|
||
Article |
6ß4) regulation of eIF-4E activity and VEGF translation
:
a survival mechanism for carcinoma cells
Address correspondence to Arthur M. Mercurio, Beth Israel Deaconess Medical Center, Research North, 330 Brookline Ave., Boston, MA 02215. Tel.: (617) 667-7714. Fax: (617) 667-5531. E-mail: amercuri{at}caregroup.harvard.edu
| Abstract |
|---|
|
|
|---|
6ß4 integrin enhances vascular endothelial growth factor (VEGF) translation in breast carcinoma cells. The mechanism involves the ability of this integrin to stimulate the phosphorylation and inactivation of 4E-binding protein (4E-BP1), a translational repressor that inhibits the function of eukaryotic translation initiation factor 4E (eIF-4E). The regulation of 4E-BP1 phosphorylation by
6ß4 derives from the ability of this integrin to activate the PI-3KAkt pathway and, consequently, the rapamycin-sensitive kinase mTOR that can phosphorylate 4E-BP1. Importantly, we show that this
6ß4-dependent regulation of VEGF translation plays an important role in the survival of metastatic breast carcinoma cells by sustaining a VEGF autocrine signaling pathway that involves activation of PI-3K and Akt. These findings reveal that integrin-mediated activation of PI-3KAkt is amplified by integrin-stimulated VEGF expression and they provide a mechanism that substantiates the reported role of
6ß4 in carcinoma progression.
Key Words: integrin; VEGF; translation; carcinoma; eIF-4E
| Introduction |
|---|
|
|
|---|
An important issue that arises from the contribution of VEGF autocrine signaling to tumor survival is an understanding of the mechanisms that regulate VEGF expression. Such mechanisms are important not only for VEGF signaling in tumor cells, but also for angiogenesis as well. Clearly, hypoxia is a strong inducer of VEGF transcription and mRNA stability (von Marschall et al., 2001), but other factors are likely to be involved. Of note, our finding that the
6ß4 integrin can promote the survival of breast carcinoma cells in stress conditions is intriguing (Bachelder et al., 1999b) and raised the novel possibility that a specific integrin, which has been implicated in cancer progression, could regulate VEGF expression. This possibility is substantiated by the finding reported here that the ability of the
6ß4 integrin to promote survival is VEGF dependent.
The results described above prompted us to investigate the relationship between the
6ß4 integrin and VEGF expression. We observed that the expression and signaling properties of this integrin have no impact on steady-state VEGF mRNA levels. Surprisingly, however, we detected a significant influence of
6ß4 on VEGF translation and protein expression in these cells, an observation that reveals the ability of this integrin to regulate translation. The mechanism by which
6ß4 regulates VEGF expression involves its ability to stimulate the phosphorylation of 4E-binding protein (4E-BP1). 4E-BP1 is phosphorylated by mammalian target of rapamycin (mTOR), a protein kinase whose catalytic domain is structurally related to that of phosphatidylinositol 3-kinase (PI-3K) (Dennis et al., 1999; Schmelzle and Hall, 2000). Phosphorylation of 4E-BP1 by mTOR disrupts its binding to eukaryotic translation initiation factor eIF-4E, which is present in rate-limiting amounts in most cells (De Benedetti and Harris, 1999; McKendrick et al., 1999). eIF-4E plays a critical role in the recruitment of the translational machinery to the 5' end of mRNA, which is demarcated by an m7GpppN cap (where m is a methyl group and N is any nucleotide) (Raught and Gingras, 1999). The m7 cap is essential for the translation of most mRNAs including VEGF (De Benedetti and Harris, 1999; Raught and Gingras, 1999). Dissociation of 4E-BP1 from eIF-4E enables eIF-4E to initiate translation (Gingras et al., 1999, 2001b). The regulation of 4E-BP1 phosphorylation by
6ß4 derives from the ability of this integrin to activate the PI-3KAkt pathway and, consequently, mTOR. Our findings reveal a novel mechanism of tumor cell survival and they highlight the ability of a specific integrin to regulate protein translation by influencing eIF-4E activity.
| Results |
|---|
|
|
|---|
6ß4 integrin to promote the survival of carcinoma cells is VEGF dependent
6ß4 integrin to promote survival is VEGF dependent, we used MDA-MB-435 cells, which lack expression of this integrin. Stable expression of
6ß4 in these cells enhances their ability to survive in stressful conditions (Bachelder et al., 1999b). Importantly, however, expression of
6ß4 does not alter the expression of other integrin subunits in these cells and does not influence their adhesion to matrix (Shaw et al., 1997). As shown in Fig.1 A, a significant level of apoptosis was observed after 24 h of serum deprivation in the parental MDA-MB-435 cells and mock transfectants, as well as in transfectants that express
6ß4 containing a cytoplasmic domain deletion of the ß4 subunit that lacks the ability to signal (Shaw et al., 1997). Stable subclones that express the intact
6ß4 integrin, however, were protected from apoptosis under these conditions. Based on these results and our previous finding that the survival of metastatic breast carcinoma cells is dependent on VEGF, we used a VEGF antisense oligonucleotide to reduce VEGF expression in the MDA-MB-435/ß4 transfectants and assessed the impact of reducing VEGF expression on their survival (Fig. 1, B and C). The VEGF antisense oligonucleotide reduced VEGF protein expression significantly in the ß4 transfectants (Fig. 1 C). As shown in Fig. 1 B, this reduction in VEGF expression abrogated the survival-enhancing effect of
6ß4 under conditions of serum deprivation.
|
6ß4 integrin increases VEGF protein but not mRNA expression
6ß4 expression is VEGF dependent, the novel possibility arose that VEGF expression could be regulated by this integrin. VEGF expression can be regulated at the level of both transcription and mRNA stability (Nabors et al., 2001; von Marschall et al., 2001), mechanisms that would alter the steady-state levels of VEGF mRNA. In addition, regulation can also occur at the level of VEGF translation (Kevil et al., 1996; Akiri et al., 1998; Stein et al., 1998). As shown in Fig. 2 A, quantitative analysis of VEGF mRNA levels in two clones of MDA-MB-435/mock and ß4 transfectants using real-time PCR revealed no significant difference in the steady-state mRNA levels in these two populations. However, we detected a substantial increase in VEGF protein expression in the MDA-MB-435/ß4 transfectants relative to either the parental cells, mock transfectants, or cells that express a cytoplasmic domain deletion of the ß4 subunit (ß4-
CYT) (Fig. 2 B). These results indicate that the
6ß4 integrin regulates VEGF protein expression. It is also worth noting that the level of apoptosis observed in these populations in response to serum deprivation correlates inversely with their expression of VEGF (Fig. 1 A and Fig. 2 B).
|
6ß4, integrin-specific antibodies were used to cluster either
6ß4 or
5ß1 and the effects of integrin-mediated clustering on VEGF expression were assessed by immunoblotting. Of note, the MDA-MB-435/ß4 transfectants express equivalent levels of
6ß4 and
5ß1 (unpublished data). An
6-specific antibody (mAb 2B7) was used to cluster the
6ß1 integrin in the mock transfectants and the
6ß4 integrin in the ß4 transfectants, a ß4-specific antibody (mAb A9) was used to cluster the
6ß4 integrin in the ß4 transfectants, and an
5-specific antibody (mAb Sam1) was used to cluster
5ß1 in both the mock and ß4 transfectants. A substantial induction of VEGF expression was observed upon
6ß4 integrin clustering in the ß4 transfectants but not in the mock transfectants, and no induction was seen in response to
5ß1 clustering (Fig. 2 C). Importantly, the induction of VEGF expression that occurs in response to
6ß4 clustering was inhibited by cycloheximide (Fig. 2 C). This result, together with the real-time PCR data (Fig. 2 A), indicates that
6ß4 is influencing VEGF translation.
To obtain more definitive evidence that
6ß4 is regulating VEGF translation, we performed polysome analysis of the VEGF message. mRNA isolated from the MDA-MB-435/mock and ß4 transfectants was fractionated on a sucrose gradient (Fig. 3 A) and the relative amount of VEGF mRNA in each fraction was determined by real-time PCR (Fig. 3 B). As shown in Fig. 3 B, a striking difference in the distribution of VEGF mRNA was evident in the two populations of cells. In the MDA-MB-435/ß4 transfectants, VEGF mRNA fractionated in the heavy polysomal region, whereas in the mock transfectants, the majority of VEGF mRNA was associated with light polysomal to ribosomal subunit fractions. This result indicates that the translation of VEGF in the MDA-MB-435/ß4 transfectants is cap dependent.
|
6ß4 integrinmediated signaling pathway that regulates VEGF expression
6ß4 regulates the cap-dependent translation of VEGF prompted us to assess the ability of this integrin to stimulate the activity of the eIF-4E translation initiation factor. The
6ß4 integrin is a potent activator of the PI-3KAkt signaling pathway in MDA-MB-435 and other carcinoma cells (Shaw et al., 1997; Bachelder et al., 1999a; Gambaletta et al., 2000; Nguyen et al., 2000; Hintermann et al., 2001), and this pathway has been linked to the regulation of protein translation. Specifically, the serine/threonine kinase mTOR is activated by Akt-mediated phosphorylation events (Sekulic et al., 2000). Phosphorylation of 4E-BP1 by mTOR disrupts its binding to eIF-4E, enabling eIF-4E to initiate translation of VEGF and other molecules (De Benedetti and Harris, 1999). We hypothesized, based on this information, that
6ß4 regulates 4E-BP1 phosphorylation and, as a consequence, VEGF expression. Initially, we assessed the steady-state phosphorylation levels of 4E-BP1 and S6 kinase (p70S6K), which are both downstream targets of mTOR, in cells that had been serum deprived for 24 h. Indeed, a marked increase in the level of phosphorylation of 4E-BP1 (on Ser65) and p70S6K (on Thr389) was evident in the MDA-MB-435/ß4 transfectants relative to either the mock transfectants or the parental cells (Fig. 4 A). Phosphorylation of Ser65 of 4E-BP1 has been shown to be critical for dissociation of 4E-BP from eIF-4E (Gingras et al., 2001a). The reduced expression of 4E-BP1 in the ß4 transfectants compared with the mock transfectants that is apparent in Fig. 4 A may reflect the possibility that the 4E-BP Ab does not recognize the hyperphosphorylated form of the protein as well as it recognizes the hypophosphorylated form.
|
6ß4 regulates VEGF expression by eIF-4Emediated, cap-dependent translation.
To confirm the specificity of the
6ß4 integrin in mTOR signaling, the effects of integrin-mediated clustering on 4E-BP1 phosphorylation were assessed. A substantial induction of Akt, 4E-BP1, and p70S6K phosphorylation was observed upon
6ß4 integrin clustering in the ß4 transfectants but not in the mock transfectants (Fig. 4 C). In contrast, clustering of the
5ß1 integrin did not stimulate phosphorylation of these molecules in either the mock or ß4 transfectants. Collectively, these data demonstrate the preferential ability of the
6ß4 integrin to regulate the mTOR signaling pathway and, more importantly, the phosphorylation of 4E-BP1.
To establish that PI-3K and mTOR are required for 4E-BP1 phosphorylation and VEGF expression, we performed the antibody clustering experiments in the presence of the PI-3Kspecific inhibitor LY294002 and the mTOR-specific inhibitor rapamycin (Fig. 5). As shown in Fig. 5 A, both of these inhibitors blocked the
6ß4-mediated induction of 4E-BP1 phosphorylation and VEGF expression. Although rapamycin did not block Akt phosphorylation, LY294002 did inhibit its phosphorylation, confirming that Akt acts upstream of mTOR and downstream of PI-3K (Fig. 5 A). These inhibitors did not block the phosphorylation of ERK1 and ERK2 (Fig. 5 A).
|
Identification of a specific tyrosine residue in the ß4 cytoplasmic domain required for
6ß4 stimulation of 4E-BP1 phosphorylation and VEGF expression
Recently, a critical tyrosine residue (Y1494) was identified in the third fibronectin type III repeat of the ß4 cytoplasmic domain, and this tyrosine was shown to be essential for activation of PI-3K by
6ß4 (Shaw, 2001). To assess the importance of Y1494 in 4E-BP1 phosphorylation and VEGF expression, stable subclones of MDA-MB-435 cells were generated that expressed
6ß4 containing a Y1494F mutation. As shown in Fig. 6 A, VEGF protein expression was barely detectable in these transfectants compared with the wild-type transfectants. Also, the steady-state level of 4E-BP1 phosphorylation was substantially lower in the Y1494F mutant transfectants than in the wild-type ß4 transfectants. Interestingly, these mutant transfectants also exhibited an eightfold higher level of apoptosis than the wild-type ß4 transfectants in response to serum deprivation (Fig. 6 B). The apoptosis of the mutant cells was reduced substantially by the addition of recombinant VEGF (Fig. 6 B), a result that substantiates the importance of VEGF in the survival of these cells. Together, these findings highlight the importance of the ß4 cytoplasmic domain and PI-3K signaling in the regulation of VEGF expression and tumor cell survival.
|
6ß4 signaling
6ß4 signaling. For this purpose, we used MDA-MB-435/mock transfectants that lack
6ß4 expression and the MDA-MB-435/ß4 Y1494F transfectants, described above, which are deficient in
6ß4-mediated activation of PI-3K. These cells were infected with adenoviruses that encoded either a myristoylated Akt (Myr-Akt) construct or ß-galactosidase as a control. As shown in Fig. 7, expression of Myr-Akt stimulated 4E-BP1 phosphorylation and VEGF expression substantially in both populations of transfectants in comparison to cells that expressed ß-galactosidase. This result indicates the critical importance of Akt activation by
6ß4 for stimulating VEGF expression.
|
6ß4 regulates 4E-BP1 phosphorylation, VEGF expression, and survival in carcinoma cells that express this integrin endogenously
6ß4 in
6ß4-deficient carcinoma cells, we sought to extend our findings to cells that express this integrin endogenously, a pattern that is typical of most carcinoma cells. For this purpose, we used MDA-MB-231 breast carcinoma cells because they express the
6ß4 and
5ß1 integrins (Plopper et al., 1998; Mukhopadhyay et al., 1999; Saad et al., 2000). Initially, we confirmed that the survival of these cells is dependent on their expression of VEGF. As shown in Fig. 8 A, expression of a VEGF antisense oligonucleotide in these cells (Bachelder et al., 2001) resulted in an approximate fourfold increase in annexin V staining upon serum starvation compared with either untreated cells or cells that expressed the sense oligonucleotide.
|
6ß4 in regulating VEGF expression and survival rigorously, we used a small interfering RNA (RNAi) approach to inhibit ß4 expression in MDA-231 cells. RNAis specific for the ß4 subunit and the corresponding inverted sequence were designed and expressed in these cells by transfection. The cells were maintained in low serum (0.5%) for 24 h after transfection and then analyzed. As shown in Fig. 8 B, cells transfected with the RNAi specific for ß4 exhibited a significant reduction in ß4 expression in comparison with either untransfected cells or cells transfected with the inverted sequence. Importantly, the reduction in ß4 expression by RNAi coincided with a marked reduction in 4E-BP1 phosphorylation and in the steady-state level of VEGF (Fig. 8 B), as well as an approximate threefold increase in annexin V staining (Fig. 8 C). These results link
6ß4 expression directly to 4E-BP1 phosphorylation, VEGF expression, and survival in a carcinoma cell line that expresses endogenous
6ß4.
Subsequently, we performed antibody clustering experiments to substantiate the regulation of VEGF expression by
6ß4 (Fig. 8 D). Clustering of the
6ß4 integrin with either an
6 integrinspecific antibody (mAb 2B7) or a ß4 integrinspecific antibody (mAb A9) stimulated the phosphorylation of 4E-BP1 and Akt, and increased VEGF expression. In contrast, no induction of VEGF expression or stimulation of either 4E-BP1 or Akt phosphorylation was observed upon clustering with an
5 integrinspecific antibody (mAb Sam1) or IgG.
| Discussion |
|---|
|
|
|---|
6ß4), which has been implicated in carcinoma progression (Mercurio and Rabinovitz, 2001), to stimulate the translation of VEGF and sustain a VEGF autocrine loop that is essential for survival. More specifically, we define a signaling pathway regulated by
6ß4 that involves the preferential ability of this integrin to stimulate the phosphorylation of 4E-BP1 by activating the PI-3KAkt pathway. As shown previously, this phosphorylation event dissociates 4E-BP1 from eIF-4E, enabling this key elongation factor to mediate the translation of VEGF and other functionally important molecules (De Benedetti and Harris, 1999; Gingras et al., 1999, 2001b; McKendrick et al., 1999). Moreover, the polysome analysis and antisense eIF-4E results we provide indicate that
6ß4 stimulation of VEGF translation is cap dependent and probably doesn't involve the internal ribosome entry sites that are present in the VEGF mRNA (Huez et al., 1998; van der Velden and Thomas, 1999). Our data extend earlier reports on the involvement of eIF-4E, VEGF, and
6ß4 in carcinoma progression by linking these molecules in a common signaling pathway that promotes tumor survival. Furthermore, they reveal a role for integrins in regulating growth factor expression by stimulating protein translation.
An important and novel aspect of our findings is that they add a new dimension to the understanding of how integrins promote cell survival. The widely accepted notion is that integrins, often in concert with growth factor receptors, activate specific signaling pathways that sustain survival (Taylor et al., 1999; Liu et al., 2000). We demonstrate here that the survival function of integrins may not only be mediated by the activation of a key survival kinase such as Akt and the consequent effects of Akt on apoptotic signaling (Datta et al., 1999) but also by the Akt-dependent translation and expression of growth factors, such as VEGF, that promote survival in an autocrine, and possibly paracrine, fashion. In other terms, our results reveal that VEGF is a novel target of Akt signaling by integrins that is important for survival and distinct from known survival factors that are downstream of Akt, such as Bad (Datta et al., 1999). Importantly, our recent observation that VEGF stimulates the PI-3KAkt pathway in carcinoma cells (Bachelder et al., 2001), in conjunction with our finding that
6ß4 signaling enhances VEGF expression, leads to the conclusion that integrin-mediated activation of PI-3KAkt is amplified by integrin-stimulated VEGF expression. Moreover, we show that this amplification of PI-3KAkt activity is important for carcinoma survival.
Although
6ß4 activates PI-3K in carcinoma cells (Gambaletta et al., 2000; Nguyen et al., 2000; Hintermann et al., 2001; Trusolino et al., 2001), no attempt had been made to link this signaling event with downstream effectors that regulate protein translation, namely mTOR and 4E-BP1. One reason that this possibility had not been explored is because a role for
6ß4 in regulating either protein translation or growth factor expression was not obvious. In fact, almost all of the functional studies on
6ß4 in carcinoma cells have focused on its role in promoting migration and invasion, and on the mechanism by which
6ß4-mediated signaling influences these processes (Mercurio, 1990; Shaw et al., 1997; Gambaletta et al., 2000; Trusolino et al., 2001). Our motivation to examine a possible connection between
6ß4 and VEGF translation was based on our interest in understanding the mechanisms by which these molecules promote the survival of carcinoma cells. Indeed, our results establish a role for
6ß4 in survival signaling by regulating VEGF translation, but the implications of these findings are more widespread. For example, recent studies that have argued that
6ß4 is necessary for growth factor receptor (erbB2, c-met) activation of PI-3K (Gambaletta et al., 2000; Trusolino et al., 2001) raise the interesting possibility of an intimate functional association among specific growth factor receptors,
6ß4, VEGF, and PI-3K, all of which have been implicated in tumor progression.
Surprisingly, few studies have examined the role of integrin signaling in regulating protein translation (e.g., Pabla et al., 1999). Indeed, there has been much more interest in defining the contribution of integrins to transcription. The ability of integrins to regulate translation, however, provides a mechanism for altering cell function rapidly, by increasing the expression of specific proteins. This possibility is exemplified by our finding that ligation of the
6ß4 integrin resulted in a significant increase in VEGF protein within 60 min (Fig. 2 C). Given the fact that eIF-4E is rate limiting for the translation of proteins involved in growth control and other critical cell functions (De Benedetti and Harris, 1999), the hypothesis can be formulated that integrin-mediated regulation of translation contributes to the ability of cells to alter their behavior rapidly in response to changes in their microenvironment. This hypothesis is particularly relevant to our interest in the regulation of VEGF expression. Although much of the work in this area has focused on the ability of hypoxia to stimulate VEGF transcription and increase the stability of VEGF mRNA (von Marschall et al., 2001), it has become apparent that translational control is also important (Kevil et al., 1996; De Benedetti and Harris, 1999). Moreover, our recent finding that VEGF is essential for the survival of breast carcinoma cells in normoxia substantiates the functional importance of integrin-mediated regulation of VEGF expression (Bachelder et al., 2001).
The fact that our data implicate eIF-4E in tumor cell survival is of considerable interest because recent studies have revealed an important role for this elongation factor in cancer (DeFatta et al., 1999, 2000; Ernst-Stecken, 2000; Berkel et al., 2001). Overexpression of this factor in NIH3T3 cells, as well as other "normal" cells, stimulates division and can induce their transformation (Fukuchi-Shimogori et al., 1997). These findings are consistent with the reports that the expression of eIF-4E is elevated in solid tumors compared with normal tissue (De Benedetti and Harris, 1999). Moreover, hypoxia, a pathophysiological stress that provides a selective pressure for the survival of aggressive tumor cells, enhances eIF-4E expression (DeFatta et al., 1999). Together, these observations highlight an important role for translational control in human cancer. This role is substantiated by the fact that eIF-4E controls the translation of not only VEGF but also other molecules that influence tumor growth and survival such as c-Myc, cyclin D1, and FGF-2 (De Benedetti and Harris, 1999). From our perspective, we are intrigued by the reports that the
6ß4 integrin is associated with the progression of many solid tumors, and its expression has been correlated with a poorer prognosis in patients with some of these tumors (Mercurio and Rabinovitz, 2001). Our finding that
6ß4 can induce the translational function of eIF-4E by regulating the phosphorylation of 4E-BP1 provides one mechanism to account for the role of this integrin in cancer.
| Materials and methods |
|---|
|
|
|---|
The generation of MDA-MB-435 subclones expressing the
6ß4 integrin has been described previously (Shaw et al., 1997). Tyrosine residue 1494 in the ß4 subunit was mutated to a phenylalanine residue using the Quickchange site-directed mutagenesis kit (Stratagene), and stable subclones of MDA-MB-435 cells that expressed
6ß4 containing this mutant ß4 subunit were generated (Shaw, 2001).
For adenoviral infection, cells were grown in DME containing 10% FBS until they reached 50% confluency. At this point, the culture medium was changed to DME containing 0.5% FBS. Viral dilutions were prepared from purified viral stocks in DME containing 0.5% FBS and the cells were infected for 4 h. At the end of the infection period, the virus-containing medium was removed and the cells were washed once with PBS, and incubated for an additional 12 h in DME containing 10% FBS.
Apoptosis assays
To induce apoptosis, cells were incubated in DME containing 0.5% FBS for 24 h at 37°C. Subsequently, both adherent and nonadherent cells were harvested and their level of apoptosis was assessed using annexin VFITC. In brief, cells were washed once with serum-containing medium, once with PBS, once with annexin VFITC buffer (10 mM Hepes-NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2), and then incubated for 15 min at room temperature with 5 µg/ml annexin VFITC (Biosource International). After washing once with annexin V buffer, the samples were resuspended in the same buffer and analyzed by flow cytometry. Immediately before the analysis, 5 µg/ml propidium iodide (PI) (Biosource International) was added to distinguish apoptotic cells from necrotic cells.
Quantitative real-time PCR
Quantitative analysis of VEGF mRNA expression was performed by real-time PCR using an ABI Prism 7700 sequence detection system (PerkinElmer) and SYBR green master mix kit as described previously (Bachelder et al., 2001). Sequences of primers and probes were as follows: VEGF forward primer, 5'-GAAGTGGTGAAGTTCATGGATGTCTA-3'; VEGF reverse primer, 5'-TGGAAGATGTCCACCAGGGT-3'; VEGF probe, 5'-/TET/AGCGCAGCTACTGCCATCCAATCG/TAM/-3'; ß-actin forward primer, 5'-TCACCATGGATGATGATATCGC-3'; ß-actin reverse primer, 5'-AAGCCGGCCTTGCACAT-3'; and ß-actin probe, 5'-/FAM/CGCTCGTCGTCGACAACGGCT/TAM/-3'.The data obtained are presented as the mean ratio of VEGF to ß-actin mRNA (± SD) obtained from triplicate samples.
VEGF antisense oligonucleotide experiments
A VEGF antisense 2'-O-methyl phosphorothioate oligodeoxynucleotide (5'-CACCCAAGACAGCAGAA-3') and a sense 2'-O-methyl phosphorothioate oligodeoxynucleotide (5'-CTTTCTGCTGTCTTGGGTG) (provided by Greg Robinson, Children's Hospital, Boston, MA) were used to transfect MDA-MB-435 ß4 transfectants at a concentration of 0.3 µM in the presence of lipofectin reagent (2 µg/ml; GIBCO BRL). The experimental details for this approach have been described previously (Bachelder et al., 2001). In addition, the same protocol was used to express antisense and sense eIF-4E oligonucleotides, which were gifts from Arigo De Benedetti (Louisiana State University, Shreveport, LA) (DeFatta et al., 2000).
RNAi experiments
An RNAi specific for the ß4 integrin subunit (GAGCUGCACGGAGUGUGUC) as well as the inverted sequence (CUGUGUGAGGCACGUCGAG) were designed and synthesized by Dharmacon, Inc. MDA-231 cells at 30% confluency were transfected with 300 pmoles of RNAi using TKO lipids (Mirus). Subsequently, the cells were maintained in complete medium for 72 h and in medium containing 0.5% FBS for an additional 24 h before analysis.
Polysome analysis
Cells (3 x 107) were maintained in medium containing low serum (0.5% FBS) for 24 h and then pretreated with 100 µg/ml cycloheximide (Calbiochem) for 15 min at 37°C before being harvested. After washing once with PBS containing 100 µg/ml cycloheximide, the cells were resuspended in 0.5 ml of a modified U+S buffer (Davies and Abe, 1995). This buffer was composed of 200 mM Tris-HCl (pH 8.8), 25 mM MgCl2, 5 mM EGTA (pH 8.0), 150 mM KCl, 10 µg/ml heparin, 5 mM DTT, 1% sodium deoxycholate, 2% polyoxyethylene 10-tridecy ester, 100 µg/ml cycloheximide, and 200 mM sucrose. Ribonuclease inhibitor (Amersham Biosciences) was added to a final concentration of 0.5 U/µl. Cells were homogenized with 2025 strokes in a Kontes tissue homogenizer, followed by centrifugation for 5 min at 14,000 g. The supernatant was collected and frozen at -80°C until further use. Sucrose gradients (1550%, wt/wt) were layered with 300 µl of cleared cell extract, which was then centrifuged at 160,000 g for 2 h. Fractions (0.750.375 ml) were withdrawn from the top of the gradient and monitored for absorbency at 254 nm using an ISCO syringe pump with UV-6 detector. Total RNA from the sucrose gradient fractions was extracted using Trizol LS (Life Technologies) according to the manufacturer's instructions. Quantitative real-time PCR was used to measure the VEGF mRNA level in each fraction as described above.
Integrin signaling experiments
Cells were harvested by trypsin treatment and washed twice with DME containing 25 mM Hepes and 0.1% BSA. After washing, the cells were resuspended in the same buffer at a concentration of 2 x 106 cells/ml and incubated for 30 min with integrin-specific antibodies (4 µg/ml) or with either mouse or rat IgG (4 µg/ml). The cells were washed once, resuspended in the same buffer, and added to plates that had been coated overnight with either the antimouse or rat IgG. After a 60-min incubation at 37°C, the cells that had attached to integrin-specific antibodies were washed twice with cold PBS and solubilized at 4°C for 10 min using RIPA buffer (20 mM Tris buffer, pH 7.4, containing 0.14 M NaCl, 1% NP-40, 10% glycerol, 1 mM sodium orthovanadate, 2 mM PMSF, 5 µg/ml aprotinin, pepstatin, and leupeptin). The IgG-treated cells were harvested by centrifugation and solubilized with RIPA buffer.
Protein analysis
Aliquots of cell extracts containing equivalent amounts of protein were solubilized using 5x sample buffer containing 100 mM DTT and then incubated at 100°C for 15 min. These extracts were resolved by SDS-PAGE and transferred to nitrocellulose filters. The filters were blocked for 1 h using a 50 mM Tris buffer, pH 7.5, containing 0.15 M NaCl, 0.05% Tween-20 (TBST), and 5% (wt/vol) Carnation dry milk. The filters were incubated overnight in the same buffer containing antibodies specific for p70S6K, 4EBP antibodies (Santa Cruz Biotechnology, Inc.), actin (ICN Biomedicals), and VEGF (clone 618, provided by Donald Senger, Beth Israel Deaconess Medical Center). After three, 10-min washes in TBST, the filters were incubated for 1 h in blocking buffer containing HRP-conjugated secondary antibodies. After three 10-min washes in TBST, proteins were detected by ECL (Pierce Chemical Co.).
For immunoblots involving phosphospecific antibodies, the filters were blocked for 1 h using a 10 mM Tris buffer, pH 7.5, containing 0.5 M NaCl, 0.1% Tween-20, and 2% (wt/vol) BSA. The filters were washed briefly and then incubated overnight at 4°C in the same blocking buffer containing antibodies specific for phospho-p70S6K (Thr-389; Cell Signaling Technology), phospho4E-BP1 (Ser-65; Cell Signaling Technology), phospho-Erk (E10; Cell Signaling Technology), and phospho-Akt (Ser-473 clone 4E2; Cell Signaling Technology). After washing, the filters were incubated for 1 h in blocking buffer containing HRP-conjugated secondary antibody and the proteins were detected by ECL.
| Footnotes |
|---|
| Acknowledgments |
|---|
This work was supported by National Institutes of Health grants CA89209 and CA80789 (A.M. Mercurio), CA81697 (R.E. Bachelder), and CA81325 (L.M. Shaw) and US Army Medical Research grants BC001077 (J. Chung) and BC000697 (A.M. Mercurio).
Submitted: 4 December 2001
Revised: 7 May 2002
Accepted: 24 May 2002
| References |
|---|
|
|
|---|
Akiri, G., D. Nahari, Y. Finkelstein, S.Y. Le, O. Elroy-Stein, and B.Z. Levi. 1998. Regulation of vascular endothelial growth factor (VEGF) expression is mediated by internal initiation of translation and alternative initiation of transcription. Oncogene. 17:227236.[CrossRef][Medline]
Bachelder, R.E., A. Marchetti, R. Falcioni, S. Soddu, and A.M. Mercurio. 1999a. Activation of p53 function in carcinoma cells by the alpha6beta4 integrin. J. Biol. Chem. 274:2073320737.
Bachelder, R.E., M.J. Ribick, A. Marchetti, R. Falcioni, S. Soddu, K.R. Davis, and A.M. Mercurio. 1999b. p53 inhibits alpha 6 beta 4 integrin survival signaling by promoting the caspase 3dependent cleavage of AKT/PKB. J. Cell Biol. 147:10631072.
Bachelder, R.E., A. Crago, J. Chung, M.A. Wendt, L.M. Shaw, G. Robinson, and A.M. Mercurio. 2001. Vascular endothelial growth factor is an autocrine survival factor for neuropilin-expressing breast carcinoma cells. Cancer Res. 61:57365740.
Berkel, H.J., E.A. Turbat-Herrera, R. Shi, and A. de Benedetti. 2001. Expression of the translation initiation factor eIF4E in the polyp-cancer sequence in the colon. Cancer Epidemiol. Biomarkers Prev. 10:663666.
Brown, L.F., A.J. Guidi, S.J. Schnitt, L. Van De Water, M.L. Iruela-Arispe, T.K. Yeo, K. Tognazzi, and H.F. Dvorak. 1999. Vascular stroma formation in carcinoma in situ, invasive carcinoma, and metastatic carcinoma of the breast. Clin. Cancer Res. 5:10411056.
Datta, S.R., A. Brunet, and M.E. Greenberg. 1999. Cellular survival: a play in three Akts. Genes Dev. 13:29052927.
Davies, E., and S. Abe. 1995. Methods for isolation and analysis of polyribosomes. Methods Cell Biol. 50:209222.[Medline]
De Benedetti, A., and A.L. Harris. 1999. eIF4E expression in tumors: its possible role in progression of malignancies. Int. J. Biochem. Cell Biol. 31:5972.[CrossRef][Medline]
DeFatta, R.J., E.A. Turbat-Herrera, B.D. Li, W. Anderson, and A. De Benedetti. 1999. Elevated expression of eIF4E in confined early breast cancer lesions: possible role of hypoxia. Int. J. Cancer. 80:516522.[CrossRef][Medline]
DeFatta, R.J., C.A. Nathan, and A. De Benedetti. 2000. Antisense RNA to eIF4E suppresses oncogenic properties of a head and neck squamous cell carcinoma cell line. Laryngoscope. 110:928933.[CrossRef][Medline]
Dennis, P.B., S. Fumagalli, and G. Thomas. 1999. Target of rapamycin (TOR): balancing the opposing forces of protein synthesis and degradation. Curr. Opin. Genet. Dev. 9:4954.[CrossRef][Medline]
Dvorak, H.F., J.A. Nagy, D. Feng, L.F. Brown, and A.M. Dvorak. 1999. Vascular permeability factor/vascular endothelial growth factor and the significance of microvascular hyperpermeability in angiogenesis. Curr. Top. Microbiol. Immunol. 237:97132.[Medline]
Ernst-Stecken, A. 2000. The molecular marker eIF4E in the surgical margins of the resection preparations of head-neck tumors as a prognostic factor. Strahlenther. Onkol. 176:383384.[Medline]
Fearon, E.R. 1999. Cancer progression. Curr. Biol. 9:R873R875.[CrossRef][Medline]
Fukuchi-Shimogori, T., I. Ishii, K. Kashiwagi, H. Mashiba, H. Ekimoto, and K. Igarashi. 1997. Malignant transformation by overproduction of translation initiation factor eIF4G. Cancer Res. 57:50415044.
Gambaletta, D., A. Marchetti, L. Benedetti, A.M. Mercurio, A. Sacchi, and R. Falcioni. 2000. Cooperative signaling between alpha(6)beta(4) integrin and ErbB-2 receptor is required to promote phosphatidylinositol 3-kinase-dependent invasion. J. Biol. Chem. 275:1060410610.
Gingras, A.C., S.P. Gygi, B. Raught, R.D. Polakiewicz, R.T. Abraham, M.F. Hoekstra, R. Aebersold, and N. Sonenberg. 1999. Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism. Genes Dev. 13:14221437.
Gingras, A.C., B. Raught, S.P. Gygi, A. Niedzwiecka, M. Miron, S.K. Burley, R.D. Polakiewicz, A. Wyslouch-Cieszynska, R. Aebersold, and N. Sonenberg. 2001a. Hierarchical phosphorylation of the translation inhibitor 4E-BP1. Genes Dev. 15:28522864.
Gingras, A.C., B. Raught, and N. Sonenberg. 2001b. Regulation of translation initiation by FRAP/mTOR. Genes Dev. 15:807826.
Hanahan, D., and J. Folkman. 1996. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell. 86:353364.[CrossRef][Medline]
Hanahan, D., and R.A. Weinberg. 2000. The hallmarks of cancer. Cell. 100:5770.[CrossRef][Medline]
Hintermann, E., M. Bilban, A. Sharabi, and V. Quaranta. 2001. Inhibitory role of
6ß4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha3beta1 integrin. J. Cell Biol. 153:465478.
Huez, I., L. Creancier, S. Audigier, M.C. Gensac, A.C. Prats, and H. Prats. 1998. Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA. Mol. Cell. Biol. 18:61786190.
Kevil, C.G., A. De Benedetti, D.K. Payne, L.L. Coe, F.S. Laroux, and J.S. Alexander. 1996. Translational regulation of vascular permeability factor by eukaryotic initiation factor 4E: implications for tumor angiogenesis. Int. J. Cancer. 65:785790.[CrossRef][Medline]
Liu, W., S.A. Ahmad, N. Reinmuth, R.M. Shaheen, Y.D. Jung, F. Fan, and L.M. Ellis. 2000. Endothelial cell survival and apoptosis in the tumor vasculature. Apoptosis. 5:323328.[CrossRef][Medline]
McKendrick, L., V.M. Pain, and S.J. Morley. 1999. Translation initiation factor 4E. Int. J. Biochem. Cell Biol. 31:3135.[CrossRef][Medline]
Mercurio, A.M. 1990. Laminin: multiple forms, multiple receptors. Curr. Opin. Cell Biol. 2:845849.[CrossRef][Medline]
Mercurio, A.M., and I. Rabinovitz. 2001. Towards a mechanistic understanding of tumor invasion: lessons from the alpha6beta 4 integrin. Semin. Cancer Biol. 11:129141.[CrossRef][Medline]
Mukhopadhyay, R., R.L. Theriault, and J.E. Price. 1999. Increased levels of alpha6 integrins are associated with the metastatic phenotype of human breast cancer cells. Clin. Exp. Metastasis. 17:325332.[Medline]
Nabors, L.B., G.Y. Gillespie, L. Harkins, and P.H. King. 2001. HuR, a RNA stability factor, is expressed in malignant brain tumors and binds to adenine- and uridine-rich elements within the 3' untranslated regions of cytokine and angiogenic factor mRNAs. Cancer Res. 61:21542161.
Nguyen, B.P., S.G. Gil, and W.G. Carter. 2000. Deposition of laminin 5 by keratinocytes regulates integrin adhesion and signaling. J. Biol. Chem. 275:3189631907.
Pabla, R., A.S. Weyrich, D.A. Dixon, P.F. Bray, T.M. McIntyre, S.M. Prescott, and G.A. Zimmerman. 1999. Integrin-dependent control of translation: engagement of integrin
IIbß3 regulates synthesis of proteins in activated human platelets. J. Cell Biol. 144:175184.
Plopper, G.E., S.Z. Domanico, V. Cirulli, W.B. Kiosses, and V. Quaranta. 1998. Migration of breast epithelial cells on laminin-5: differential role of integrins in normal and transformed cell types. Breast Cancer Res. Treat. 51:5769.[CrossRef][Medline]
Raught, B., and A.C. Gingras. 1999. eIF4E activity is regulated at multiple levels. Int. J. Biochem. Cell Biol. 31:4357.[CrossRef][Medline]
Saad, S., L.J. Bendall, A. James, D.J. Gottlieb, and K.F. Bradstock. 2000. Induction of matrix metalloproteinases MMP-1 and MMP-2 by co-culture of breast cancer cells and bone marrow fibroblasts. Breast Cancer Res. Treat. 63:105115.[CrossRef][Medline]
Schmelzle, T., and M.N. Hall. 2000. TOR, a central controller of cell growth. Cell. 103:253262.[CrossRef][Medline]
Scotlandi, K., S. Benini, M. Sarti, M. Serra, P.L. Lollini, D. Maurici, P. Picci, M.C. Manara, and N. Baldini. 1996. Insulin-like growth factor I receptor-mediated circuit in Ewing's sarcoma/peripheral neuroectodermal tumor: a possible therapeutic target. Cancer Res. 56:45704574.
Sekulic, A., C.C. Hudson, J.L. Homme, P. Yin, D.M. Otterness, L.M. Karnitz, and R.T. Abraham. 2000. A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 60:35043513.
Shaw, L.M. 2001. Identification of insulin receptor substrate 1 (IRS-1) and IRS-2 as signaling intermediates in the
6ß4 integrin-dependent activation of phosphoinositide 3-OH kinase and promotion of invasion. Mol. Cell. Biol. 21:50825093.
Shaw, L.M., I. Rabinovitz, H.H. Wang, A. Toker, and A.M. Mercurio. 1997. Activation of phosphoinositide 3-OH kinase by the alpha6beta4 integrin promotes carcinoma invasion. Cell. 91:949960.[CrossRef][Medline]
Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature. 359:843845.[CrossRef][Medline]
Stein, I., A. Itin, P. Einat, R. Skaliter, Z. Grossman, and E. Keshet. 1998. Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol. Cell. Biol. 18:31123119.
Taylor, S.T., J.A. Hickman, and C. Dive. 1999. Survival signals within the tumour microenvironment suppress drug-induced apoptosis: lessons learned from B lymphomas. Endocr. Relat. Cancer. 6:2123.[Abstract]
Tokunou, M., T. Niki, K. Eguchi, S. Iba, H. Tsuda, T. Yamada, Y. Matsuno, H. Kondo, Y. Saitoh, H. Imamura, and S. Hirohashi. 2001. c-MET expression in myofibroblasts: role in autocrine activation and prognostic significance in lung adenocarcinoma. Am. J. Pathol. 158:14511463.
Trusolino, L., A. Bertotti, and P.M. Comoglio. 2001. A signaling adapter function for alpha6beta4 integrin in the control of HGF-dependent invasive growth. Cell. 107:643654.[CrossRef][Medline]
van der Velden, A.W., and A.A. Thomas. 1999. The role of the 5' untranslated region of an mRNA in translation regulation during development. Int. J. Biochem. Cell Biol. 31:87106.[CrossRef][Medline]
von Marschall, Z., T. Cramer, M. Hocker, G. Finkenzeller, B. Wiedenmann, and S. Rosewicz. 2001. Dual mechanism of vascular endothelial growth factor upregulation by hypoxia in human hepatocellular carcinoma. Gut. 48:8796.
Wong, A.S., S.L. Pelech, M.M. Woo, G. Yim, B. Rosen, T. Ehlen, P.C. Leung, and N. Auersperg. 2001. Coexpression of hepatocyte growth factor-Met: an early step in ovarian carcinogenesis? Oncogene. 20:13181328.[CrossRef][Medline]