|
||
Article |
Address correspondence to Servicio de Inmunología, Hospital de la Princesa, Universidad Autónoma de Madrid, C/Diego de León 62, 28006 Madrid, Spain. Tel.: 34-91-309-2115. Fax: 34-91-520-2374. E-mail: fsanchez{at}hlpr.insalud.es
| Abstract |
|---|
|
|
|---|
-actinin, vinculin, and VASP. Phosphoinositides and the Rho/p160 ROCK pathway, which participate in the activation of ERM proteins, were involved in the generation and maintenance of the anchoring structure. These results provide the first characterization of an endothelial docking structure that plays a key role in the firm adhesion of leukocytes to the endothelium during inflammation.
Key Words: ERM; VCAM-1; ICAM-1; leukocyte adhesion and transendothelial migration; docking structure
| Introduction |
|---|
|
|
|---|
4ß1 (VLA-4) and
Lß2 (LFA-1) play a major role in the tight adhesion of leukocytes to endothelium (González-Amaro and Sánchez-Madrid, 1999). Their main ligands on endothelium are vascular cell adhesion molecule (VCAM)*-1 and intercellular adhesion molecule (ICAM)-1, respectively (Marlin and Springer, 1987; Elices et al., 1990). ICAM-1 but not VCAM-1 is basally expressed in resting cells, and both molecules are induced upon activation by proinflammatory cytokines such as IL-1 and TNF-
(Carlos and Harlan, 1994). Although it has been described that both VLA-4/VCAM-1 and LFA-1/ICAM-1 interactions mediate the firm adhesion of leukocytes, only the latter molecular pair seems to be required for lymphocyte diapedesis (Oppenheimer-Marks et al., 1991). The interaction of adhesion molecules with cytoskeletal components is of critical importance for cellcell and cellsubstratum adhesion as well as for receptor internalization. The cortical cytoskeleton regulates the membrane localization of several adhesion receptors, such as ICAMs, CD43, and CD44, through one or more members of the ezrin, radixin, and moesin (ERM) family of proteins (Serrador et al., 1997; Heiska et al., 1998; Yonemura et al., 1998). These molecules function as membrane-actin cytoskeleton linkers regulating cortical morphogenesis and cell adhesion. Accordingly, they play a key role in the formation of protrusive plasma membrane structures such as filopodia, microspikes, or microvilli (Mangeat et al., 1999; Yonemura and Tsukita, 1999). Structurally, they are closely related to each other and seem to be functionally redundant, as suggested by the apparently normal phenotype of moesin knockout mice (Doi et al., 1999). Their NH2-terminal domains interact with integral membrane proteins, whereas their COOH-terminal domains bind F-actin (Turunen et al., 1994). These functions are conformationally regulated by reversible changes from inactive to functionally active forms. Binding of phosphatidylinositol 4,5-biphosphate (PI[4,5]P2) and phosphorylation of a specific COOH-terminal threonine residue unmask the F-actin and membrane binding sites and stabilize the active conformation (Nakamura et al., 1999; Barret et al., 2000). The Rho/p160 ROCK signaling pathway and the phosphatidylinositol turnover are the major regulatory mechanisms for ERM activation, inducing their phosphorylation and translocation into apical membrane/actin protrusions (Hirao et al., 1996; Matsui et al., 1998; Shaw et al., 1998). On the other hand, activated ERM proteins can sequestrate Rho-GDI to permit Rho activation, providing a positive feedback pathway (Takahashi et al., 1997).
These proteins have been studied in a variety of cellular types, but thus far their functions have not been addressed in endothelial cells. Herein, we describe the direct interaction of VCAM-1 with moesin and ezrin, the two members of the ERM family most highly expressed in endothelium (Menager et al., 1999). We also describe the dynamic distribution of VCAM-1, ICAM-1, and moesin during leukocyte adhesion and lymphoblast transendothelial migration (TEM), using live time-lapse fluorescence confocal microscopy. Our data indicate that an endothelial docking structure is formed during leukocyte-endothelium interaction in static and under flow conditions. VCAM-1, ICAM-1, and activated ERM proteins participate in this novel anchoring structure together with structural and regulatory molecules typical of nascent phagosomes.
| Results |
|---|
|
|
|---|
activated human umbilical vein endothelial cells (HUVEC). VCAM-1 colocalized with ezrin (Fig. 1, ac) and moesin (Fig. 1, eg) in the microspikes and microvilli that protrude from the apical surface of these cells. Colocalization analysis confirmed these observations (Fig. 1, d and h). By contrast, VE-cadherin did not colocalize with ERM proteins (Fig. 1, il).
|
|
|
|
4 integrin (4M7 cells) (Muñoz et al., 1996). These cells expressed high levels of VLA-4, but negligible amounts of LFA-1 (Fig. 5 A). In addition, their adhesion to activated endothelium was dependent on VLA-4, as it was inhibited by the blocking anti-
4 HP2/1 mAb, and induced by the activating anti-ß1 TS2/16 mAb (Fig. 5 B). 4M7 cells adhered to activated endothelium mainly via VLA-4, but these cells were unable to progress to TEM (unpublished data). When the distribution of endogenous endothelial VCAM-1 was examined during 4M7 cell adhesion, we found that it was strongly concentrated around attached leukocytes (Fig. 5 C, c). Endogenous ezrin colocalized with VCAM-1 at the endothelialleukocyte contact area (Fig. 5 C, d), and antibodies to ezrin also stained the leukocyte membrane (Fig. 5 C, b). Furthermore, a three-dimensional reconstruction of the site of adhesion showed that VCAM-1 and ezrin were contained in a unique docking structure that was raised above the level of the endothelial cell surface and that surrounded the adherent leukocyte in a cup-like fashion. Both proteins were preferentially concentrated in microspikes of this structure that presumably served to anchor the attached leukocyte (Fig. 5 C, eg). The redistribution of VCAM-1 and moesin to the leukocyteendothelium contact area was tracked separately by live time-lapse fluorescence confocal microscopy during the interaction of 4M7 cells with VCAM-1 or moesinGFP transfected HUVEC. The dynamic studies demonstrated that VCAM-1/VLA-4 engagement was associated with the progressive concentration of VCAM-1 and moesin at the specialized anchoring structure formed between the two interacting cells, which was progressively strengthened and sustained with time (Fig. 5 D).
|
|
-actininGFP also redistributed to this structure with a punctuate pattern (Fig. 7 B, c and d, and C, ac). Likewise, VASP-GFP colocalized with VCAM-1 (Fig. 7 C, fg), whereas talin and paxillin-GFP were only found colocalizing with VCAM-1 at some adhesion structures (Fig. 7 B, a and b, and C, d and e). These data indicate that the endothelial docking structure was supported by the actin cytoskeleton, actin bundling proteins such as
-actinin, actin-nucleating proteins such as VASP, and focal adhesion proteins such as vinculin, talin or paxillin. The formation of this structure was associated with a remarkable change in distribution of several of these proteins, in particular vinculin, talin, and paxillin, from their normal subcellular localization at focal adhesions at the basal surface to the docking structure at the apical surface.
|
, which binds PI(4,5)P2, and that of GRP1, which binds PI(3,4,5)P3 and PI(3,4)P2, fused to GFP (Gray et al., 1999; Várnai et al., 1999). Upon endothelial cell transfection, both probes colocalized with VCAM-1 at the endothelial docking structure (Fig. 8 B, a and b; d and e). PLC
-PHGFP showed a higher concentration at microspike tips (Fig. 8 B, c), whereas GRP1-PHGFP appeared to be more diffusely distributed and localized throughout the entire structure (Fig. 8 B, f).
|
|
| Discussion |
|---|
|
|
|---|
The cytoskeletal components involved in the redistribution of VCAM-1 at the leukocyte-endothelial cell contact area have not been studied previously. Among potential candidates, ERM proteins seemed likely to mediate this process as these molecules play an important role in the remodelling of the plasma membrane, as reported for ICAMs (Helander et al., 1996; Serrador et al., 1997; Heiska et al., 1998). We found that endogenous VCAM-1 colocalizes and is physically associated with moesin and ezrin in microspikes and microvilli of the apical surface of cytokine-activated endothelial cells. Furthermore, the cytoplasmic tail of VCAM-1 and the active NH2-terminal domain of moesin or ezrin are capable to directly bind in vitro. These data strongly suggest that ERM proteins are directly involved in the redistribution of VCAM-1. However, it cannot be ruled out completely that adaptor proteins such as EBP50 or E3KARP (Bretscher et al., 2000), also play a role. It has been reported that ERM proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2 (Yonemura et al., 1998). In addition, we have found recently that a novel serine-rich motif within the cytoplasmic tail of ICAM-3 is critical for its interaction with ERM proteins (Serrador et al., 2002). The amino acid sequence comparison of VCAM-1 and ICAM-3 cytoplasmic tails suggests that VCAM-1 contains a similar serine-rich motif, likely accounting for ERM association.
To study the VCAM-1/ERM interaction during the extravasation of lymphoblasts, we have made extensive use of a live cell system in combination with time-lapse fluorescence microscopy and GFP fusion proteins. This afforded us with information on dynamic relationships of the two molecules during early adhesion and later stages of TEM. Although both VCAM-1 and moesin clustered around spreading lymphoblasts on the apical endothelial surface, only moesin remained at lymphoblast-endothelial contacts during the passage of lymphoblasts across the endothelium and their subsequent migration beneath the endothelial monolayer. However, it has been reported that VCAM-1 actively participates in T lymphoblast transmigration across high endothelial venules and monocyte extravasation (Meerschaert and Furie, 1995; Faveeuw et al., 2000). These discrepancies point to a differential role of VCAM-1 that might be both leukocyte and endothelial cell-type specific. Our data on moesin dynamics clearly indicate that another receptor linked to moesin could drive this migration. In this regard, we have found that the dynamic behavior of moesin is similar to that of ICAM-1 during lymphoblast transmigration, a finding that is in accordance with previous reports describing the distribution of ICAM-1 on the lumenal and basal surfaces of the endothelium and its involvement in TEM (Oppenheimer-Marks et al., 1991; Randolph and Furie, 1996). The differential dynamic behavior of VCAM-1 and ICAM-1 during lymphoblast adhesion and transmigration on the one hand, and of moesin on the other, could suggest a mechanism by which ERM proteins are able to regulate the distribution of both molecules independently.
As VCAM-1/ERM interaction was mostly restricted to leukocyte tight adhesion and spreading, we took advantage of a cellular model based mainly on VLA-4/VCAM-1. In this model, leukocytes are restricted to a sustained tight adhesion and are unable to progress to TEM, allowing a detailed study of the endothelial VCAM-1/ERM interaction. In this cell model, VCAM-1 and both, moesin and ezrin, clustered around adherent leukocytes, participating in the formation of an actin-rich docking structure that was attached to and partially engulfed the leukocyte. Similar docking structures were formed around spreading lymphoblasts in static conditions or PBLs adhered to endothelium under flow, in which VCAM-1 and ICAM-1 were concentrated together with ERM proteins. The fact that both adhesion receptors actively participate in such endothelial structure would reinforce the concept of cross-talk between their ligands VLA-4 and LFA-1 during lymphocyte adhesion (Chan et al., 2000; Rose et al., 2001). Under these physiological conditions, docking structures rapidly vanished as lymphoblasts or lymphocytes began to migrate through the endothelial monolayer.
Our findings highlight the remarkable active role played by the endothelium during leukocyte adhesion. Thus, the initial VCAM-1 and ICAM-1 engagement trigger their clustering and the subsequent activation and clustering of endothelial moesin and ezrin at the site of cellcell contact. In turn, phosphorylated active ERM proteins would participate in concert with
-actinin, an actin-bundling protein, in the rearrangement of the actin cytoskeleton to create the docking structure. Several focal adhesion proteins such as vinculin, talin, and paxillin seem to be involved as well. Interestingly, the endothelial docking structure is reminiscent of nascent receptor-mediated phagosomes, in that the subcellular distribution of all these structural proteins is similar in both structures (Allen and Aderem, 1996). In this regard, it has been proposed that focal adhesions and complement receptor-mediated phagosomes could share some conserved mechanisms requiring the same molecules (May and Machesky, 2001). A similar argument could be made to functionally link the former structures and the novel leukocyteendothelium docking structure described here. On the other hand, VASP is concentrated in the docking structure. This protein is present in actin-based protrusions, where it cooperates with WASp-Arp2/3 complex, as occurs in phagosomes (Castellano et al., 2001). Its presence at the docking structure could indicate the existence of actin polymerization supporting this endothelial structure, and suggests common mechanisms for de novo actin assembly in all these structures. Interestingly, ERM proteins have been also implicated in the de novo actin assembly on mature Fc receptor-mediated phagosomes (Defacque et al., 2000).
As ERM activation occurred during the formation of the anchoring structure, we studied the regulatory mechanisms involved. These proteins are regulated by the interplay of PI(4,5)P2 metabolism and components of the Rho GTPase signaling pathway, thereby linking events occurring at the plasma membrane with cytoskeletal remodelling (Sechi and Wehland, 2000). Interestingly, these regulatory molecules are also important in phagocytosis (Botelho et al., 2000; Chimini and Chavrier, 2000). We found that PI(3,4)P2, PI(3,4,5)P3, and more abundantly PI(4,5)P2, colocalized with VCAM-1 and ERM proteins in the endothelial docking structure. Notably, PI(4,5)P2 was preferentially concentrated at the microspike tips, whereas the other phosphoinositides exhibited a more diffuse pattern. These observations point to a prominent role of PI(4,5)P2 in regulating molecular events during endothelial docking of leukocytes. One such event could be the activation of moesin and ezrin through its binding to their NH2-terminal domain. PI(4,5)P2 production could be mediated by Rho, as PI4P5K is a down-stream RhoGTPase effector. On the other hand, the presence of PI(3,4)P2 and PI(3,4,5)P3 could be related to PI3K activity. Inhibitors of PI3K only mildly affected the generation and maintenance of the docking structure, a finding that is in agreement with its role in phagocytosis, namely to mediate phagosome closure (Cox et al., 1999). In our experimental model, the endothelial anchoring structure does not progress to engulf the leukocyte; therefore, it is less PI3K dependent. In contrast, the p160 ROCK inhibitor Y27632 inhibited the formation of the anchoring structure and induced its dissolution as well. Abnormal formation of the endothelial docking structure was also observed under flow conditions after the treatment with Y-27632, which rendered an inhibitory effect in lymphocyte adhesion and transmigration. In addition, the phenomenon of rolling was also decreased. This finding is in agreement with previous reports describing the existence of an E-selectin/actin cytoskeleton adhesion complex induced by leukocyte adhesion (Yoshida et al., 1996; Lorenzon et al., 1998), which it is likely to be also affected by the inhibition of the Rho/p160 ROCK pathway. Our results concur with the previously described regulation of the VCAM-1, ICAM-1, and E-selectin clustering by the GTPase Rho during monocyte adhesion (Wojciak-Stothard et al., 1999). Furthermore, the key role of the Rho/p160 ROCK signaling pathway in the regulation of the adhesion receptor/ERM/actin cytoskeleton interaction and remodelling, which results in the formation of this protrusive structure, is further strengthened by the implication of this pathway in the regulation of complement receptormediated phagosomes (Caron and Hall, 1998).
In conclusion, our results provide novel insights into the links between the actin cytoskeleton and adhesion receptors involved in leukocyte adhesion and TEM during inflammation. Further analysis will be focused on molecules involved in the regulation of the endothelial docking structure disruption to allow diapedesis, and the signaling pathways that interconnect both processes.
| Materials and methods |
|---|
|
|
|---|
(20 ng/m; R&D Systems) was added to the culture media 20 h before the assays were performed. Human PBLs and T lymphoblasts were obtained and cultured as described elsewhere (Serrador et al., 1997). K562 cells stably transfected with the
4 integrin chain gene (4M7 cells) were grown in RPMI 1640 medium (GIBCO BRL) supplemented with 10% FCS, 50 IU/ml penicillin, 50 µg/ml streptomycin, and 1 mg/ml of G418 (Calbiochem).
Antibodies and reagents
The TEA1/31 anti-VE cadherin and TS2/16 anti-ß1 integrin (Yáñez-Mó et al., 1998), the HP2/1 anti-
4 integrin, TS1/11 anti-
L integrin, and TP1/24 anti-ICAM-3 (Serrador et al., 1997) mAb have been described elsewhere. The 4B9 and P8B1 (antiVCAM-1), Hu5/3 (antiICAM-1), and 297S (antiphosphorylated forms of ERM proteins) mAb were provided by Dr. R.R. Lobb (Biogen Inc.), Dr. E.A. Wayner (Fred Hutchinson Cancer Research Center, Seattle, WA), Dr. F.W. Luscinskas (Brigham and Women's Hospital and Harvard Medical School, Boston, MA), and Dr. S. Tsukita (Faculty of Medicine, Kyoto University, Japan), respectively. The moesin-specific polyclonal antiserum 95/2 and the ezrin-polyclonal antiserum 90/3 have been previously described (Serrador et al., 2002). The anti-tubulin and -vinculin mAb were purchased from Sigma-Aldrich. The anti-talin polyclonal antibody (pAb) was a gift of Dr. K. Burridge (University of North Carolina, Chapel Hill, NC). The monoclonal IgG1,
from the P3x63 myeloma cell line was used as negative control. Recombinant human fibronectin was purchased from Sigma-Aldrich. The p160 ROCK inhibitor Y-27632, the PI3K inhibitor Ly 294002, and the classical PKCs inhibitor Gö6976 were purchased from Calbiochem.
Recombinant DNA constructs and cell transfections
The fusion protein GSTVC, containing the cytoplasmic tail of VCAM-1, was obtained by PCR amplification using as template the human VCAM-1 cDNA, and [TATGGATCCAGAAAAGCCAACATGAAG] and [TGGAATTCATAGATGGGCATTTC] as 5' and 3' primers, respectively. The PCR product was cloned as a BamHI/EcoRI fragment into pGEX-4T (Pharmacia LKB Biotechnology). The cytoplasmic tail of ICAM-3 fused to GST (GST-IC3), and a truncated form of it (GST-Y9, Y490stop) have been described elsewhere (Serrador et al., 2002). Expression of GST fusion proteins in BL21 bacteria and purification were performed following the manufacturer's instructions.
VCAM-1GFP and ICAM-1GFP were obtained using the corresponding human cDNAs as templates to amplify by PCR the complete encoding region of these molecules without the stop codon. A Xho I site was added to the 5' end and a Xma I site at the 3' end of VCAM-1 cDNA. Likewise, HindIII and BamHI sites were added to the 5' and 3' ends of ICAM-1 cDNA, respectively. The PCR products were then cloned into pEGFP-N1 (CLONTECH Laboratories, Inc.) resulting in an in-frame fusion of enhanced GFP to the COOH terminus of VCAM-1 and ICAM-1. The VCAM-1- and ICAM-1GFP proteins behaved similarly to the corresponding endogenous proteins in terms of their binding to ezrin and moesin. The generation of the GFP fusion construct containing the GFP cDNA inserted at the COOH-terminal end of the rat full-length moesin (moesin-GFP, residues 1577) has been previously described (Amieva et al., 1999).
-actininGFP and paxillin-GFP were gifts of Dr. A.F. Horwitz (University of Virginia, Charlottesville, VA). VASP-GFP, PLC
-PH-GFP, and GRP1-PH-GFP, were provided by Dr. J.V. Small (Institute of Molecular Biology, Salzburg, Austria), Dr. T. Balla (National Institutes of Health, Bethesda, MA), and Dr. A. Gray (University of Dundee, Dundee, U.K.), respectively.
Transiently transfected HUVEC were generated by electroporation at 200 V and 975 µF using a Gene Pulser (Bio-Rad Laboratories) and adding 20 µg of each DNA construct. These cells were used 2448 h after transfection.
Flow cytometry analysis, immunofluorescence, and confocal microscopy
For flow cytometry analysis and immunofluorescence experiments, cells were treated as previously described (Yáñez-Mó et al., 1998). Rhodamine Red-X-Affinipure goat antimouse IgG (H+L), Alexa Fluor 488 rabbit antimouse or goat antirabbit IgG (H + L) conjugate highly crossadsorbed, Alexa Fluor 488 streptavidin, and Phalloidin Alexa Fluor 568 were used as fluorescent reagents (Molecular Probes). Staining with the 297S mAb was performed as previously described (Hayashi et al., 1999). Series of optical sections were obtained with a Leica TCS-SP confocal laser scanning unit equipped with Ar and He/Ne laser beams and attached to a Leica DMIRBE inverted epifluorescence microscope (Leica Microsystems), using a 63x oil immersion objective. Colocalization histograms were obtained using the Leica Confocal Software.
Immunoprecipitation, Western blot, in vitro translation, and protein binding assays
Lysates from activated HUVEC, immunoprecipitation, and Western blot were performed as described (Serrador et al., 2002). The pCR3 plasmids carrying the inserts of untagged moesin and ezrin NH2-terminal regions (amino acid residues 1310) were transcribed, translated, and isotope labeled in vitro using a TNT-coupled rabbit reticulocyte lysate system (Promega). Then, binding assays using these isotope-labeled recombinant proteins and the GST fusion proteins (GSTVC, GSTIC3, GSTY9, and GST alone) were performed as previously described (Serrador et al., 2002).
Adhesion and transendothelial migration assays
For cellular adhesion assays, HUVEC were grown to confluence in 96-microwell plates (Costar) and activated with TNF-
for 20 h. K562 cells were labeled with 1 µM of BCECF-AM for 15 min at 37°C, preincubated with different purified mAb, and allowed to adhere to activated HUVEC for 15 min at 37°C as previously described (Yáñez-Mó et al., 1998). Fluorescence intensity was measured in a microplate reader (Biotek FL500). T lymphoblast migration through a confluent monolayer of activated HUVEC was assayed in 3-µm pore Transwell cell culture chambers (Costar). HUVEC were seeded and grown to confluence on these Transwell inserts precoated with 1% gelatin and activated with TNF-
for 20 h. Cultured lymphoblasts (2 x 105 in 100 µl of complete 199 medium/well) were incubated with 10 µg/ml of different purified mAbs for 20 min at 4°C, and then added to the upper chambers. In the lower well, 600 µl of complete 199 medium were poured. Cells were incubated for 90 min at 37°C, and migrated cells were recovered from the lower chamber. The relative number of migrated cells was estimated by flow cytometry.
Time-lapse fluorescence confocal microscopy
HUVEC transfected with different GFP constructs were grown to confluence on glass-bottom dishes (WillCo Wells) precoated with Fn (20 µg/ml). Then, cells were activated with TNF-
for 20 h, and placed on the microscope stage. 4M7 cells or T lymphoblasts resuspended in 500 µl of complete 199 medium were added. Plates were maintained at 37°C in a 5% CO2 atmosphere using an incubation system (La-con GBr Pe-con GmbH). Confocal series of fluorescence and differential interference contrast (DIC) images, distanced 0.4 µm in the z axis, were simultaneously obtained at 30-s or 1-min intervals, with a 63x oil immersion objective. Images were processed and assembled into movies using the Leica Confocal Software.
Parallel plate flow chamber analysis of endothelial-PMN interactions
The parallel plate flow chamber used for leukocyte adhesion and transmigration under defined laminar flow has been described in detail (Luscinskas et al., 1994). PBLs (106/ml) were drawn across activated confluent monolayers at an estimated wall shear stress of 1.8 dynes/cm2 for perfusion times from 30 s to 10 min. Lymphocyte rolling on the endothelium were easily visualized as they travelled more slowly than free-flowing cells. Lymphocytes were considered to be adherent after 20 s of stable contact with the monolayer. Transmigrated lymphocytes were determined as being beneath the endothelial monolayer. Lymphocytes were considered to be detached when they returned to free-flowing after having been completely arrested on endothelium. The number of rolling, adhered, transmigrated, and detached cells was quantified by direct visualization of 4 different fields (40x phase-contrast objective) at each time point of every independent experiment. Coverslips were fixed immediately in PFA 4% at room temperature for 10 min, washed with HBSS, and stained for VCAM-1, ICAM-1, or ezrin.
Online supplemental material
All videos are available at http://www.jcb.org/cgi/content/full/jcb.200112126/DC1. Video 1 (corresponding to Fig. 4 A, af) shows a lymphoblast that contacts with a moesinGFP-transfected endothelial cell, and immediately transmigrates and moves beneath the endothelium. Moesin is clustered around the lymphoblast along the whole process. Video 2 (corresponding to Fig. 4 A, gl), shows a lymphoblast (upper site) that adheres to, spreads on, and moves toward a lateral junction of the VCAM-1GFP-transfected endothelial cell. It then transmigrates and moves beneath the endothelium, whereas another lymphoblast (lower site) remains spread on the endothelial cell. VCAM-1 is clustered around lymphoblasts adhered to the apical surface of endothelium (arrows), but it is not concentrated around migrating lymphocytes beneath the endothelium (arrowheads). Video 3 (corresponding to Fig. 4 B), shows a lymphoblast that adheres to, spreads on, and moves toward a lateral junction of the ICAM-1GFP-transfected endothelial cell (black arrows). It then transmigrates and moves beneath the endothelium (white arrows). ICAM-1 is clustered around the lymphoblast along the whole process. In all videos, the apical endothelial surface is at a plane remote from the observer.
| Footnotes |
|---|
* Abbreviations used in this paper: ERM, ezrin, radixin, and moesin; DIC, differential interference contrast; GFP, green fluorescent protein; GST, glutathione-S-transferase; HUVEC, human umbilical vein endothelial cells; ICAM, intercellular adhesion molecule; pAb, polyclonal antibody; PBL, peripheral blood lymphocyte; PI(4,5)P2, phosphatidylinositol 4,5-biphosphate; TEM, transendothelial migration; VCAM, vascular cell adhesion molecule.
| Acknowledgments |
|---|
This work was supported by grants SAF99-0034-C01 and FEDER 2FD97-068-C02-02 from the Ministerio de Educación, and grant QLRT-1999-01036 from the European Community to F. Sánchez-Madrid, and a fellowship from the Ministerio de Educación to O. Barreiro.
Submitted: 24 December 2001
Revised: 7 May 2002
Accepted: 7 May 2002
| References |
|---|
|
|
|---|
Allen, L.-A.H., and A. Aderem. 1996. Molecular definition of distinct cytoskeletal structures involved in complement- and Fc receptor-mediated phagocytosis in macrophages. J. Exp. Med. 184:627637.
Alon, R. 2001. Encephalitogenic lymphoblast recruitment to resting CNS microvasculature: a natural immunosurveillance mechanism? J. Clin. Invest. 108:517519.[CrossRef][Medline]
Amieva, M.R., P. Litman, L. Huang, E. Ichimaru, and H. Furthmayr. 1999. Disruption of dynamic cell surface architecture of NIH3T3 fibroblasts by the N-terminal domains of moesin and ezrin: in vivo imaging with GFP fusion proteins. J. Cell Sci. 112:111125.[Abstract]
Barret, C., C. Roy, P. Montcourrier, P. Mangeat, and V. Niggli. 2000. Mutagenesis of the phosphatidilinositol 4,5-biphosphate (PIP[2]) binding site in the NH(2)-terminal domain of ezrin correlates with its altered cellular distribution. J. Cell Biol. 151:10671079.
Botelho, R.J., M. Teruel, R. Dierckman, R. Anderson, A. Wells, J.D. York, T. Meyer, and S. Grinstein. 2000. Localized biphasic changes in phosphatidylinositol-4,5-biphosphate at sites of phagocytosis. J. Cell Biol. 151:13531367.
Bretscher, A., D. Chambers, R. Nguyen, and D. Reczek. 2000. ERM-Merlin and EBP50 protein families in plasma membrane organization and function. Annu. Rev. Cell Dev. Biol. 16:113143.[CrossRef][Medline]
Butcher, E.C. 1991. Leukocyte-endothelial cell recognition: three (or more) steps to specificity and diversity. Cell. 67:10331036.[CrossRef][Medline]
Carlos, T.M., and J.M. Harlan. 1994. Leukocyte-endothelial adhesion molecules. Blood. 84:20682101.
Caron, E., and A. Hall. 1998. Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science. 282:17171721.
Carter, R.A., and I.P. Wicks. 2001. Vascular cell adhesion molecule 1 (CD 106). A multifaceted regulator of joint inflammation. Arthritis Rheum. 44:985994.[CrossRef][Medline]
Castellano, F., C. Le Clainche, D. Patin, M.-F. Carlier, and P. Chavrier. 2001. A WASp-VASP complex regulates actin polymerization at the plasma membrane. EMBO J. 20:56035614.[CrossRef][Medline]
Chan, J.R., S.J. Hyduk, and M.I. Cybulsky. 2000.
4ß1 integrin/VCAM-1 interaction activates
Lß2 integrin-mediated adhesion to ICAM-1 in human T cells. J. Immunol. 164:746753.
Cox, D., C.C. Tseng, G. Bjekic, and S. Greenberg. 1999. A requirement for phosphatidylinositol 3-kinase in pseudopod extension. J. Biol. Chem. 274:12401247.
Cybulsky, M.I., K. Iiyama, H. Li, S. Zhu, M. Chen, M. Iiyama, V. Davis, J.C. Gutierrez-Ramos, P.W. Connelly, and D.S. Milstone. 2001. A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J. Clin. Invest. 107:12551262.[Medline]
Chimini, G., and P. Chavrier. 2000. Function of Rho family proteins in actin dynamics during phagocytosis and engulfment. Nat. Cell Biol. 2:E191E196.[CrossRef][Medline]
Defacque, H., M. Egeberg, A. Habermann, M. Diakonova, C. Roy, P. Mangeat, W. Voelter, G. Marriot, J. Pfannstiel, H. Faulstich, and G. Griffiths. 2000. Involvement of ezrin/moesin in de novo actin assembly on phagosomal membranes. EMBO J. 19:199212.[CrossRef][Medline]
Doi, Y., M. Itoh, S. Yonemura, S. Ishihara, H. Takano, T. Noda, and S. Tsukita. 1999. Normal development of mice and unimpaired cell adhesion/cell motility/actin-based cytoskeleton without compensatory up-regulation of ezrin or radixin in moesin gene knockout. J. Biol. Chem. 274:23152321.
Elices, M.J., L. Osborn, Y. Takada, C. Crouse, S. Luhowskyj, M.E. Hemler, and R.R. Lobb. 1990. VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin binding site. Cell. 60:577584.[CrossRef][Medline]
Faveeuw, C., M.E. Di Mauro, A.A. Price, and A. Ager. 2000. Roles of alpha(4) integrins/VCAM-1 and LFA-1/ICAM-1 in the binding and transendothelial migration of T lymphocytes and T lymphoblasts across high endothelial venules. Int. Immunol. 12:241251.
González-Amaro, R., and F. Sánchez-Madrid. 1999. Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19:389429.[Medline]
Gray, A., J. van der Kaay, and C.P. Downes. 1999. The pleckstrin homology domains of protein kinase B and GRP1 (general receptor for phosphoinositides-1) are sensitive and selective probes for the cellular detection of phosphatidylinositol 3,4-bisphosphate and/or phosphatidylinositol 3,4,5-triphosphate in vivo. Biochem. J. 344:929936.[CrossRef][Medline]
Hayashi, K., S. Yonemura, T. Matsui, and S. Tsukita. 1999. Immunofluorescence detection of ezrin/radixin/moesin (ERM) proteins with their carboxil-terminal threonine phosphorylated in cultured cells and tissues. J. Cell Sci. 112:11491158.[Abstract]
Heiska, L., K. Alfthan, M. Gronholm, P. Vilja, A. Vaheri, and O. Carpen. 1998. Association of ezrin with intercellular adhesion molecule-1 and -2 (ICAM-1 and ICAM-2). Regulation by phosphatidylinositol 4, 5-bisphosphate. J. Biol. Chem. 273:2189321900.
Helander, T.S., O. Carpen, O. Turunen, P.E. Kovanen, A. Vaheri, and T. Timonen. 1996. ICAM-2 redistributed by ezrin as a target for killer cells. Nature. 382:265268.[CrossRef][Medline]
Hirao, M., N. Sato, T. Kondo, S. Yonemura, M. Monden, T. Sasaki, Y. Takai, and S. Tsukita. 1996. Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and Rho-dependent signaling pathway. J. Cell Biol. 135:3751.
Koni, P.A., S.K. Joshi, U.A. Temann, D. Olson, L. Burkly, and R.A. Flavell. 2001. Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J. Exp. Med. 193:741753.
Leuker, C.E., M. Labow, W. Müller, and N. Wagner. 2001. Neonatally induced inactivation of the vascular cell adhesion molecule 1 gene impairs B cell localization and T cell-dependent humoral immune response. J. Exp. Med. 193:755767.
Lorenzon, P., E. Vecile, E. Nardon, E. Ferrero, J.M. Harlan, F. Tedesco, and A. Dobrina. 1998. Endothelial cell E- and P-selectin and vascular cell adhesion molecule-1 function as signaling receptors. J. Cell Biol. 142:13811391.
Luscinskas, F.W., G.S. Kansas, H. Ding, P. Pizcueta, B.E. Schleiffenbaum, T.F. Tedder, and M.A. Gimbrone Jr. 1994. Monocyte rolling, arrest and spreading on IL-4 activated vascular endothelium under flow is mediated via sequential action of L-selectin, beta-1-integrins, and beta-2-integrins. J Cell Biol. 125:14171427.
Mangeat, P., C. Roy, and M. Martin. 1999. ERM proteins in cell adhesion and membrane dynamics. Trends Cell Biol. 9:187192.[CrossRef][Medline]
Marlin, S.D., and T.A. Springer. 1987. Purified inter-cellular adhesion molecule (ICAM-1) is a ligand for lymphocyte-associated antigen 1 (LFA1). Cell. 51:813819.[CrossRef][Medline]
Matsui, T., M. Maeda, Y. Doi, S. Yonemura, M. Amano, K. Kaibuchi, and S. Tsukita. 1998. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J. Cell Biol. 140:647657.
May, R.C., and L.M. Machesky. 2001. Phagocytosis and the actin cytoskeleton. J. Cell Sci. 114:10611077.[Abstract]
Meerschaert, J., and M.B. Furie. 1995. The adhesion molecules used by monocytes for migration across endothelium include CD11a/CD18, CD11b/CD18, and VLA-4 on monocytes and ICAM-1, VCAM-1, and other ligands on endothelium. J. Immunol. 154:40994112.[Abstract]
Menager, C., J. Vassy, C. Doliger, Y. Legrand, and A. Karniguian. 1999. Subcellular localization of RhoA and ezrin at membrane ruffles of human endothelial cells: differential role of collagen and fibronectin. Exp. Cell Res. 249:221230.[CrossRef][Medline]
Muñoz, M., J. Serrador, F. Sanchez-Madrid, and J. Teixido. 1996. A region of the integrin VLA alpha 4 subunit involved in homotypic cell aggregation and in fibronectin but not vascular cell adhesion molecule-1 binding. J. Biol. Chem. 271:26962702.
Nakamura, F., L. Huang, K. Pestonjamasp, E.J. Luna, and H. Furthmayr. 1999. Regulation of F-actin binding to platelet moesin in vitro by both phosphorylation of threonine 558 and polyphosphatidylinositides. Mol. Biol. Cell. 10:26692685.
Oppenheimer-Marks, N., L.S. Davis, D.T. Bogue, J. Ramberg, and P.E. Lipsky. 1991. Differential utilization of ICAM-1 and VCAM-1 during the adhesion and transendothelial migration of human T lymphocytes. J. Immunol. 147:29132921.[Abstract]
Randolph, G.J., and M.B. Furie. 1996. Mononuclear phagocytes egress from an in vitro model of the vascular wall by migrating across endothelium in the basal to apical direction: role of intercellular adhesion molecule 1 and the CD11/CD18 integrins. J. Exp. Med. 183:451462.
Rose, D.M., V. Grabovsky, R. Alon, and M.H. Ginsberg. 2001. The affinity of integrin
4ß1 governs lymphocyte migration. J. Immunol. 167:28242830.
Sechi, A.S., and J. Wehland. 2000. The actin cytoskeleton and plasma membrane connection: PtdIns(4,5)P2 influences cytoskeletal protein activity at the plasma membrane. J. Cell Sci. 113:36853695.[Abstract]
Serrador, J.M., J.L. Alonso-Lebrero, M.A. del Pozo, H. Furthmayr, R. Schwartz-Albiez, J. Calvo, F. Lozano, and F. Sánchez-Madrid. 1997. Moesin interacts with the cytoplasmic region of intercellular adhesion molecule-3 and is redistributed to the uropod of T lymphocytes during cell polarization. J. Cell Biol. 138:14091423.
Serrador, J.M., M. Vicente-Manzanares, J. Calvo, O. Barreiro, M.C. Montoya, R. Schwartz-Albiez, H. Furthmayr, F. Lozano, and F. Sanchez-Madrid. 2002. A novel serine-rich motif in the intercellular adhesion molecule-3 is critical for its ERM-directed subcellular targeting. J. Biol Chem. 277:1040010409.
Shaw, R.J., M. Henry, F. Solomon, and T. Jacks. 1998. RhoA-dependent phosphorylation and relocalization of ERM proteins into apical membrane/actin protrusions in fibroblasts. Mol. Biol. Cell. 9:403419.
Takahashi, K., T. Sasaki, A. Mammoto, K. Takaishi, T. Kameyama, S. Tsukita, and Y. Takai. 1997. Direct interaction of the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the activation of the Rho small G protein. J. Biol. Chem. 272:2337123375.
Turunen, O., T. Wahlstrom, and A. Vaheri. 1994. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J. Cell Biol. 126:14451453.
Várnai, P., K.I. Rother, and T. Balla. 1999. Phosphatidylinositol 3-kinase-dependent membrane association of the Bruton's tyrosine kinase pleckstrin homology domain visualized in single living cells. J. Biol. Chem. 274:1098310989.
Wojciak-Stothard, B., L. Williams, and A.J. Ridley. 1999. Monocyte adhesion and spreading on human endothelial cells is dependent on Rho-regulated receptor clustering. J. Cell Biol. 145:12931307.
Yáñez-Mó, M., A. Alfranca, C. Cabañas, M. Marazuela, R. Tejedor, M.A. Ursa, L.K. Ashman, M.O. de Landázuri, and F. Sánchez-Madrid. 1998. Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and CD151/PETA-3 with alpha3beta1 integrin localized at endothelial lateral junctions. J. Cell Biol. 141:791804.