|
||
Article |
Address correspondence to David E. Fisher, Dana-Farber Cancer Institute, Pediatric Oncology, Dana 630, 44 Binney St., Boston, MA 02115. Tel.: (617) 632-4916. Fax: (617) 632-2085. E-mail: David_Fisher{at}dfci.harvard.edu
| Abstract |
|---|
|
|
|---|
Key Words: Wnt-signaling; ß-catenin; MITF; survival; melanoma
| Introduction |
|---|
|
|
|---|
A role for MITF in pigment gene regulation has been strongly suggested (Bentley et al., 1994; Hemesath et al., 1994; Yasumoto et al., 1994, 1997) based on the existence of highly conserved MITF consensus DNA binding elements in the promoters of the three major pigment enzyme genes: tyrosinase, Tyrp1, and Dct. Mounting evidence also suggests a role for MITF in the commitment, proliferation, and survival of melanocytes before and/or during neural crest cell migration (Opdecamp et al., 1997). Moreover, examination of heterozygous mutant MITF mice shows that absolute numbers of melanoblasts are reduced (Hornyak et al., 2001), suggesting a dosage dependence on MITF. Collectively, these studies suggest that MITF, in addition to its role in differentiation pathways such as pigmentation, may serve an important role in the proliferation and/or survival of developing melanocytes. The retention of MITF expression in the vast majority of human primary melanomas, including nonpigmented tumors, is consistent with this possibility and has also led to the widespread use of MITF as a diagnostic tool in this malignancy (King et al., 1999; Salti et al., 2000; Chang and Folpe, 2001; Miettinen et al., 2001).
The Wnt signaling pathway plays an integral role throughout development (for review see Wodarz and Nusse, 1998), particularly in the neural crest (for review see Dorsky et al., 2000a), and has also been strongly implicated in human tumorigenesis (for reviews see Bienz and Clevers, 2000; Peifer and Polakis, 2000). Wnt signaling plays a pivotal role in neural crest population expansion (Ikeya et al., 1997) and melanocyte lineage-specific expansion and differentiation (Dorsky et al., 1998; Dunn et al., 2000; Jin et al., 2001). A key downstream effector of this pathway is ß-catenin, a multifunctional protein which can either bind to E-cadherins as an integral part of the actin cytoskeleton which anchors cellcell adhesion, or can act as a transcriptional coactivator by interacting with the T-cell transcription factor (TCF)/lymphoid enhancer binding factor (LEF) family of DNA binding proteins in the nucleus. In the absence of Wnt-signals, ß-catenin is targeted for degradation via phosphorylation by a complex consisting of glycogen synthase kinase (GSK)3ß, axin, and adenomatous polyposis coli protein (APC). Wnt signals lead to inactivation of GSK3ß, and thus stabilize ß-catenin levels in the cell which increase transcription of downstream target genes. Mutations in multiple components of the Wnt pathway have been identified in many human cancers, and share the property of inducing nuclear accumulation of ß-catenin (Polakis, 2000). Dysregulation of ß-catenin levels has been shown to produce aberrant transactivation of downstream proto-oncogenes such as cyclin D1 (Shtutman et al., 1999; Tetsu and McCormick, 1999) and c-Myc (He et al., 1998). In human melanoma, stabilizing mutations of ß-catenin have been found in a significant fraction of established cell lines (Rubinfeld et al., 1997). Importantly, in primary human melanoma specimens, almost one third display aberrant nuclear accumulation of ß-catenin, although generally without evidence of direct mutations within the ß-catenin gene itself (Rimm et al., 1999). These observations are consistent with the hypothesis that this pathway contributes to behavior of melanoma cells and might be inappropriately deregulated in the genesis of this disease.
During zebrafish development, Wnt signaling has been demonstrated to be both necessary and sufficient to promote pigment cell fate of neural crest cells through its effector ß-catenin at the expense of neural and glial lineages (Dorsky et al., 1998). The zebrafish MITF homologue, nacre, was shown to mediate this fate decision as a downstream target of Wnt signaling (Dorsky et al., 2000b). In mammalian cells, Wnt-3a, was also shown to induce MITF expression (Takeda et al., 2000). These reports indicate that the MITF promoter is transactivated by ß-catenin in a manner dependent on TCF/LEF DNA consensus elements. Based on their pivotal requirements during melanocyte development, it is of interest to speculate that MITF and Wnt/ß-catenin may also play central roles in the behavior of melanoma cells.
Here we show that ß-catenin is a significant regulator of melanoma cell growth, with MITF as a critical downstream target. Importantly, disruption of the canonical Wnt pathway abrogates growth of melanoma cells, and constitutive overexpression of MITF rescues the growth suppression. These observations establish a critical role for both ß-catenin and MITF in cell growth and survival of human melanoma.
| Results |
|---|
|
|
|---|
|
1/3 of primary melanoma specimens (Rimm et al., 1999). Reporter assays were performed and showed that cells without aberrant nuclear accumulation of ß-catenin retain a modest (approximately twofold) but measurable degree of endogenous TCF/LEF transcriptional activity (Fig. 2 B). The aberrant nuclear accumulation of ß-catenin in 501mel and SK-MEL-5 is associated with significantly higher activity for the reporter containing optimal TCF/LEF binding sites (TK-TOP) relative to the one with mutated TCF/LEF sites (TK-FOP). These experiments suggest that the ß-cateninTCF/LEF transcriptional pathway is activated to varying degrees among melanoma cell lines, a finding which is consistent with data from primary human melanomas (Rimm et al., 1999). Moreover, the ß-cateninTCF/LEF pathway appears to be active, although to a lesser extent, even in those melanomas without excessive quantities of ß-catenin in the nucleus. Ectopic expression of ß-catenin in these human melanoma lines revealed a correlation between absence of aberrant nuclear ß-catenin and a mitogenic effect from exogenous ß-catenin (Table I). The lack of a mitogenic effect for exogenous ß-catenin in cells with aberrant nuclear accumulated ß-catenin is consistent with the possibility that these cells are already maximally stimulated through this pathway, and therefore less responsive to additional (exogenous) ß-catenin. However, expression of dnTCF does profoundly disrupt proliferation in all tested melanoma lines (see below), suggesting that the pathway remains important in cells exhibiting either nuclear plus cytoplasmic or mostly cytoplasmic ß-catenin.
|
|
control probes previously identified as TCF/LEF and TCF/LEF with ß-catenin (Korinek et al., 1997). In addition, inclusion of a polyclonal antibody directed at ß-catenin produces a supershifted complex, highlighting the identity of this complex. The shifted complex was competed with a wild-type MITF probe but not with a probe in which the TCF/LEF site is mutated. Importantly, nuclear extracts from melanomas with or without aberrant nuclear ß-catenin both produce supershiftable ß-catenin complexes, further supporting the conclusion that the Wnt/ß-catenin/LEF pathway is functional even in melanomas exhibiting predominantly cytoplasmic ß-catenin. To assess whether ß-catenin is endogenously bound to the MITF promoter in melanoma cells, we conducted chromatin immunoprecipitation assays in B16 melanoma cells. As shown in Fig. 4 A, these studies revealed occupancy of the endogenous melanocyte-specific MITF promoter by ß-catenin with absence of signal from control antibody, no-antibody control, or antiß-catenin tested on a remote transcriptionally active genomic location (the tyrosinase promoter). This observation on the endogenous MITF gene is in agreement with the previously reported ability of the architectural TCF/LEF proteins to bind the MITF promoter in gel shift assays (Takeda et al., 2000) and extends this further to show that endogenous ß-catenin is truly found at the MITF-promoter in melanoma cells.
|
|
A novel MITF(dn) abrogates ß-catenininduced proliferation
During melanocyte development, MITF appears to be a functionally critical target of Wnt signaling, as demonstrated using rescue assays in zebrafish (Dorsky et al., 2000b). Although ß-catenin signaling is heavily implicated in human malignancies, few identified downstream targets of this pathway have been found that are lineage specific and functionally important in the neoplastic state. In order to conduct loss-of-function experiments, we made use of a novel dn mutation of MITF (MITF[dn]) based on a mutant mouse allele, which deletes a critical basic domain arginine while retaining an intact HLH-Zip dimerization motif. This mutation is dn through sequestration of a wild-type partner into a heterodimer that is incapable of binding DNA due to the arginine deletion (Hemesath et al., 1994). Without affecting its specificity, a further NH2-terminal truncation was made which removes the transactivation domain. Immunofluorescence revealed that the dominant negative protein localizes to the nucleus in transfected melanoma cells (Fig. 5 A). In vitro transcriptional assays using an E-boxdependent reporter demonstrated that the dn construct potently represses basal activity, whereas wild-type MITF stimulates the reporter in B16 melanoma cells (Fig. 5 B). Importantly, the MITF(dn) construct is unable to repress the same E-box reporter in non-MITFexpressing HEK293 cells, consistent with its repressive effect being due to sequestration of endogenous MITF away from DNA.
|
MITF specifically rescues apoptosis induced by dnTCF
If MITF were a functionally important mediator of ß-catenin signaling in melanoma, then transfection of MITF-encoding plasmid may be able to rescue the phenotype generated by blockade of the Wnt pathway. We recapitulated ß-catenin blockade using dnTCF in multiple melanoma lines and examined the effects of simultaneous MITF expression from a constitutive promoter. Constitutive MITF expression significantly rescued colony formation in human 501mel and SK-MEL-5 melanoma cells (Fig. 6 A), both of which exhibit nuclear accumulated ß-catenin (Table I). The same experiment was also carried out in B16 melanoma cells, displaying mostly cytoplasmic ß-catenin. In this setting as well, growth suppression imposed by dnTCF was similarly rescued by constitutive MITF expression, as displayed in a quantitative summary of clonogenic growth assays (Fig. 6 B). In contrast, c-Myc, a different downstream target of the Wnt pathway (He et al., 1998), did not rescue growth suppression by dnTCF in melanoma cells, and in some cases even further suppressed clonogenic growth (Fig. 6, A and B). Control experiments in B16 melanoma revealed measurable growth suppression by both dnTCF and c-Myc (Fig. 6 C).
|
| Discussion |
|---|
|
|
|---|
MITF as a survival factor in the melanocyte lineage
It is noteworthy that MITF expression is retained in the vast majority of human melanomas, including the many tumors in which other differentiation markers, such as pigmentation, are lost (King et al., 1999). Furthermore, MITF deficiency in mouse or man results in melanocyte loss (rather than depigmentation), and one mutant mouse allele (Mitfvit) displays most melanocyte loss postnatally (Lerner et al., 1986). These observations suggest that MITF may be functionally important for melanoma growth or survival, a premise that is tested here.
In addition to its Wnt responsiveness, the MITF promoter responds to melanocyte stimulating hormone via a CRE element (Bertolotto et al., 1998; Price et al., 1998). The observation that melanoma cells are sensitized towards apoptosis by introduction of a dn CREB (Jean et al., 1998) is consistent with the possibility that the response may be at least partially mediated by disruption of MITF expression. Although the Wnt/ß-catenin and CREB signaling pathways are both ubiquitous among cell types, it is striking that their effects on MITF expression are restricted to the melanocyte lineage, providing an example of ubiquitous pathways which are harnessed to regulate a tissue-restricted promoter both during normal development and in malignancy. Recent data have also shown direct transcriptional regulation of the prosurvival gene BCL2 by MITF (McGill et al., 2002). Furthermore, the Wnt pathway has been shown to protect against induction of apoptosis in an in vitro fibroblast system dependent on ß-catenin/TCF-mediated transcriptional activity (Chen et al., 2001). In vivo inactivation of ß-catenin has also been shown to increase apoptosis in migrating neural crest cells (Brault et al., 2001), suggesting that in nonmelanocytic neural crest derivatives, Wnt/ß-catenin likely employs different (non-MITF) targets to mediate anti-apoptotic signaling.
MITF as a downstream effector of developmental and oncogenic pathways
As ß-catenin has been shown in other systems to augment growth, it is not surprising to find that this also pertains to melanoma cells, where ß-catenin overexpression or disruption are shown to significantly modulate both cell cycle and survival (Figs. 1, 5, and 6). In melanomas with aberrant nuclear accumulation of ß-catenin, further ectopic ß-catenin expression does not lead to augmented proliferation (Table I). This could be due to the maximized basal activity of ß-catenin in these cells, as proliferation and growth is still abrogated by introduction of dnTCF irrespective of ß-catenin status. Of note, there is also a correlation between the endogenous MITF level and presence of aberrant nuclear ß-catenin in the human melanomas employed here, where A375 (with mostly cytoplasmic ß-catenin) has significantly less MITF than the human melanoma cell lines which lack strong nuclear ß-catenin staining (unpublished data). Still, MITFs transcriptional ability may be modulated by posttranslational events so that quantitative measures of MITF may not necessarily correlate perfectly with its transcriptional activity. We have also shown that ß-catenin leads to increased growth that is potently abrogated by MITF(dn), both measured as decreased proliferation via cell cycle profiles and clonogenic growth. The blockade of ß-catenininduced growth of melanoma cells by MITF(dn) suggests an implicit need for MITF to sustain the growth of these cells. MITF(dn) has been found to suppress melanoma growth regardless of whether ß-catenin's basal activity is low or high. Interestingly, reintroduction of MITF(wt) minimally reverses the alterations in cell cycle caused by suppressing the Wnt pathway by ectopic dnTCF. This observation argues that whereas MITF may be necessary for cell cycle progression induced by ß-catenin, MITF is not sufficient to stimulate cell cycle progression. Therefore, it will be of interest to determine whether there are MITF target genes, which influence cell cycle progression to examine the possibility that MITF contributes to maintenance of the cell cycle machinery while perhaps not directly participating in the mitogenic response. Cell cycle targets of Wnt signaling such as c-Myc, Cyclin D1 (He et al., 1998; Tetsu and McCormick, 1999; Shtutman et al., 1999), and others may more directly mediate ß-catenin's mitogenic effects. Such a model would predict that MITF, as a highly tissue-restricted factor, or its downstream target genes, may represent attractive drug targets in melanoma, a disease for which effective therapies are severely lacking. Towards this end, it will also be important to examine these activities using in vivo tumor models.
Concluding remarks
The importance of MITF in the establishment of the melanocyte lineage is clear, but its role postdevelopmentally is incompletely understood at this time. These data suggest an important role for MITF in survival downstream of the canonical Wnt pathway. Here we show that MITF is able to rescue abrogation of the canonical Wnt pathway by dnTCF in cells irrespective of their ß-catenin status. However, as MITF is retained in virtually all melanomas, including those with deregulated ß-catenin, its role might be broader than as purely an effector for survival in the Wnt pathway. Thus, the many signaling pathways that converge on MITF (Goding, 2000; Price and Fisher, 2001) might reveal additional cues involved in the genesis of melanomas similar to that of the Wnt pathway.
| Materials and methods |
|---|
|
|
|---|
Cell cycle, MITF endogenous expression, colony-forming, and reporter assays
For cell cycle experiments, B16 cells and A375 (maintained in DME supplemented with 10% FBS) were seeded in serum-free RPMI-1640 media 24 h before transfection in 100-mm plates. Cells were transfected using Lipofectamine2000 (GIBCO BRL) according to the manufacturer's recommendations with the indicated vectors (4 µg) and 0.3 µg pcDNA3.1-hrGFP. Cells were refed with RPMI-1640 supplemented with 10% FBS 2 h after transfection, and on the following day they were washed and refed. 48 h after transfection, cells were harvested, fixed, and permeabilized for flow cytometry analysis using propidium iodide to stain for DNA content. Similarly, 501mel and SK-MEL-5 cells were also assayed using their respective media preferences (see below). Endogenous MITF expression was performed similarly as for cell cycle but the cells were harvested earlier, at 28 h posttransfection. MITF protein was stained with mouse monoclonal C5 anti-MITF antibody, washed repeatedly, and then stained secondarily with a R-phycoerythrin conjugated goat-antimouse antibody (Molecular Probes). All samples for flow cytometry were analysed on a Becton-Dickinson FACS instrument using CellQuest software and each sample comprised of at least 104 gated GFP-positive events. Cell cycle and apoptosis data were calculated using ModFit v2.0 (Becton-Dickinson). Colony-forming assays were conducted in 6-well plates (2 µg of total DNA/well) and transfected with indicated vectors including 0.25 µg (12.5%) of pBABE-puro. 501mel were grown in Ham's F10 media, SK-MEL-5 and HEK293 cells in DME, all supplemented with 10% FBS. In experiments with two effector vectors, the ratio of dnTCF to the other vector was 4:1 as indicated. 24 h after transfection cells were refed with DME/10% FBS containing 1 µg/mL puromycin for antibiotic selection. Cells were then refed with the same media every 2 d for 1014 d and subsequently colonies were stained with crystal violet, photographed and measured by absorbance for relative cell numbers. Reporter assays were made in 24-well plates (0.8 µg DNA/well) using Lipofectamine2000 (GIBCO BRL) or Fugene6 (Roche) according to the manufacturer's instructions. 24 h after transfection, the cells were lysed and assayed using Dual Luciferase reagents (Promega). Luciferase values were normalized to constitutive Renilla luciferase generated by cotransfected pRL-CMV plasmid (Promega) and for the TK-FOP/TK-TOP experiments normalized to pRL-TK (Promega).
Soft agar assays
The respective constructs were subcloned into pLHCX-retroviral backbones and replication incompetent virus produced in 293-EBNA cells (Invitrogen) by cotransfection of GagPol and VSV-G expression vectors. High-titer viral supernatants were used to infect SK-MEL-5 in the presence of polybrene (8 µg/ml) and 48 h after infection cells were seeded at 105 cells per 60-mm dishes and refed every 23 d until macroscopic colonies were visible. Infection was controlled by coinfection of hrGFP-expressing retrovirus which was equal in all samples 48 h after infection.
Electrophoretic mobility shift assays and ChIPs
Electrophoretic mobility shift assays (EMSA) were performed by incubating (total volume of 20 µL) 3 µg of nuclear protein, 0.2 ng of radiolabeled probe, and 100 ng of sonicated herring sperm DNA in 10 mM Hepes, pH 7.9, 60 mM KCl, 1 mM EDTA, 1 mM DTT, and 12.5% glycerol. For competition experiments, 5-, 15-, or 50-fold excess unlabeled MITF oligo (wild-type GAGTTTGACTTTGATAGCTCGTCAC or mutant GAGTTTGACTTTGGCAGCTCGTCAC in double-stranded configurations) was incubated with the extract for 5 min before the addition of labeled oligo and the incubation proceeded for an additional 20 min at room temperature. In supershift experiments, 1 µL of antiß-catenin antibody (Upstate Biotechnology) or control rabbit polyclonal antisera were added subsequently and incubated for an additional 20 min at room temperature. Samples were analysed on a native 30:1 (acrylamide:bis) polyacrylamide gel run in 0.5 x TBE at 4°C. ChIPs was performed in mouse B16 cells grown in logarithmic phase in DME/10% FBS. Cells were harvested by scraping, homogenized in a low-salt buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 60 mM KCl, 5% sucrose, 0.1% NP-40, 1 mM EDTA, proteinase inhibitors) on ice using a Dounce homogenizer. The nuclei were isolated by centrifugation onto a 10% sucrose pad, crosslinked for 15 min at room temperature with 1% formaldehyde in PBS, and subsequently, the reaction quenched by the addition of glycine to a final 125-mM concentration. Nuclei were then spun down and resuspended in ChIPs buffer (100 mM Tris-HCl, pH 7.4, 100 mM NaCl, 60 mM KCl, 0.1% NP-40, proteinase inhibitors) and sonicated by three 30-s pulses using a Fisher dismembranator fitted with a microtip on ice. The samples were then precleared by an extensive high-speed centrifugation (14,000 g, 10 min) and then precleared additionally with Ultralink protein A/G beads (Pierce Chemical Co.). Antiß-catenin antibody (06734; Upstate Biotechnology), and control anti-NFATc1 (7A6; Santa Cruz Biotechnology, Inc.) was then added to a tenfold ChIPs buffer diluted sample and incubated on a rotator for 3 h at room temperature. Subsequently, Ultralink protein A/G beads were added to the samples and an additional control sample without antibody and subsequently incubated for an additional hour. Immunoprecipitates were washed twice with ChIPs buffer, twice with 500 mM NaCl containing ChIPs buffer and once with TE, pH 8. The immunoprecipitates were released from the beads by incubating at 65°C for 20 min in 1%SDS/TE, pH 6.8, and protein digested by proteinase K treatment side by side with an additional unprecipitated sample as input control. Crosslinks were released by heating at 70°C for 10 h and DNA subsequently recovered by extraction with phenol and chloroform at high salt (0.6 M NaAcetate, pH 8). Semiquantative PCR was then performed on samples using primers FWD-5'-TGGCCATTAGGGAAGTCTCATGTG and REV-5'-AATTCGAAGAGCGACCGGCATAAAG covering the TCF/LEF binding site in the mouse MITF promoter (EMBL/GenBank/DDBJ under accession no. AC021060). Mouse tyrosinase promoter specific primers FWD-5'-GAGGCAACTATTTTAGACTGATTACTTT and REV-5'-AGGTTAATGAGTGTCACAGACTTC were used as a control.
Immunofluorescence
Melanoma cells were seeded onto coverslips in 24-well plates. In transfection experiments cells were transfected 18 h postplating with pcDNA3.1-HA/MITF(dn) using Lipofectamine2000. The day after transfection (or plating alone), cells were fixed with 3% formaldehyde and stained with polyclonal antiß-catenin antibody (Upstate Biotech) and secondarily with FITC-conjugated goat-antirabbit antibody (Jackson ImmunoResearch Laboratories) or for transfection experiments with FITC-conjugated rat high-affinity anti-HA monoclonal antibody (Roche), all in 10% normal goat serum. Subsequently, the cells were washed, counterstained with DAPI, and photographed through a Nikon fluorescence microscope.
| Footnotes |
|---|
M.A. Horstmann's present address is Universitäts-Klinikum Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany.
E.R. Price's present address is CombinatoRx Inc., Boston, MA 02118.
* Abbreviations used in this paper: APC, adenomatous polyposis coli; bHLHzip, basic/helix-loop-helix/leucine-zipper; dn, dominant-negative; GSK, glycogen synthase kinase; hr, humanized Renilla; LEF, lymphoid enhancer binding factor; MITF, Microphthalmia-associated transcription factor; TCF; T-cell transcription factor.
| Acknowledgments |
|---|
This work was supported by National Institutes of Health grant AR43369 to D.E. Fisher. H.R. Widlund is a Swedish Wenner-Gren Foundation postdoctoral fellow, and S.L. Lessnick is supported by National Institutes of Health training grant HL07574-20. D.E. Fisher is the Jan and Charles Nirenberg Fellow in Pediatric Oncology at Dana-Farber Cancer Institute.
Submitted: 12 February 2002
Revised: 2 July 2002
Accepted: 29 July 2002
| References |
|---|
|
|
|---|
Bentley, N.J., T. Eisen, and C.R. Goding. 1994. Melanocyte-specific expression of the human tyrosinase promoter: activation by the micropthalmia gene product and role of the initiator. Mol. Cell Biol. 14:79968006.
Bertolotto, C., P. Abbe, T.J. Hemesath, K. Bille, D.E. Fisher, J.P. Ortonne, and R. Ballotti. 1998. Microphthalmia gene product as a signal transducer in cAMP-induced differentiation of melanocytes. J. Cell Biol. 142:827835.
Bienz, M., and H. Clevers. 2000. Linking colorectal cancer to Wnt signaling. Cell. 103:311320.[CrossRef][Medline]
Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D.H. Rowitch, A.P. McMahon, L. Sommer, O. Boussadia, and R. Kemler. 2001. Inactivation of the ß-catenin gene by Wnt-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development. 128:12531264.[Abstract]
Chang, K.L., and A.L. Folpe. 2001. Diagnostic utility of microphthalmia transcription factor in malignant melanoma and other tumors. Adv. Anat. Pathol. 8:273275.[CrossRef][Medline]
Chen, S., D.C. Guttridge, Z. You, Z. Zhang, A. Fribley, M.W. Mayo, J. Kitajewski, and C.-Y. Wang. 2001. Wnt-1 signaling inhibits apoptosis by activating ß-catenin/T cell factor-mediated transcription. J. Cell Biol. 152:8796.
Dorsky, R.I., R.T. Moon, and D.W. Raible. 1998. Control of neural crest cell fate by the Wnt signalling pathway. Nature. 396:370373.[CrossRef][Medline]
Dorsky, R.I., R.T. Moon, and D.W. Raible. 2000a. Environmental signals and cell fate specification in premigratory neural crest. Bioessays. 22:708716.[CrossRef][Medline]
Dorsky, R.I., D.W. Raible, and R.T. Moon. 2000b. Direct regulation of nacre, a zebrafish MITF homolog required for pigment cell formation, by the Wnt pathway. Genes Dev. 14:158162.
Dunn, K.J., B.O. Williams, Y. Li, and W.J. Pavan. 2000. Neural crest-directed gene transfer demonstrates Wnt1 role in melanocyte expansion and diffrentiation during mouse development. Proc. Natl. Acad. Sci. USA.. 97:1005010055.
Goding, C.R. 2000. MITF from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage. Genes Dev. 14:17121728.
Hann, S.R., V. Dixit, R.C. Sears, and L. Sealy. 1994. The alternatively initiated c-Myc proteins differentially regulate transcription through a noncanonical DNA-binding site. Genes Dev. 8:24412452.
He, T.-C., A.B. Sparks, C. Rago, H. Hermeking, L. Zawel, L.T. da Costa, and P.J. Morin Vogelstein, B., and K.W. Kinzler. 1998. Identification of c-MYC as a target of the APC pathway. Science. 281:15091512.
Hemesath, T.J., E. Steingrímsson, G. McGill, M.J. Hansen, J. Vaught, C.A. Hodgkinson, H. Arnheiter, N.G. Copeland, N.A. Jenkins, and D.E. Fisher. 1994. Micropthamia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8:27702780.
Hodgkinson, C.A., K.J. Moore, A. Nakayama, E. Steingrímsson, N.G. Copeland, N.A., Jenkins, and H. Arnheiter. 1993. Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell. 74:395404.[CrossRef][Medline]
Hornyak, T.J., D.J. Hayes, L. Chiu, and E.B. Ziff. 2001. Transcription factors in melanocyte development: distinct roles for Pax-3 and MITF. Mech. Dev. 101: 4759.[CrossRef][Medline]
Hughes, A.E., V.E. Newton, X.Z. Liu, and A.P. Read. 1994. A gene for Waardenburg syndrome type 2 maps close to the human homologue of the microphthalmia gene at chromosome 3p12-p14.1. Nat. Genet. 7:509512.[CrossRef][Medline]
Ikeya, M., S.K.M. Lee, J.E. Johnson, A.P. McMahon, and S. Takada. 1997. Wnt signaling required for expansion of neural crest and CNS progenitors. Nature. 389:966970.[CrossRef][Medline]
Jean, D., M. Harbison, D.J. McConkey, Z. Ronai, and M. Bar-Eli. 1998. CREB and Its associated proteins act as survival factors for human melanoma cells. J. Biol. Chem. 273:2488424890.
Jin, E.J., C.A. Erickson, S. Takada, and L.W. Burrus. 2001. Wnt and BMP signaling govern lineage segregation of melanocytes in the avian embryo. Dev. Biol. 233:2237.[CrossRef][Medline]
King, R., K.N. Weilbaecher, G. McGill, E. Cooley, M. Mihm, and D.E. Fisher. 1999. Microphthalmia transcription factor. A sensitive and specific melanocyte marker for melanoma diagnosis. Am. J. Path. 155:731738.
Korinek, V., N. Barker, P.J. Morin, D. van Wichen, R. de Weger, K.W. Kinzler, B. Vogelstein, and H. Clevers. 1997. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science. 275:17841787.
Lerner, A.B., T. Shiohara, R.E. Boissy, K.A. Jacobson, M.L. Lamoreux, and G.E. Moellmann. 1986. A mouse model for vitiligo. J. Invest. Dermatol. 87:299304.[CrossRef][Medline]
Liu, C., Y. Kato, Z. Zhang, V.M. Do, B.A. Yankner, and X. He. 1999. beta-Trcp couples beta-catenin phosphorylation-degradation and regulates Xenopus axis formation. Proc. Natl. Acad. Sci. USA. 96:62736278.
McGill, G.G., M.A. Horstmann, H.R. Widlund, J. Du, G. Motyckova, E.K. Nishimura, Y.-L. Lin, S. Ramaswamy, W. Avery, H.-F. Ding, S.A. Jordan, I.J. Jackson, S.J. Korsmeyer, T.R. Golub, and D.E. Fisher. 2002. Bcl2 regulation by the melanocyte master regulator mitf modulates lineage survival and melanoma cell viability. Cell. 109:707718.[CrossRef][Medline]
Miettinen, M., M. Fernandez, K. Franssila, Z. Gatalica, J. Lasota, and M. Sarlomo-Rikala. 2001. Micropthamia transcription factor in the immunohistochemical diagnosis of metastatic melanoma: comparison with four other melanoma markers. Am. J. Surg. Pathol. 25:205211.[Medline]
Opdecamp, K., A. Nakayama, M.T. Nguyen, C.A. Hodgkinson, W.J. Pavan, and H. Arnheiter. 1997. Melanocyte development in vivo and in neural crest cell cultures: crucial dependence on the MITF basic-helix-loop-helix-zipper transcription factor. Development. 124:23772386.[Abstract]
Peifer, M., and P. Polakis. 2000. Wnt signaling in oncogenesis and embryogenesis-a look outside the nucleus. Science 287:16061609.
Polakis, P. 2000. Wnt signaling and cancer. Genes Dev. 14:18371851.
Price, E.R., and D.E. Fisher. 2001. Sensorineural deafness and pigmentation genes Melanocytes and the MITF transcriptional network. Neuron. 30:1518.[CrossRef][Medline]
Price, E.R., M.A. Horstmann, A.G. Wells, K.N. Weilbaecher, C.M. Takemoto, M.W. Landis, and D.E. Fisher. 1998. alpha-Melanocyte-stimulating hormone signaling regulates expression of microphthalmia, a gene deficient in Waardenburg syndrome. J. Biol. Chem. 273:3304233047.
Rimm, D.L., K. Caca, G. Hu, F.B. Harrison, and E.R. Fearon. 1999. Frequent nuclear/cytoplasmic localization of ß-catenin without exon 3 mutations in malignant melanoma. Am. J. Path. 154:325329.
Rubinfeld, B., P. Robbins, M. El-Gamil, I. Albert, E. Porfiri, and P. Polakis. 1997. Stabilization of ß-catenin by genetic defects in melanoma cell lines. Science 275:17901792.
Salti, G.I., T. Manougian, M. Farolan, A. Shilkaitis, D. Majumdar, and T.K. Das Gupta. 2000. Micropthalmia transcription factor: a new prognostic marker in intermediate-thickness cutaneous malignant melanoma. Cancer Res. 60:50125016.
Shtutman, M., J. Zhurinsky, I. Simcha, C. Albanese, M. D'Amico, R. Pestell, and A. Ben-Ze'ev. 1999. The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. USA. 96:55225527.
Takeda, K., K. Yasumoto, R. Takada, S. Takada, K. Watanabe, T. Udono, H. Saito, K. Takahashi, and S. Shibahara. 2000. Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt-3a. J. Biol. Chem. 275:1401314016.
Tetsu, O., and F. McCormick. 1999. ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398:422426.[CrossRef][Medline]
van de Weterling, M., J. Castrop, V. Korinek, and H. Clevers. 1996. Extensive alternative splicing and dual promoter usage generate tcf-1 protein isoforms with differential transcription control properties. Mol. Cell Biol. 16:745752.[Abstract]
Wodarz, A., and R. Nusse. 1998. Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14:5988.[CrossRef][Medline]
Yasumoto, K., K. Yokoyama, Y. Shibata, Y. Tomita, and S. Shibahara. 1994. Micropthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol. Cell Biol. 14:80588070.
Yasumoto, K., K. Yokoyama, K. Takahashi, Y. Tomita, and S. Shibahara. 1997. Functional analysis of microphthalmia-associated transcription factor in pigment cell-specific transcription of the human tyrosinase family genes. J. Biol. Chem. 272:503509.
This article has been cited by other articles:
| |||||||||||||||||||||||||