addition, antisense-mediated down-regulation of NEEP21 retarded recycling of GluR1 (and marginally of GluR2) after NMDA application. Because NMDA receptor activation has been proposed to cause AMPA receptor internalization with subsequent recycling to the plasma membrane (Ehlers, 2000), our results indicate that NEEP21 is an important component in the machinery necessary for AMPA receptor recycling. Expression of NEEP21 mRNA (Sutcliffe et al., 1983; Saberan-Djoneidi et al., 1998) and protein (present study) is highest during the first postnatal week. AMPA receptors are recruited into NMDA receptor-containing synapses during postnatal development, with a subsequent switch of receptor subunits (Pickard et al., 2000; Zhu et al., 2000). Our results correlate well with a role of NEEP21 in such a recruitment and/or subunit exchange during synaptogenesis.
Suppression of NEEP21 not only affected AMPA receptor cycling, but also TfR and L1 in PC12 cells. Because these three molecules are rather divergent plasma membrane proteins, NEEP21 probably acts on a larger range of receptors than only on one specific type. Although further studies will have to clarify the precise function of NEEP21, this protein is, to our knowledge, the first neuronal protein with a distinct localization in the early endosomal pathway and with a function in the cycling of neuronal receptors.
| Materials and methods |
|---|
|
|
|---|
SNAP (W 1:2,000, a gift of Dr. R. Jahn [Max-Planck Institute, Göttingen, Germany]); Rab4, Rab11, and EEA1 (IF 1:300; W 1:2,000; Transduction Labs); GluR2 (IF, 1:250; Chemicon); lysobisphosphatidic acid (clone 6C4; IF 1:50, a gift of Dr. J. Gruenberg [University of Geneva, Geneva, Switzerland]); and synaptophysin (IF 1:250; Synaptic Systems). We applied HRP- (W 1:2,000; Calbiochem), Cy3-, Cy5- (IF 1:200; Jackson ImmunoResearch Laboratories), and Oregon Greencoupled (IF 1:200; Molecular Probes Inc.) secondary antimouse and antirabbit IgG.
Identification of NEEP21
Immunoaffinity chromatography and Western blots were performed as described (Hirling et al., 2000) with modifications: (a) An antisyntaxin 13 column was used; (b) membrane pellets were lysed in B/1% Triton X-100 (T)/0.1 M KCl (K)/10 µM Taxol (Sigma-Aldrich) to reduce tubulin content; (c) columns were washed by 20 vol of B/1% T/0.1 M K, 2 vol of B/0.2% T/0.1 M K, 2 vol of B/0.2% T/0.5 M K, 1 vol of B/0.2% T/1 M K, and 1 vol of B/0.2% T/0.1 M K; and (d) purifications from 21 g of P3 rat brain were pooled, and a band at 21 kD was cut out from gel for peptide sequencing. A single peak contained a sequence matching the brain-specific clone 1A75/p21 (Sutcliffe et al., 1983; Saberan-Djoneidi et al., 1998). We amplified, by PCR, a full-length mouse clone using oligo-dTprimed mouse brain cDNA. To express tagged protein, the myc-hiscoding sequence between XbaI and PmeI of pcDNA3.1/myc-his.B (Invitrogen) was replaced by GAGTACATGCCCATGGAGTGA coding for the EE tag EYMPMEstop (Grussenmeyer et al., 1985). The cDNA of full-length or deleted mouse 1A75, which we propose to name NEEP21, was subcloned by PCR into EcoRI/XhoI upstream of this EE tag, a gift of Dr. D. Lavery (ICBM, Lausanne, Switzerland). To express NEEP21 antisense RNA, its cDNA was subcloned by PCR in the reverse direction into pcDNA3 between BamHI and EcoRI, downstream of the GFP cDNA and additional stop codons (herein called pcDNA3-antisense). The cDNAs of Rab5wild-type and -Q79L (Stenmark et al., 1994) were subcloned by PCR as BamHI/EcoRI fragments downstream of a myc tag in pcDNA3.
For IPs, polyclonal and monoclonal antibodies were crosslinked by 20 mM dimethylpimelimidate to protein A and protein GSepharose, respectively (Amersham Pharmacia Biotech). P3 membrane extract (160 µg) was incubated with 10-µl beads for 4 h, and washed and eluted as above. Transfected COS-7 cells were lysed in buffer B/100 mM K/1% T, centrifuged at 20,000 g, and incubated with antibody beads for 4 h. Beads were washed (B/100 mM K/0.2% T) and eluted as above. Cortical neurons were lysed in PBS/0.5% T. Protein concentrations were determined by the Bradford technique (Bio-Rad Laboratories) and Coomassie bluestained SDS-PAGE. For trypsin digestions, PC12 cells were lysed by seven passages through a 25-G needle, and centrifuged at 3,000 g for 5 min. The supernatant (40 µg) was incubated for 1 h either without additions, or with 4 µg trypsin, or with trypsin and 0.5% T, followed by Western blot. All preparations were done at 4°C.
Cell culture and immunocytochemistry
PC12ES cells were processed as described (Hirling et al., 2000). COS-7 cells were grown in DME/10% FCS and transfected by Fugene (Roche).
Cortical rat neurons were prepared as described (Hirling et al., 2000). Hippocampal neurons were prepared from P0 rats. Hippocampi without dentate gyri were dissociated with papain and triturated using a glass pipette. After centrifugation at 400 g for 2 min, cells were plated at 150,000 cells per 35-mm dish containing poly-D-lysin/laminin-coated borosilicate coverslips in DME/10% FCS. Medium was changed after 3 h to Neurobasal/B27 medium. Neurons were transfected according to Xia et al. (1996) by the calcium-phosphate technique 2 d before immunocytochemistry. DNA (4 µg) in 60 µl CaCl2 was mixed with 60 µl 2 x HBS, pH 7.0, and added to one culture dish (35 mm) for 30 min, followed by glycerol shock for 1 min.
For immunocytochemistry (Hirling et al., 2000), cultures were fixed in 4% paraformaldehyde/4% sucrose. For labeling of Rab proteins or of LBPA, PC12 cells were prepermeabilized in PBS for 150 s with 0.04% digitonin, or for 30 min in 0.05% saponin, respectively. FITC- or rhodamin-conjugated human Tf (0.025 mg/ml; Molecular Probes) was added to cells transfected with pcDNA3-hTfR (human TfR, a gift of Dr. L. Kühn (ISREC, Epalinges, Switzerland), Epalinges, Switzerland) in serum-free medium for 20 min at 4°C, followed by incubation without Tf for the indicated times at 37°C. For L1 surface labeling, transfected PC12 cells were incubated on ice for 1 h with an extracellularly binding anti-L1 antibody, and then for 1 h with Cy5 secondary IgG. Then cells were incubated at 37°C for the indicated times, fixed, and incubated without detergent with anti-L1, and then with Cy3 secondary IgG. For drug treatments, cortical neurons at DIV3 were treated for 60 min with 5 µg/ml BFA or with 100 nM wortmannin before immunolabeling. For labeling of internalized GluR2, hippocampal neurons after DIV8 were incubated for 1 h at 37°C with TTX (2 µM) and for 30 min with TTX and anti-GluR2 against an extracellular epitope. After washing, neurons were stimulated with 100 µM AMPA or 50 µM NMDA for 2 min, or with 500 nM insulin for 15 min (expect for time point at 2 min), and further incubated at 37°C for the indicated times. Neurons were fixed and Cy5-antimouse IgG was added for 30 min without detergent (to block noninternalized GluR2); then anti-NEEP21 was added with detergent, followed by Cy3-antimouse IgG and Oregon Green antirabbit IgG. To measure recycling of GluR1 or GluR2, hippocampal neurons, transfected with either pcDNA3-GFP or pcDNA3 antisense, were preincubated on DIV10 for 1 h with TTX (2 µM) before stimulation with TTX/NMDA (50 µM) for 2 min. Cells were rinsed and incubated at 37°C in medium/TTX before fixation and immunolabeling without detergent using anti-GluR1 or -GluR2 antibodies (both against extracellular domains). Immunostained cells were analyzed on a Leica TCSNT confocal microscope and processed with Adobe® Photoshop® (v. 5.5).
Tf cycling assays
PC12 cells were cotransfected with pcDNA3 coding hTfR and either NEEP21-EE, antisense, or GFP. After 2 d of differentiation, cells were incubated on ice for 30 min with 25 ng/ml rhodamin-Tf. Cells were then rinsed with medium and shifted to 37°C for the indicated times, and washed twice with PBS/30 mM glycine, pH 2.5, and twice with PBS, followed by immunocytochemistry for NEEP21. To measure Tf internalization biochemically, HRP-conjugated human Tf (HRP-Tf; Pierce Chemical Co.) was used on the hamster pancreatic ß cell line HIT-T15. Cells were grown in RPMI 1640/10% FCS/2.05 mM L-glutamine/32.5 µM glutathione/10 mM selenic acid, and electroporated with pcDNA3-hTfR and either pcDNA3 or pcDNA3-NEEP21-EE. Cells were incubated on ice for 60 min with 10 ng/ml HRP-Tf. Cells were then rinsed and either lysed with PBS/0.5% T, followed by spectrophotometrical peroxidase assay using TMB substrate (Sigma-Aldrich) (corresponds to 100% bound Tf), or shifted to 37°C for 3 or 8 min. These cells were washed on ice with PBS/glycine, pH 2.5, before lysis and peroxidase assay (corresponds to the percentage of internalized Tf). Results from five independent experiments were cumulated and statistically analyzed by a two-way analysis of variance test.
Quantitative image analysis
All experiments were done at least three times. Three confocal sections covering the whole thickness of the cell were acquired with identical parameters, and in each case the middle section was used for quantification. For colocalization, two separate confocal images for the red (1) and green (2) channels were acquired. The threshold was set at a fixed value. The intersection image of the merged red and green channels was separated into red (3) and green (4) channels corresponding to the double-labeled pixels. Channels 14 were analyzed using NIH image software for mean pixel intensity and number of labeled pixels. We then added the values from channels 1 and 2 (corresponding to 100% in Fig. 8 B; pixels being red or green), and from the intersected red (3) and green (4) channels (corresponds to colocalization; pixels being red and green). Values from 10 cells per condition were statistically analyzed by a t test (double asterisks, P < 0.01). For quantification of surface GluR labeling, the threshold was adjusted by NIH image to a level that suppressed all noncellular signals to two pixels per cm2 (corresponding to 0.3% of all pixels) to have a minimal visual background density. The average pixel intensity (normalized intensity) was determined by dividing the sum of all pixel intensities by the number of labeled pixels above threshold. Between 5 and 10 cells per condition were measured, and the results were analyzed by a t test (double asterisks, P < 0.01; single asterisks, P < 0.02). Quantification of Tf and L1 cycling was performed as described for GluR. Between 50 and 150 cells per condition were measured and the results were analyzed by a t test (double asterisks, P < 0.01).
| Footnotes |
|---|
| Acknowledgments |
|---|
This work was supported by grant 3100-052587.97/1 from the Swiss National Science Foundation.
Submitted: 6 February 2002
Revised: 23 April 2002
Accepted: 6 May 2002
| References |
|---|
|
|
|---|
Beatti, E.C., R.C. Carroll, X. Yu, W. Morishita, H. Yasuda, M. von Zastrow and R.C. Malenka. 2000. Regulation of AMPA receptor endocytosis by a signaling mechansim shared with LTD. Nat. Neurosci. 3:12911200.[CrossRef][Medline]
Buckley, K.M., H.E. Melikian, C.J. Provoda, and M.T. Waring. 2000. Regulation of neuronal function by protein trafficking: a role for the endosomal pathway. J. Physiol. 525:1119.
Carlock, L., T. Vo, M. Lorincz, P.D. Walker, D. Bessert, D. Wisniewski, and J.C. Dunbar. 1996. Variable subcellular localization of a neuron-specific protein during NTera 2 differentiation into post-mitotic human neurons. Molec. Brain Res. 42:202212.[Medline]
Carroll, R.C., D.V. Lissin, M. von Zastrow, R.A. Nicoll, and R.C. Malenka. 1999. Rapid redistribution of glutamate receptors contributes to long-term depression in hippocampal cultures. Nat. Neurosci. 2:454460.[CrossRef][Medline]
Dailey, M.E., and P.C. Bridgman. 1993. Vacuole dynamics in growth cones: correlated EM and video observations. J. Neurosci. 13:33753393.[Abstract]
Diefenbach, T.J., P.B. Guthrie, H. Stier, B. Billups, and S.B. Kater. 1999. Membrane recycling in the neuronal growth cone revealed by FM1-43 labeling. J. Neurosci. 19:94369444.
Ehlers, M.D. 2000. Reinsertion or degradation of AMPA receptors determined by activity-dependent endocytic sorting. Neuron. 28:511525.[CrossRef][Medline]
Gorvel, J.P., P. Chavrier, M. Zerial, and J. Gruenberg. 1991. Rab5 controls early endosome fusion in vitro. Cell. 64:915925.[CrossRef][Medline]
Grimes, M.L., J. Zhou, E.C. Beattie, E.C. Yuen, D.E. Hall, J.S. Valletta, K.S. Topp, J.H. LaVail, N.W. Bunnett, and W.C. Mobley. 1996. Endocytosis of activated TrkA: evidence that nerve growth factor induces formation of signaling endosomes. J. Neurosci. 16:79507964.
Gruenberg, J., and F.R. Maxfield. 1995. Membrane transport in the endocytic pathway. Curr. Opin. Cell Biol. 7:552563.[CrossRef][Medline]
Grussenmeyer, T., K.H. Scheidtmann, M.A. Hutchinson, W. Eckhart, and G. Walter. 1985. Complexes of polyoma virus medium T antigen and cellular proteins. Proc. Natl. Acad. Sci. USA. 82:79527954.
Hirling, H., P. Steiner, C. Chaperon, R. Marsault, R. Regazzi, and S. Catsicas. 2000. Syntaxin 13 is a developmentally regulated SNARE involved in neurite outgrowth and endosomal trafficking. Eur. J. Neurosci. 12:19131923.[CrossRef][Medline]
Kamiguchi, H., and V. Lemmon. 2000. Recycling of the cell adhesion molecule L1 in axonal growth cones. J. Neurosci. 20:36763686.
Kobayashi, T., E. Stang, K.S. Fang, P. de Moerloose, R.G. Parton, and J. Gruenberg. 1998. A lipid associated with the antiphospholipid syndrome regulates endosome structure and function. Nature. 392:193197.[CrossRef][Medline]
Lezcano, N., L. Mrzljak, S. Eubanks, R. Levenson, P. Goldman-Rakic, and C. Bergson. 2000. Dual signaling regulated by calcyon, a D1 dopamine receptor interacting protein. Science. 287:16601664.
Lin, J.W., J. William, K. Foster, S.H. Lee, G. Ahmadian, M. Wyszynski, Y.T. Wang, and M. Sheng. 2000. Distinct molecular mechanisms and divergent endocytotic pathways of AMPA receptor internalization. Nat. Neurosci. 3:12821290.[CrossRef][Medline]
Lippincott-Schwartz, J., L. Yuan, C. Tipper, M. Amherdt, L. Orci, and R.D. Klausner. 1991. Brefeldin A's effects on endosomes, lysosomes, and the TGN suggest a general mechanism for regulating organelle structure and membrane traffic. Cell. 67:601616.[CrossRef][Medline]
Malide, D., and S.W. Cushman. 1997. Morphological effects of wortmannin on the endosomal system and GLUT4-containing compartments in rat adipose cells. J. Cell Sci. 110:27952806.[Abstract]
McBride, H.M., V. Rybin, C. Murphy, A. Giner, R. Teasdale, and M. Zerial. 1999. Oligomeric complexes link Rab5 effectors with NSF and drive membrane fusion via interactions between EEA1 and syntaxin 13. Cell. 98:377386.[CrossRef][Medline]
McLauchlan, H., J. Newell, N. Morrice, A. Osborne, M. West, and E. Smythe. 1998. A novel role for Rab5-GDI in ligand sequestration into clathrin-coated pits. Curr. Biol. 8:3445.[CrossRef][Medline]
Nagelkerken, B., E. Van Anken, M. Van Raak, L. Gerez, K. Mohrmann, N. Van Uden, J. Holthuizen, L. Pelkmans, and P. Van Der Sluijs. 2000. Rabaptin4, a novel effector of the small GTPase Rab4a, is recruited to perinuclear recycling vesicles. Biochem. J. 346:593601.[CrossRef][Medline]
Passafaro, M., V. Piech, and M. Sheng. 2001. Subunit-specific temporal and spatial patterns of AMPA receptor exocytosis in hippocampal neurons. Nat. Neurosci. 4:917926.[CrossRef][Medline]
Pickard, L., J. Noel, J.M. Henley, G.L. Collingridge, and E. Molnar. 2000. Developmental changes in synaptic AMPA and NMDA receptor distribution and AMPA receptor subunit composition in living hippocampal neurons. J. Neurosci. 20:79227931.
Prekeris, R., J. Klumperman, Y.A. Chen, and R.H. Scheller. 1998. Syntaxin 13 mediates cycling of plasma membrane proteins via tubulovesicular recycling endosomes. J. Cell Biol. 143:957971.
Rothman, J.E. 1994. Mechanisms of intracellular protein transport. Nature. 372:5563.[CrossRef][Medline]
Saberan-Djoneidi, D., I. Marey-Semper, R. Picart, J.M. Studler, C. Tougard, J. Glowinski, and M. Levi-Strauss. 1995. A 19-kDa protein belonging to a new family is expressed in the Golgi apparatus of neural cells. J. Biol. Chem. 270:18881893.
Saberan-Djoneidi, D., R. Picart, D. Escalier, M. Gelman, A. Barret, C. Tougard, J. Glowinski, and M. Levi-Strauss. 1998. A 21-kDa polypeptide belonging to a new family of proteins is expressed in the Golgi apparatus of neural and germ cells. J. Biol. Chem. 273:39093914.
Shi, S.H., Y. Hayashi, J.A. Esteban, and R. Malinow. 2001. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons. Cell. 105:331343.[CrossRef][Medline]
Sonnichsen, B., S. De Renzis, E. Nielsen, J. Rietdorf, and M. Zerial. 2000. Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5 and Rab11. J. Cell Biol. 149:901913.
Spiro, D.J., W. Boll, T. Kirchhausen, and M. Wessling-Resnick. 1996. Wortmannin alters the transferrin receptor endocytic pathway in vivo and in vitro. Mol. Biol. Cell. 7:355367.[Abstract]
Stenmark, H., R.G. Parton, O. Steele-Mortimer, A. Lutcke, J. Gruenberg, and M. Zerial. 1994. Inhibition of Rab5 GTPase activity stimulates membrane fusion in endocytosis. EMBO J. 13:12871296.[Medline]
Sutcliffe, J.G., R.J. Milner, T.M. Shinnick, and F.E. Bloom. 1983. Identifying the protein products of brain-specific genes with antibodies to chemically synthesized peptides. Cell. 33:671682.[CrossRef][Medline]
Tang, B.L., A.E.H. Tan, L.K. Lim, S.S. Lee, D.Y.H. Low, and W.J. Hong. 1998. Syntaxin 12, a member of the syntaxin family localized to the endosome. J. Biol. Chem. 273:69446950.
Tooze, J., and M. Hollinshead. 1992. In AtT20 and HeLa cells brefeldin A induces the fusion of tubular endosomes and changes their distribution and some of their endocytic properties. J. Cell Biol. 118:813830.
Trischler, M., W. Stoorvogel, and O. Ullrich. 1999. Biochemical analysis of distinct Rab5- and Rab11-positive endosomes along the transferrin pathway. J. Cell Sci. 112:47734783.[Abstract]
Ullrich, O., S. Reinsch, S. Urbe, M. Zerial, and R.G. Parton. 1996. Rab11 regulates recycling through the pericentriolar recycling endosome. J. Cell Biol. 135:913924.
van der Sluijs, P., M. Hull, P. Webster, P. Male, B. Goud, and I. Mellman. 1992. The small GTP-binding protein Rab4 controls an early sorting event on the endocytic pathway. Cell. 70:729740.[CrossRef][Medline]
Wan, Q., Z.G. Xiong, H.Y. Man, C.A. Ackerley, J. Braunton, W.Y. Lu, L.E. Becker, J.F. MacDonald, and Y.T. Wang. 1997. Recruitment of functional GABA(A) receptors to postsynaptic domains by insulin. Nature. 388:686690.[CrossRef][Medline]
Xia, Z., H. Dudek, C.K. Miranti, and M.E. Greenberg. 1996. Calcium influx via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism. J. Neurosci. 16:54255436.
Zhu, J.J., J.A. Esteban, Y. Hayashi, and R. Malinow. 2000. Postnatal synaptic potentiation: delivery of GluR4-containing AMPA receptors by spontaneous activity. Nat. Neurosci. 3:10981106.[CrossRef][Medline]
This article has been cited by other articles: