|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Article |
Address correspondence to Jennifer Lippincott-Schwartz, Cell Biology and Metabolism Branch, National Institutes of Child Health and Human Development, National Institutes of Health, 18 Library Dr., Bldg. 18T, Rm. 101, Bethesda, MD 20892. Tel.: (301) 402-1010. Fax: (301) 402-0078. email: jlippin{at}helix.nih.gov
| Abstract |
|---|
|
|
|---|
Key Words: endoplasmic reticulum; photobleaching; cytochrome b5; GFP; FRAP
| Introduction |
|---|
|
|
|---|
A striking example of ER differentiation is the conversion of reticular ER into sheets of smooth ER that become tightly stacked into arrays. These can be arranged as stacked cisternae on the outer nuclear envelope (NE; called karmellae; Smith and Blobel, 1994; Parrish et al., 1995; Koning et al., 1996) or be distributed elsewhere in the cell (called lamellae; Porter and Yamada, 1960; Abran and Dickson, 1992; Koning et al., 1996). Alternatively, they can take the form of compressed bodies of packed sinusoidal ER (Anderson et al., 1983), concentric membrane whorls (also called z-membranes in plants; Gong et al., 1996; Koning et al., 1996) or ordered arrays of membrane tubules/sheets with hexagonal or cubic symmetry (called crystalloid ER; Chin et al., 1982; Yamamoto et al., 1996). In all cases, the tripartite junctions of branching ER are scanty or lacking, and the cytoplasmic faces of the proliferated membranes are tightly apposed. EM studies have established that these structures connect to the rest of the ER (Chin et al., 1982; Gong et al., 1996; Yamamoto et al., 1996). Because the structures often appear adjacent to and segueing into each other in the same cell, the structures may represent different stages of smooth ER differentiation (Pathak et al., 1986; Takei et al., 1994). Given that all of these ER structures contain highly ordered smooth ER membranes we refer to them as organized smooth ER (OSER).
OSER structures have been reported in a variety of cells, tissues, and organisms including plants, fungi, and animals under physiological conditions (Porter and Yamada, 1960; Tabor and Fisher, 1983; Yorke and Dickson, 1985; Bassot and Nicola, 1987; Abran and Dickson, 1992; Wolf and Motzko, 1995; Gong et al., 1996), during drug treatments (Chin et al., 1982; Singer et al., 1988; Berciano et al., 2000), or by overexpression of resident ER transmembrane proteins (Wright et al., 1990; Vergeres et al., 1993; Smith and Blobel, 1994; Takei et al., 1994; Ohkuma et al., 1995; Gong et al., 1996; Yamamoto et al., 1996; Sandig et al., 1999). The basis for OSER formation under these conditions is not clear. Protein mutagenesis studies of OSER-inducing proteins, such as HMG CoA reductase, have suggested that the cytoplasmic domain of the protein is important for OSER formation (Profant et al., 1999). Furthermore, the OSER-inducing protein must be anchored to the ER via a transmembrane domain (TMD; Vergeres et al., 1993; Takei et al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001). Therefore, one model for OSER biogenesis is that the cytoplasmic domains of OSER-inducing proteins on apposing membranes bind tightly to each other and "zipper" the apposing membranes together (Takei et al., 1994; Gong et al., 1996; Yamamoto et al., 1996; Fukuda et al., 2001). This model predicts that OSER-inducing proteins residing within OSER structures are tightly bound to each other and do not readily diffuse in and out of these structures.
Here, we have used OSER-inducing proteins, including cytochrome b(5) [b(5)], tagged with GFP to investigate aspects of OSER formation and dynamics in living cells. Our results reveal, contrary to predictions of existing models, that OSER-inducing proteins are not tightly bound to each other within OSER structures and they can readily diffuse in and out of these structures into surrounding reticular ER. Furthermore, time-lapse imaging of OSER biogenesis revealed that these structures formed relatively quickly once a threshold level of OSER-inducing proteins was present within cells and such formation involved gross remodeling of surrounding reticular ER. Finally, attachment of a protein capable of low affinity, head to tail dimerization (i.e., GFP) to the cytoplasmic domain of different resident ER membrane proteins was sufficient to induce OSER formation upon overexpression of the modified proteins in living cells. This suggested that homotypic low affinity interactions between cytoplasmic domains of proteins can differentiate reticular ER into stacked lamellae or crystalloid structures. Such a mechanism may underlie the reorganization of other organelles into stacked structures.
| Results |
|---|
|
|
|---|
|
8 nm for b(5) and
11 nm for GFP-b(5)) that extended throughout the three-dimensional configuration of an OSER, similar to that reported in previous OSER studies (Vergeres et al., 1993; Takei et al., 1994). Based on these results, we concluded that overexpression of b(5) or GFP-b(5) was sufficient to induce the formation of OSER structures.
|
|
0.53-µm diam) using intense laser light (Fig. 4 c). Fluorescence recovery by exchange of bleached for nonbleached protein was monitored using an attenuated laser beam. Notably, fluorescence recovered extremely rapidly into the bleached area at the expense of fluorescence in the nonbleached area of the OSER, as shown in the fluorescent images (Fig. 4 c) or as quantified in a plot of fluorescence recovery (Fig. 4, f and g). Because the prebleach ratio of fluorescence between bleached and nonbleached OSER sectors was reestablished, all GFP-b(5) molecules were highly mobile in OSER structures. These results indicated that GFP-b(5) molecules were not immobilized within OSER structures by tight cross-linking between proteins on adjacent membranes.
|
6 min (Fig. 4 e), indicating that GFP-b(5) readily diffuses into OSER structures from surrounding ER membranes. When all cellular fluorescence outside an OSER was photobleached, subsequent imaging with nonbleaching irradiation revealed the fluorescence within nonbleached OSER structures redistributed into surrounding branching ER over time (unpublished data), which is consistent with free diffusion of GFP-b(5) in and out of OSER structures. Comparable results were observed upon photobleaching other types of OSER structures expressing GFP-b(5), including short karmellae, open loops, and intensely fluorescent clustered nonpolygonal branching ER structures corresponding to sinusoidal or crystalloid ER (unpublished data). We found that the rate of fluorescence recovery into photobleached OSER structures was slower than for photobleached reticular ER of similar size (Fig. 4, f and g, compare curves d and e). This can be explained by the fact that there are substantially fewer branching connections between OSER membranes compared with reticular ER membranes (Fig. 2). Thus, once a protein enters an OSER, it dwells as a freely mobile protein within this structure for significantly longer periods than within other areas of surrounding reticular ER.
The role of protein interactions in OSER formation
These findings prompted us to explore models for OSER biogenesis that did not involve tight cross-linking and zippering of membrane proteins. The first clue favoring an alternative model (Fig. 4 b) was our finding that OSER structures could be generated in cells expressing elevated levels of GFP fused to b(5)'s TMD via a short linker region (GFP-truncated cytochrome b(5) containing amino acids 94134 [b(5) tail]). In this chimera, b(5)'s cytoplasmic, enzymatic domain was removed (Fig. 5 a, GFP-b(5) tail) and GFP and the linker constituted the cytoplasmic domain. Overexpression of the construct in COS-7 cells resulted in the appearance of numerous brightly labeled circular and elongated masses that by EM appeared as membrane whorls and short karmellae, consistent with their being OSER structures (Fig. 5, bd). In addition, another form of smooth ER, anastomosing smooth ER, was sometimes observed in continuity with lamellar ER stacks (Fig. 5 d, inset). These results indicated that the GFP-b(5) tail chimera could function as an OSER-inducing protein.
|
, and a truncated cytochrome P450 containing amino acids 129 (C1(1-29)P450; Szczesna-Skorupa et al., 1998; Fig. 6 a). The two Sec61 components are, like b(5), "tail-anchored" proteins that are posttranslationally inserted into the ER membrane with the COOH terminus in the ER lumen. Note that when overexpressed in cells, neither chimera was found to incorporate into translocons (unpublished data). The C1(1-29)P450 is co-translationally inserted with the NH2 terminus inserted into the ER lumen. Its signal sequence is not cleaved and serves as a TMD (Szczesna-Skorupa et al., 1998).
|
|
|
. GFP-Sec61
was found to be highly mobile within an OSER (Fig. 6 c), as well as within surrounding reticular ER (Fig. 6 d). Moreover, the chimera could readily diffuse into and out of OSER structures (Fig. 6, eg). Thus, after OSER induction, neither GFP-b(5) nor GFP-Sec61
exhibits restricted mobility within membranes comprising OSER structures. Similar results were observed for YFP-Sec61ß and C1(1-29)P450-GFP (unpublished data).
To address what levels of GFP-Sec61
overexpression were necessary for OSER structures to be generated, we quantified the mean fluorescence intensities of expressing cells in which OSER structures were or were not present (100 cells each; Fig. 8). OSER formation occurred in cells with mean fluorescence intensities between three- and ninefold higher than the dimmest visibly expressing cells. Therefore, OSER-inducing proteins must be present at relatively high levels within ER membranes before OSER structures will form within a cell.
|
(mGFP-Sec61
) and C1(1-29)P450 (C1(1-29)P450mGFP) that could not dimerize. First, we checked whether expression levels of the unmutated, dimerizing GFP and mGFP constructs were comparable. Results from immuno-blotting with anti-GFP antibodies confirmed that the mGFP and GFP fusion proteins were indeed expressed at comparable levels in transiently transfected cells (Fig. 9 a). Similar results were obtained for the C1(1-29)P450-GFP and YFP-Sec61ß fusion proteins (unpublished data).
|
, mGFP-Sec61ß, and C1(1-29) P450-mGFP upon expression of the proteins in cells (Fig. 9, b-d, and Table I). At both high and low expression levels, no OSER-like structures were observed. Instead, these proteins were distributed primarily in a normal reticular ER pattern. Often, clustered ER structures of variable fluorescence intensity and size were observed in the highly overexpressing cells (Fig. 9 b, and Table I), but these structures were never organized into stacks or polygonal arrays of tubules. Rather, as shown by EM, these structures consisted of disorganized ribosome-free membrane clusters (Fig. 7, e and f), similar to the anastomosing smooth ER of hepatocytes and steroid-secreting cells (Fawcett, 1981). In addition, the absence of OSER structures in cells expressing mGFP attached to ER resident proteins was not due to a difference in the mobility of the unmutated GFP and mGFP chimeras because the Deff (0.53 ± 0.13 µm2/s, n = 8) of mGFP-Sec61
was not significantly different from that of GFP-Sec61
(Deff = 0.6 ± 0.08 µm2/s, n = 8). These combined results suggested that dimerizing interactions between GFPs attached to the cytoplasmic domains of ER resident proteins are responsible for OSER biogenesis in cells overexpressing these proteins.
OSER formation and dynamics in living cells
To clarify the morphological pathway by which OSER structures are formed, we studied individual COS-7 cells expressing GFP-b(5) tail by time-lapse confocal microscopy from the time the cells had no OSER structures to when they had produced these structures (Fig. 10 a). Before OSER formation, only a fine reticular ER pattern containing GFP-b(5) tail was observed. During the time course of the experiment, the levels of GFP-b(5) tail fluorescence within cells continually increased due to new protein synthesis. When the concentration of GFP-b(5) tail in the cell reached high enough levels, distinct OSER structures emerged overtime periods as short as 1 h (Fig. 10 a). Once their formation was initiated, OSER structures grew brighter and larger with time. This increase in OSER fluorescence intensity was not solely due to new protein synthesis. Concomitant with OSER proliferation, the surface area of branching ER decreased (Fig. 10 a). Similar results were observed for cells expressing other OSER-inducing proteins (unpublished data). These results suggested that the process of OSER formation involves incorporation of preexisting branching ER into stacked structures.
|
| Discussion |
|---|
|
|
|---|
The role of transient weak protein interactions
OSER biogenesis has been viewed up until now as involving tight binding interactions between cytoplasmic domains of ER resident proteins (Takei et al., 1994; Yamamoto et al., 1996; Fukuda et al., 2001). Through such interactions, membranes are thought to zipper up into highly compacted, stacked structures with stable, immobilized components. Evidence against this mechanism came from several findings in our paper. First, photobleaching experiments revealed that OSER-inducing proteins could readily diffuse in and out of OSER structures, so they were not tightly cross-linked to each other or to some type of scaffold. Second, OSER-inducing proteins were not noticeably more enriched than other ER proteins in OSER structures, as would be expected if they formed an immobilized array and excluded other membrane proteins. Third, and most significantly, OSER structures were induced in cells overexpressing chimeras in which GFP, known to undergo weak homodimerization (Zacharias et al., 2002), was attached to the cytoplasmic domains of different ER-retained proteins, including b(5)-tail, Sec61
, Sec61ß, and C1(1-29)P450. And, no OSER structures formed in cells expressing chimeras with an attached GFP containing a mutation abolishing GFP's homodimerizing potential or when dimer-forming GFP was attached to the lumenal domain of a chimera.
These data suggest that weak homodimeric interactions between cytoplasmic domains of ER resident proteins are sufficient for generating OSER structures. However, the OSER-inducing GFP-tagged proteins need to be abundant enough for their interactions to cause ER membranes to rearrange into OSER structures, consisting of stacks with narrow cytoplasmic spacing and few interconnections. Our measurements comparing the fluorescent intensities of cells expressing ER resident proteins with GFP attached to their cytoplasmic domains revealed that cells containing OSER structures typically had three to nine times higher levels of the chimera relative to cells that had no OSER structures. This suggested that a critical level of OSER-inducing proteins in ER membranes must be reached before OSER structures can form within a cell.
The degree of affinity between cytoplasmic domains of OSER-inducing proteins could explain the diversity of OSER structures, with higher affinities leading to the formation of different OSER structures, such as the hexagonal crystalloid ER observed in cells overexpressing HMG-CoA reductase (Chin et al., 1982). Modulation of the affinity between OSER-inducing proteins may also affect the rate of OSER formation. For example, the inositol 1,4,5-trisphosphate receptor (IP3R; Takei et al., 1994) in Purkinje neurons mediates a strikingly rapid formation of lamellar stacks of ER cisternae within minutes of induction of hypoxia. Because IP3R is normally present at high densities in these cells, hypoxia-induced OSER biogenesis may result from an increase in affinity between IP3R molecules due to modifications of IP3R or of other ER-associated proteins.
Not all ER proteins with GFP on their cytoplasmic domain may induce OSER structures, because for a given protein its adjacent protein domains or the rotational mobility of the fused GFP could interfere with dimerization. This would explain why in some studies examining overexpression of ER membrane proteins with cytoplasmically attached GFP, OSER structures were not observed (Li et al., 2003). Furthermore, the added requirement of being at high expression levels and in membranes capable of close apposition could explain why other organelles (i.e., plasma membrane and endosomes) have not been reported to change their morphology upon expression of resident proteins with cytoplasmically attached GFP.
The fact that GFP's dimerizing properties can result in low affinity interactions between proteins that normally do not interact, and such interactions (when frequent enough) can lead to stacking of ER membranes (shown here) or fluorescence energy transfer at the plasma membrane (Zacharias et al., 2002) should serve as a cautionary note for studies using GFP chimeras. To avoid these effects, the use of GFP variants that do not dimerize (Zacharias et al., 2002) is recommended. If dimerizing forms of GFP attached to a protein are used in an experiment, then the fusion protein should only be expressed at low levels. Under these conditions, there is usually no significant difference in the distribution or dynamics of proteins with dimeric GFP versus mGFP attached to their cytoplasmic tail (unpublished data).
Effects of OSER on global ER structure
Within only a few hours after OSER structures began to form in cells overexpressing ER proteins with cytoplasmically attached GFP, we observed that a significant proportion of reticular ER membranes became incorporated into highly compacted OSER membranes (Fig. 10 a). Initially, OSER structures formed at sites adjacent to the NE rather than in other areas of the reticular ER, as found when OSER structures are induced by overexpression of HMG-CoA reductase (Pathak et al., 1986). This could result from the relative stability of ER membranes adjacent to the NE compared with surrounding reticular ER membranes, which are continually remodeling through dynamic tubulation and fusion events. The stability of ER membranes next to the NE would allow surrounding ER cisternae to arrange themselves over time next to this surface due to multiple, transient proteinprotein interactions between these membranes. Once lamellar ER arrays are initiated in this fashion, they could then move away from this surface and serve as their own stable template for further growth of OSER lamellar sheets. This scenario is supported by our live cell imaging of the formation and dynamics of individual OSER structures (Fig. 10 b).
The dynamic process of OSER biogenesis and differentiation, as described in the Results, would not necessarily require the induction of specialized ER stress or lipid biosynthetic pathways, as suggested in previous studies (Block-Alper et al., 2002). Rather, it would require only an abundance of proteins containing a cytoplasmic domain capable of low affinity, antiparallel binding. Consistent with this, we found that overexpressing mGFP attached to the cytoplasmic domain of a nondimerizing ER protein did not induce OSER production. Instead, it led to anastomosing smooth ER proliferation reminiscent of ER specialized for steroid synthesis (i.e., adrenocortical and Leydig cells).
Potential OSER functions
The function of OSER within cells remains to be clarified. Both OSER-forming proteins (Figs. 4 and 6) and non-OSER-forming proteins (unpublished data) dwell for relatively long periods within OSER structures compared with similar sized areas of branching ER due to the limited number of connections between OSER and branching ER. Therefore, reorganization of branching ER into OSER results in the effective compartmentalization of the ER. This could play an important role in sequestering lipophilic drugs away from other organelles or regions of the cytoplasm during detoxification. Furthermore, a potential role for OSER in pathogenesis is raised by the observation that OSER structures can form when mutant membrane proteins accumulate in the ER due to defects in their ability to be exported out of the ER. Examples of this are the pathogenic phenotype observed in a mouse model of Charcot-Marie-Tooth syndrome (Dickson et al., 2002), as well as for early onset torsion dystonia (Hewett et al., 2000).
Implications for biogenesis of other stacked organelles
Our results have implications for mechanisms underlying the stacked morphology of other organelles within cells, such as the Golgi apparatus, thylakoids in chloroplasts, or the myelin sheath formed by Schwann cells around axons. Traditionally, the stacked elements of such structures, in particular the Golgi apparatus, has been viewed as requiring a specific matrix or glue for holding them together (Cluett and Brown, 1992; Barr et al., 1997). Our finding that dynamic tubular elements of the ER can convert into stacked ER cisternae through transient low affinity interactions between the cytoplasmic domains of proteins on apposing ER membranes raises the possibility that the stacking of Golgi membranes or other organelles occurs by a similar mechanism. Consistent with this, several features of Golgi morphology resemble OSER structures. First, certain Golgi proteins (i.e., GRASP65) form transoligomers in the cytoplasm that appear to be sufficient for mediating Golgi stacking (Wang et al., 2003). Second, Golgi cisternae are separated by a uniformly narrow cytoplasmic space (Cluett and Brown, 1992) and are not connected along their surface (Ladinsky et al., 1999). Finally, Golgi resident components undergo rapid lateral diffusion (Cole et al., 1996). These similarities with OSER structures raise the possibility that weak transient interactions between proteins on apposing membranes provide a general mechanism for the formation of stacked organelle structures.
| Materials and methods |
|---|
|
|
|---|
and YFP-Sec61ß were derived from the ORF for human Sec61
and Sec61ß amplified from a human brain cDNA library (CLONTECH Laboratories, Inc.) and inserted into the pCR cloning vector (Invitrogen) and verified by automated sequencing. The Sec61
ORF was excised from the pCR cloning vector and inserted into pEGFP-C1 (CLONTECH Laboratories, Inc.). The excised Sec61
fragment was ligated to the vector to produce the GFP-Sec61
fusion. Sec61ß was excised from pCR and inserted into pEYFP-C1 to produce the YFP-Sec61ß fusion. The cDNA coding for rabbit b(5) in the mammalian expression vector pCB6 has been described previously (Pedrazzini et al., 1996). The GFP-b(5) tail construct is also described in previous publications (referred to as GFP-ER [Borgese et al., 2001] and as GFP-17 [Bulbarelli et al., 2002]). C1(1-29)P450 GFP has been described previously (Szczesna-Skorupa et al., 1998) and was a gift from B. Kemper (College of Medicine at Urbana-Champaign, University of Illinois, Urbana, IL).
For GFP-b(5), EGFP was fused at its COOH terminus via the same linker as above to the sequence coding for the entire ER isoform (minus the first two residues) of rabbit b(5) (GFP-b(5)). The EGFP plus linker fragment was derived from GFP-b(5) tail. The coding sequence of b(5) was obtained by digestion of pGb(5)AX (Pedrazzini et al., 2000). The GFP-linker fragment was ligated with the b(5) fragment into the modified pCB6 vector (De Silvestris et al., 1995).
mGFP forms of the fusion proteins were created by site-directed mutagenesis using reverse (GGTCACGAACTCCTTAAGGACCATGTGATC) and forward primers (GATCACATGGTCCTTAAGGAGTTCGTGACC). Mutagenesis was performed using the Quickchange kit from Stratagene as recommended by the manufacturer. The primers convert leucine 221 to lysine and introduce a new restriction site, Afl2, with a silent mutation for ease of screening mutants.
We confirmed that the constructs in this work localized to the ER by performing immunofluorescence with antibodies against several different ER marker proteins.
Cell culture and transfection
COS-7 and CV-1 cells were grown in DME (Biofluids, Inc.) supplemented with FBS, glutamate, penicillin, and streptomycin. Transient transfections were performed using FuGENE 6 transfection reagent according to the manufacturer's instructions (Roche) or by the Ca2PO4 method (Graham and van der Eb, 1973). Cells were analyzed 1648 h after transfection.
Antibodies
The polyclonal rabbit antibody against Sec61ß was prepared (Lampire Biological Laboratories) against the synthetic peptide PGPTPSGTNC (residues 210 plus a cysteine) of canine Sec61ß conjugated to keyhole limpet hemocyanin using standard protocols. Other antibodies used include polyclonal antirat b(5) (Borgese et al., 2001), monoclonal anti-GFP (JL-8) (CLONTECH Laboratories, Inc.), polyclonal anticalreticulin and antiprotein disulfide isomerase (Affinity BioReagents, Inc.), polyclonal antibody anticalnexin (StressGen Biotechnologies) and antirabbit IgG labeled with Alexa 546 (Molecular Probes).
Immunoblotting
Separation of proteins by SDS-PAGE was on 12% Tris-tricine gels. Immunoblotting was performed after transfer to nitrocellulose. The blot was developed with SuperSignal ECL reagents from Pierce Chemical Co. Autoradiographs made on film (BioMax; Kodak) were digitized for display in the figures (prepared using Photoshop and Illustrator software from Adobe Systems Inc.).
EM
For EM, cells were fixed as a monolayer in 2% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4, for 30 min, scraped, and collected as a pellet, supplemented with fresh fixative and left overnight at 4°C. The cells were further fixed with osmium tetroxide and embedded in epon by standard procedures. Lead citrate stained thin sections were observed under a transmission electron microscope (model CM10; Philips).
Immunofluorescence and photobleaching experiments
For immunofluorescence experiments, cells were fixed with formaldehyde, permeabilized with 0.2% Triton X-100, and incubated with antibodies as described in previous publications (Cole et al., 1998). Fixed and live cells were imaged on a temperature controlled stage of a confocal microscope system (model LSM 510; Carl Zeiss MicroImaging, Inc.) using the 488-nm line of a 40-mW Ar/Kr laser for GFP or the 514-nm line of the same laser for YFP with either a 63x 1.2 NA water or a 63x 1.4 NA oil objective.
Qualitative FRAP experiments were performed by photobleaching a region of interest at full laser power and monitoring fluorescence recovery by scanning the whole cell at low laser power. No photobleaching of the cell or adjacent cells during fluorescence recovery was observed.
Fluorescence recovery plots and diffusion (Deff) measurements were obtained by photobleaching a 4-µm-wide strip as described previously (Ellenberg et al., 1997; Siggia et al., 2000). Deff was determined using an inhomogeneous diffusion simulation program written by Eric Siggia (Siggia et al., 2000). To create the fluorescence recovery curves, the fluorescence intensities were transformed into a 0100% scale in which the first postbleach time point equals 0% recovery and the recovery plateau equals 100% recovery. The plots do not represent the mobile fraction of the GFP chimeras. The mobile fraction was calculated by comparing the photobleach corrected prebleach and postbleach recovery fluorescence intensity values in the photobleached region of interest as described previously (Ellenberg et al., 1997). Image analysis was performed using NIH Image 1.62 and LSM image examiner software. Composite figures were prepared using Photoshop 5.5 and Illustrator 9.0 software (both from Adobe). Fluorescence recovery curves were plotted using Kaleidagraph 3.5 (Synergy Software).
| Acknowledgments |
|---|
Work in the laboratory of Nica Borgese was supported by grants from the Associazione Italiana per la Ricerca sul Cancro, the Ministero per la Università e Ricerca (COFIN 2001), and the Ministero per la Sanità (Amyotrophic Lateral Sclerosis grant 2002). Erik Snapp was a Pharmacology and Research Training Fellow during the course of these studies.
Submitted: 4 June 2003
Accepted: 27 August 2003
| References |
|---|
|
|
|---|
Abran, D., and D.H. Dickson. 1992. Biogenesis of myeloid bodies in regenerating newt (Notophthalmus viridescens) retinal pigment epithelium. Cell Tissue Res. 268:531538.[CrossRef][Medline]
Anderson, R.G., L. Orci, M.S. Brown, L.M. Garcia-Segura, and J.L. Goldstein. 1983. Ultrastructural analysis of crystalloid endoplasmic reticulum in UT-1 cells and its disappearance in response to cholesterol. J. Cell Sci. 63:120.[Abstract]
Barr, F., M. Puype, J. Vandekerckhove, and G. Warren. 1997. GRASP65, a protein involved in the stacking of Golgi cisternae. Cell. 91:253262.[CrossRef][Medline]
Bassot, J.M., and G. Nicola. 1987. An optional dyadic junctional complex revealed by fast-freeze fixation in the bioluminescent system of the scale worm. J. Cell Biol. 105:22452256.
Baumann, O., and B. Walz. 2001. Endoplasmic reticulum of animal cells and its organization into structural and functional domains. Int. Rev. Cytol. 205:149214.[Medline]
Berciano, M.T., R. Fenandez, E. Pena, E. Calle, N.T. Villagra, J.C. Rodriguez-Rey, and M. Lafarga. 2000. Formation of intranuclear crystalloids and proliferation of the smooth endoplasmic reticulum in Schwann cells induced by tellurium treatment: association with overexpression of HMG CoA reductase and HMG CoA synthase mRNA. Glia. 29:246259.[CrossRef][Medline]
Block-Alper, L., P. Webster, X. Zhou, L. Supekova, W.H. Wong, P.G. Schultz, and D.I. Meyer. 2002. INO2, a positive regulator of lipid biosynthesis, is essential for the formation of inducible membranes in yeast. Mol. Biol. Cell. 13:4051.
Bonifacino, J., and J. Lippincott-Schwartz. 2003. Coat proteins: shaping membrane transport. Nat. Rev. Mol. Cell Biol. 4:409414.[CrossRef][Medline]
Borgese, N., I. Gazzoni, M. Barberi, S. Colombo, and E. Pedrazzini. 2001. Targeting of a tail-anchored protein to endoplasmic reticulum and mitochondrial outer membrane by independent but competing pathways. Mol. Biol. Cell. 12:24822496.
Bulbarelli, A., T. Sprocati, M. Barberi, E. Pedrazzini, and N. Borgese. 2002. Trafficking of tail-anchored proteins: transport from the endoplasmic reticulum to the plasma membrane and sorting between surface domains in polarised epithelial cells. J. Cell Sci. 115:16891702.
Chin, D.J., K.L. Luskey, R.G. Anderson, J.R. Faust, J.L. Goldstein, and M.S. Brown. 1982. Appearance of crystalloid endoplasmic reticulum in compactin-resistant Chinese hamster cells with a 500-fold increase in 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Proc. Natl. Acad. Sci. USA. 79:11851189.
Cluett, E., and W. Brown. 1992. Adhesion of Golgi cisternae by proteinaceous interactions: intercisternal bridges as putative adhesive structures. J. Cell Sci. 103:773784.[Abstract]
Cole, N.B., C.L. Smith, N. Sciaky, M. Terasaki, M. Edidin, and J. Lippincott-Schwartz. 1996. Diffusional mobility of Golgi proteins in membranes of living cells. Science. 273:797801.[Abstract]
Cole, N.B., J. Ellenberg, J. Song, D. DiEuliis, and J. Lippincott-Schwartz. 1998. Retrograde transport of Golgi-localized proteins to the ER. J. Cell Biol. 140:115.
De Silvestris, M., A. D'Arrigo, and N. Borgese. 1995. The targeting information of the mitochondrial outer membrane isoform of cytochrome b5 is contained within the carboxyl-terminal region. FEBS Lett. 370:6974.[CrossRef][Medline]
Dickson, K.M., J.J. Bergeron, I. Shames, J. Colby, D.T. Nguyen, E. Chevet, D.Y. Thomas, and G.J. Snipes. 2002. Association of calnexin with mutant peripheral myelin protein-22 ex vivo: a basis for "gain-of-function" ER diseases. Proc. Natl. Acad. Sci. USA. 99:98529857.
Ellenberg, J., E.D. Siggia, J.E. Moreira, C.L. Smith, J.F. Presley, H.J. Worman, and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. J. Cell Biol. 138:11931206.
Fawcett, D.W. 1981. The Cell. W.B. Saunders Co., Philadelphia. 827 pp.
Fukuda, M., A. Yamamoto, and K. Mikoshiba. 2001. Formation of crystalloid endoplasmic reticulum induced by expression of synaptotagmin lacking the conserved WHXL motif in the C terminus. J. Biol. Chem. 276:4111241119.
Gong, F.C., T.H. Giddings, J.B. Meehl, and L.A. Staehelin. 1996. Z-membranes: artificial organelles for overexpressing recombinant integral membrane proteins. Proc. Natl. Acad. Sci. USA. 93:22192223.
Graham, F.L., and A.J. van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 52:456467.[CrossRef][Medline]
Hewett, J., C. Gonzalez-Agosti, D. Slater, P. Ziefer, S. Li, D. Bergeron, D.J. Jacoby, L.J. Ozelius, V. Ramesh, and X.O. Breakefield. 2000. Mutant torsinA, responsible for early-onset torsion dystonia, forms membrane inclusions in cultured neural cells. Hum. Mol. Genet. 9:14031413.
Koning, A.J., C.J. Roberts, and R.L. Wright. 1996. Different subcellular localization of Saccharomyces cerevisiae HMG-CoA reductase isozymes at elevated levels corresponds to distinct endoplasmic reticulum membrane proliferations. Mol. Biol. Cell. 7:769789.[Abstract]
Ladinsky, M., D. Mastronarde, J. McIntosh, K. Howell, and L.A. Staehelin. 1999. Golgi structure in three dimensions: functional insights from the normal rat kidney cell. J. Cell Biol. 144:11351149.
Lee, C., and L.B. Chen. 1988. Dynamic behavior of endoplasmic reticulum in living cells. Cell. 54:3746.[CrossRef][Medline]
Li, Y., D. Dinsdale, and P. Glynn. 2003. Protein domains, catalytic activity, and subcellular distribution of neuropathy target esterase in mammalian cells. J. Biol. Chem. 278:88208825.
Lippincott-Schwartz, J., E.L. Snapp, and A. Kenworthy. 2001. Studying protein dynamics in living cells. Nat. Rev. Mol. Cell Biol. 2:444456.[CrossRef][Medline]
Ohkuma, M., S.M. Park, T. Zimmer, R. Menzel, F. Vogel, W.H. Schunck, A. Ohta, and M. Takagi. 1995. Proliferation of intranuclear membrane structures upon homologous overproduction of cytochrome P-450 in Candida maltosa. Biochim. Biophys. Acta. 1236:163169.[Medline]
Orrenius, S., and J.L. Ericsson. 1966. Enzyme-membrane relationship in phenobarbital induction of synthesis of drug-metabolizing enzyme system and proliferation of endoplasmic reticulum. J. Cell Biol. 28:181198.
Parrish, M.L., C. Sengstag, J.D. Rine, and R.L. Wright. 1995. Identification of the sequences in HMG-CoA reductase required for karmellae assembly. Mol. Biol. Cell. 6:15351547.[Abstract]
Pathak, R.K., K.L. Luskey, and R.G.W. Anderson. 1986. Biogenesis of the crystalloid endoplasmic reticulum in UT-1 cells: evidence that newly formed endoplasmic reticulum emerges from the nuclear envelope. J. Cell Biol. 102:21582168.
Pedrazzini, E., A. Villa, and N. Borgese. 1996. A mutant cytochrome b5 with a lengthened membrane anchor escapes from the endoplasmic reticulum and reaches the plasma membrane. Proc. Natl. Acad. Sci. USA. 93:42074212.
Pedrazzini, E., A. Villa, R. Longhi, A. Bulbarelli, and N. Borgese. 2000. Mechanism of residence of cytochrome b(5), a tail-anchored protein, in the endoplasmic reticulum. J. Cell Biol. 148:899913.
Porter, K.R., and E. Yamada. 1960. Studies on the endoplasmic reticulum: V. Its form and differentiation in pigment epithelial cells of the frog retina. J. Biophys. Biochem. Cyt. 8:181205.
Profant, D.A., C.J. Roberts, A.J. Koning, and R.L. Wright. 1999. The role of the 3-hydroxy 3-methylglutaryl coenzyme A reductase cytosolic domain in karmellae biogenesis. Mol. Biol. Cell. 10:34093423.
Sandig, G., E. Kargel, R. Menzel, F. Vogel, T. Zimmer, and W.H. Schunck. 1999. Regulation of endoplasmic reticulum biogenesis in response to cytochrome P450 overproduction. Drug Metab. Rev. 31:393410.[CrossRef][Medline]
Seemann, J., E. Jokitalo, M. Pypaert, and G. Warren. 2000. Matrix proteins can generate the higher order architecture of the Golgi apparatus. Nature. 407:10221026.[CrossRef][Medline]
Siggia, E.D., J. Lippincott-Schwartz, and S. Bekiranov. 2000. Diffusion in a inhomogeneous media: theory and simulations applied to a whole cell photobleach recovery. Biophys. J. 79.
Singer, I.I., S. Scott, D.M. Kazazis, and J.W. Huff. 1988. Lovastatin, an inhibitor of cholesterol synthesis, induces hydroxymethylglutaryl-coenzyme A reductase directly on membranes of expanded smooth endoplasmic reticulum in rat hepatocytes. Proc. Natl. Acad. Sci. USA. 85:52645268.
Smith, S., and G. Blobel. 1994. Colocalization of vertebrate lamin B and lamin B receptor (LBR) in nuclear envelopes and in LBR-induced membrane stacks of the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA. 91:1012410128.
Szczesna-Skorupa, E., C. Chen, S. Rogers, and B. Kemper. 1998. Mobility of cytochrome P450 in the endoplasmic reticulum membrane. Proc. Natl. Acad. Sci. USA. 95:1479314798.
Tabor, G.A., and S.K. Fisher. 1983. Myeloid bodies in the mammalian retinal pigment epithelium. Invest. Ophthalmol. Vis. Sci. 24:388391.
Takei, K., G.A. Mignery, E. Mugnaini, T.C. Sudhof, and P. De Camilli. 1994. Inositol 1,4,5-trisphosphate receptor causes formation of ER cisternal stacks in transfected fibroblasts and in cerebellar Purkinje cells. Neuron. 12:327342.[CrossRef][Medline]
Vale, R. 2003. The molecular motor toolbox for intracellular transport. Cell. 112:467480.[CrossRef][Medline]
Vergeres, G., T.S. Benedict Yen, J. Aggeler, J. Lausier, and L. Waskell. 1993. A model system for studying membrane biogenesis: overexpression of cytochrome b5 in yeast results in marked proliferation of the intracellular membrane. J. Cell Sci. 106:249259.[Abstract]
Wang, Y., J. Seemann, M. Pypaert, J. Shorter, and G. Warren. 2003. A direct role for GRASP65 as a mitotically regulated Golgi stacking factor. EMBO J. 22:32793290.