|
|
|
|
|
|
|
||
Report |
Address correspondence to Patrick Doherty, Molecular Neurobiology Group, Medical Research Council Center for Developmental Neurobiology, New Hunt's House, King's College London, London Bridge, London SE1 1UL, UK. Tel.: 44-207-848-6813. Fax: 44-207-848-6816. email: patrick.doherty{at}kcl.ac.uk; or Vincenzo Di Marzo, Endocannabinoid Research Group, Istituto di Chimica Biomolecolare, Consiglio Nazionale delle Ricerche, Via Campi Flegrei 34, Comprensorio Olivetti, 80078 Pozzuoli, Italy. Tel.: 39-081-8675093. Fax: 39-081-8041770. email: vdimarzo{at}icmib.na.cnr.it
 |
Abstract |
|---|
 Top Abstract IntroductionResults and discussionMaterials and methodsReferences |
|---|
Key Words: diacylglycerol lipase; CB1 receptor; anandamide; axonal growth; synaptic plasticity
Abbreviations used in this paper: 2-AG, 2-arachidonoyl-glycerol; BDNF, brain-derived neuronotrophic factor; DAGL, DAG lipase; THL, tetrahydrolipstatin.
|
Introduction |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
|
Results and discussion |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
and ß) are identified as the only homologues (Fig. 1 a). The encoded gene products are 1,042 () and 672 (ß) amino acids in length and show extensive homology throughout, but differ in the length of the sequence that follows the catalytic domain (Fig. 1 a). Both proteins contain a lipase-3 motif and a serine lipase motif, and they are predicted to have four transmembrane-spanning domains with the catalytic domain and amino terminus inside of the cell (Fig. 1 a). The genes are found in a wide range of species (e.g., chickens, zebrafish, and mice) with a high degree of conservation between man and mouse (97% identity for and 79% for ß; unpublished data).
|
70 kD for the ß gene and 120 kD for the gene) with protein expression localized to the plasma membrane (Fig. 1, b and c). COS cells expressing the highest levels of the gene products (clones 12 and 15ß) were selected for enzymatic characterization with a clone that expressed no detectable transgene taken as a control (clone 7ß; Fig. 1 b). When using sn-1-stearoyl-2-[14C]arachidonoyl-glycerol as a substrate, and measuring the 2-[14C]AG released, we confirmed that both enzymes are mostly expressed in the 10,000 g membrane fraction (Fig. 2 a), exhibit optimal activity at pH 7 (not depicted), and follow Michaelis–Menten kinetics, with Km values in the range of the possible concentrations of DAGs in animal tissues (154.7 ± 19.1 and 74.1 ± 4.9 µM for the and ß form, respectively; Fig. 2 b). Both enzymes exhibit very little, if any, monoacylglycerol lipase, phospholipase A1/A2, triacylglycerol lipase, and anandamide amidase activity (unpublished data). To investigate their substrate selectivity, three types of radiolabeled DAG substrates were synthesized. A three- to eightfold selectivity for the sn-1 over the sn-2 position of DAGs (Fig. 2 c) was demonstrated by comparing the rate of the formation of [14C]oleic acid and sn-1-[14C]oleoyl-glycerol from sn-1-[14C]oleoyl-2-oleoyl-glycerol; or by comparing the rate of the formation of mono[14C]oleoyl-glycerol from either sn-1-[14C]oleoyl-2-oleoyl-glycerol or sn-1-oleoyl-2-[14C]oleoyl-glycerol. The similar activities of the enzymes observed when using as substrates either sn-1-[14C]oleoyl-2-arachidonyl glyceryl ether, which cannot be hydrolyzed on the 2 position, or sn-1-[14C]oleoyl-2-arachidonoyl glycerol, further demonstrates that the two lipases are selective for the sn-1 position of DAGs. Of the two enzymes, the ß form appears to prefer sn-1-oleoyl-2 acyl-glycerols with linoleic 
oleic > arachidonic > stearic acid on the 2 position, whereas the form appears to work equally well with all fatty acids (Fig. 2 d and not depicted). Both enzymes are equally sensitive to Ser/Cys-hydrolase inhibitors such as p-hydroxy-mercuri-benzoate and HgCl2, but not to PMSF. Importantly, both enzymes are inhibited by RHC80267, a drug that blocks 2-AG formation from intact cells (Bisogno et al., 1997; Stella et al., 1997). Glutathione and Ca2+ stimulate both enzymes (Fig. 2 e). Based on homology with other serine lipases, two of the three amino acids that likely constitute the "catalytic triad" can readily be identified as serine 443 and aspartic acid 495 in the ß form of the enzyme (Fig. 1 a). Accordingly, substitution of the serine (clone 11-11ß) or aspartic acid (clone 3-9ß) with alanines abolished enzymatic activity (Fig. 2 a). Based on these results, we can conclude that the products of the genes are specific sn-1-DAGLs; therefore, we designate them as DAGL and DAGLß.
|
or 15ß cells led to the production, and release into the media, of significantly higher amounts of 2-AG than control COS cells (Fig. 2 f). A strong correlation between the expression of the novel genes and endogenous DAGL activity was found in a wide range of cell types (e.g., N18TG2 neuroblastoma, C6 glioma, RBL-2H3 basophilic leukemia, human Caco-2, and embryonic kidney HEK-293 cells; unpublished data). More importantly, tetrahydrolipstatin (THL), a second DAGL inhibitor (Lee et al., 1995), potently inhibited both DAGL and DAGLß from clone 12 and 15ß cell homogenates (IC50 = 60 and 100 nM, respectively). THL (5-min preincubation at 1 µM) also decreased the ionomycin-induced release of 2-AG from intact N18TG2, C6, and RBL-2H3 cells (66.7 ± 5.9, 93.5 ± 7.3, and 99.2 ± 10.1% inhibition, respectively; means ± SEM, n = 3, P < 0.01), as well as in clone 12 (Fig. 2 f). FGF2 stimulates neurite outgrowth from cerebellar neurons via a pathway that requires DAGL activity to generate 2-AG and the consequent activation of the CB1 receptor (Williams et al., 2003). THL inhibited the neurite outgrowth stimulated by FGF2 with no effect on the response stimulated by a CB1 agonist or brain-derived neuronotrophic factor (BDNF; Fig. 3), demonstrating that it is acting specifically, and upstream of the CB1 receptor, in the FGF signaling pathway. Thus, the novel enzymes make and release 2-AG as endocannabinoid, and THL is a useful tool to investigate the cellular function of the two enzymes.
|
and ß showed the same qualitative staining pattern, demonstrating that they are normally coexpressed; and similar staining patterns were seen with three independent antisera to DAGL (unpublished data). We found that all developing axonal tracts examined coexpress the enzymes. For example, in the mouse at embryonic day 10, DAGL and DAGLß are expressed in axons crossing the floor plate of the spinal cord (Fig. 4, a–c). At day 14, DAGLß can be seen to specifically label the retinal ganglion fiber tract and also the optic nerve (Fig. 4 d). A similar, but less pronounced, staining was seen for DAGL (unpublished data). Remarkably, both enzymes are absent from axonal tracts in the adult mouse brain, with this shown for DAGL in the optic and anterior commissures in Fig. 4, e and f. This contrasted with the very strong staining of both regions with antibodies to the CB1 receptor (Fig. 4, g and h). In the cerebellum, the highest levels of DAGL and DAGLß are seen in the dendritic field with staining also apparent in the deep cerebellar nuclei (Fig. 4, i and j); however, both enzymes are again absent in the axonal tracts. A high power image of DAGL expression within the Purkinje cell dendritic field of the cerebellum clearly shows that the enzyme is specifically expressed in the tubular-like structures that characterize the dendritic tree of the Purkinje cell (Fig. 4 k). The staining for DAGLß was qualitatively similar but considerably less pronounced than that for DAGL (Fig. 4, i and j), suggesting a substantial down-regulation of the ß form of the enzyme during development. Given the maintained expression of high levels of DAGL in the adult nervous system, we assessed the relative level of transcripts for the gene in various adult tissues in the mouse and human by TaqMan RT-PCR. In the mouse, the highest levels of transcripts were found in the nervous system, with barely detectable levels found in the skin, heart, lung, and various other tissues (Fig. 5), which is in agreement with the highest relative abundance of 2-AG and other 2-acylglycerols in the rodent brain (Kondo et al., 1998). In the human, high levels of expression were again found in the brain, relative to most tissues, with high levels also noted in the pancreas (Fig. 5). The pancreatic expression is of interest given the established role for DAGL activity in amylase secretion in this tissue (Hou et al., 1997).
|
|
|
Materials and methods |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
gene (gi|20521122) was obtained from the Kazusa DNA Research Institute (KIAA0659), and the mouse ß gene (gi|16359288) was obtained from I.M.A.G.E. Consortium (4921222). The coding sequence for the gene was amplified by PCR and inserted into pcDNA3.1D/V5-His-TOPO (Invitrogen) to generate an expression construct with an in-frame 3' V5 epitope tag. The coding sequence for the ß gene was amplified by PCR and subcloned into pCMV-Tag4A (Stratagene) using the NotI and XhoI restriction sites, in-frame with a 3' FLAG epitope tag. Single point mutations in the ß gene were generated using the QuikChange Site-Directed Mutagenesis kit (Stratagene). Plasmids were transfected into COS-7 cells using lipofectamine plus (Invitrogen), and stable transfected clones were selected using G418. For Western blotting, equal amounts of protein lysate were separated on SDS–polyacrylamide gels and transferred to nitrocellulose Hybond ECL (Amersham Biosciences). Primary antibodies used were mouse anti-V5 (Invitrogen) at 1:5,000 and mouse anti-Flag (Stratagene) at 1:1,000. The secondary antibody was anti–mouse HRP (Vector Laboratories) used at 1:3,000.
Synthesis of substrates
In brief, the compounds were obtained from the R (-) solketal esterified with either unlabeled or 14C-labeled oleic acid using N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride/4-dimethylaminopyridin, and deprotecting the acetonide with hydrochloride/methanol. The primary alcoholic group was protected selectively with triisopropylsilyl chloride, whereas the free secondary alcohol was esterified with various fatty acids, either unlabeled or 14C-labeled. Finally, the sn-1,2-diacyl-glycerol with two different acyl groups in position sn-1 and 2 was obtained by removing selectively the sylyl group with tetrabutylammonium fluoride/acetic acid. To prepare sn-1-[14C]oleoyl-2-arachidonyl glyceryl ether, the previously prepared 2-AG ether (noladin) was esterified with [14C]oleic acid using N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride /4-dimethylaminopyridin. 2-[3H]arachidonoyl-glycerol and arachidonoyl-[14C]ethanol-amide were synthesized as described previously (Bisogno et al., 1997) with minor modifications.
Enzyme assays
Confluent cells were harvested in Tris-HCl buffer, pH 7, and homogenized in a homogenizer (Dounce). The homogenates were centrifuged at 4°C sequentially at 800 g (5 min), 10,000 g (25 min), and 100,000 g (70 min). Each fraction or, for most of the experiments, the 10,000-g fraction was incubated at pH 7.0 (or in citrate 50 mM or Tris-HCl 50 mM buffers at different pH values) at 37°C for 15 min, with different radiolabeled substrates (i.e., for DAGL activity, with various synthetic 14C-labeled DAGs [1.0 mCi/mmol, 50 µM] or with sn-1-stearoyl-2-[14C]arachidonoyl-glycerol from Amersham Biosciences, 56.0 mCi/mmol, at different concentrations; for monoacylglycerol lipase activity, with synthetic 2-[3H]arachidonoyl-glycerol, 1.0 mCi/mmol, 50 µM; for triacylglycerol lipase activity, with 1,2,3-tri-[14C]oleoyl-glycerol from NEN, 100.0 mCi/mmol, 50 µM; for phospholipase A1/A2 activity, or sn-1-[14C]oleoyl-2-[14C]oleoyl-phosphatidylcholine from NEN, 104.0 mCi/mmol, 20 µM; and for fatty acid amide hydrolase activity, with synthetic arachidonoyl-[14C]ethanolamide, 5.0 mCi/mmol, 25 µM). After the incubation, lipids were extracted three times with 2 vol chloroform/methanol 2:1 (by vol), and the extracts were lyophilized under vacuum. Extracts were fractionated by TLC on silica on polypropylene plates using chloroform/methanol/NH4OH (85:15:0.1, by vol) as the eluting system. Under these conditions, the migration index of free fatty acids, monoacylglycerols, and diacylglycerols was 0.25, 0.65, and 0.9, respectively; the migration index of phospholipids and triacylglycerols was 0.05 and 1.0, respectively. Bands corresponding to each class of lipids were cut, and their radioactivity was counted with a ß-counter. Using sn-1-stearoyl-2-[14C]arachidonoyl-glycerol as the substrate, the DAGL reaction rate was linear up to 20 min and reached a plateau after 30 min, with both DAGL and ß. Saturation of DAGL and ß activity was reached with 500 and 400 µM, respectively, when using sn-1-stearoyl-2-[14C]arachidonoyl-glycerol as the substrate.
Intact cell stimulation and 2-AG analyses
Confluent cells were stimulated for 20 min at 37°C with either vehicle or 4 µM ionomycin or 1 µM ionomycin + THL, after a 5-min preincubation, with THL in DME medium without serum. Immediately after the stimulation, cells, medium, or cells plus medium were extracted three times with 2 vol chloroform/methanol 2:1 (by vol), and the extracts were lyophilized under vacuum. Each extract was purified by open bed chromatography over silica columns, followed by 2-AG quantification by means of isotope dilution atmospheric pressure chemical ionization–liquid chromatography–mass spectrometry (Marsicano et al., 2002).
Immunohistochemistry
Rabbit antibodies, raised and affinity purified against the GASPTKQDDLVISAR epitope in DAGL, and the SSDSPLDSPTKYPTL epitope in DAGLß, were used at 1.5–3.0 µg/ml for immunostaining. An affinity-purified antibody against the CB1 receptor (PA1-745; Affinity BioReagents, Inc.) was used at 20 µg/ml IgG. An antineurofilament monoclonal antibody (N5264; Sigma-Aldrich) was used at a dilution of 1:1,000. 6-µm sections of formalin-fixed, paraffin wax–embedded tissues were subjected to heat-mediated antigen retrieval to disclose antigenic sites before being incubated in primary antibody solutions overnight at 4°C. After washing, the sections were incubated with biotinylated secondary antibodies (E0432 and E0433; Dakopatts) followed by detection with an HRP-streptavidin-biotin kit (model K377; Dakopatts). To visualize the V5 epitope tag, cells were fixed with 4% PFA and processed for indirect immunofluorescence. Cells were permeabilized with 0.2% Triton X-100/PBS and stained with mouse anti-V5 primary antibody at 1:200, followed by Alexa Fluor 488 goat anti–mouse IgG secondary (Molecular Probes) at 1:2,000. Slides were viewed on a microscope (model Axiovert 135; Carl Zeiss MicroImaging, Inc.), using 10x/0.25 Achrostigmat or 63x/1.4 Oil Pan-Apochromat lens. Images were captured with an AxioCam using KS300 software (Carl Zeiss MicroImaging, Inc.). Images were processed in Adobe Photoshop, with brightness and contrast being the only adjustments made.
Neurite outgrowth studies
Neurite outgrowth studies and reagents used therein were as described previously (Williams et al., 2003).
Real-time RT-PCR analysis of DAGL expression in various tissues
TaqMan RT-PCR for DAGL was performed essentially as described previously (Bond et al., 2002). Primers were based on sequences encoded by exon 19; for the mouse, the forward and reverse primers were ttcgccgagttcattgacag and tctcaggcaccatcatgca. For the human, the forward and reverse primers were cctcttcaacctggacagcaa and gggccctcagcgtagtca. To normalize data and to correct for variations in RNA and/or cDNA quality and quantity, parallel TaqMan assays were run for two housekeeping genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and ß-actin.
|
Acknowledgments |
|---|
This work was supported by the Wellcome Trust, Volkswagen Stiftung, Italian Ministry of Education, University and Research (Fondo per gli Investimenti della Ricerca di Base), and the UK Medical Research Council. A Human Frontier in Science Program Organization fellowship partly supported T. Bisogno.
Submitted: 28 May 2003
Accepted: 24 September 2003
|
References |
|---|
|
TopAbstractIntroductionResults and discussionMaterials and methodsReferences |
|---|
Bisogno, T., N. Sepe, D. Melck, S. Maurelli, L. De Petrocellis, and V. Di Marzo. 1997. Biosynthesis, release and degradation of the novel endogenous cannabimimetic metabolite 2-arachidonoylglycerol in mouse neuroblastoma cells. Biochem. J. 322:671–677.
Bond, B.C., D.J. Virley, N.J. Cairns, A.J. Hunter, G.B. Moore, S.J. Moss, A.W. Mudge, F.S. Walsh, E. Jazin, and P. Preece. 2002. The quantification of gene expression in an animal model of brain ischaemia using TaqMan real-time RT-PCR. Brain Res. Mol. Brain Res. 106:101–116.[Medline]
Brittis, P.A., J. Silver, F.S. Walsh, and P. Doherty. 1996. Fibroblast growth factor receptor function is required for the orderly projection of ganglion cell axons in the developing mammalian retina. Mol. Cell. Neurosci. 8:120–128.
Diana, M.A., C. Levenes, K. Mackie, and A. Marty. 2002. Short-term retrograde inhibition of GABAergic synaptic currents in rat Purkinje cells is mediated by endogenous cannabinoids. J. Neurosci. 22:200–208.
Di Marzo, V., D. Melck, T. Bisogno, and L. De Petrocellis. 1998. Endocannabinoids: endogenous cannabinoid receptor ligands with neuromodulatory action. Trends Neurosci. 21:521–528.[CrossRef][Medline]
Di Marzo, V., M.P. Hill, T. Bisogno, A.R. Crossman, and J.M. Brotchie. 2000. Enhanced levels of endogenous cannabinoids in the globus pallidus are associated with a reduction in movement in an animal model of Parkinson's disease. FASEB J. 14:1432–1438.
Di Marzo, V., S.K. Goparaju, L. Wang, J. Liu, S. Batkai, Z. Jarai, F. Fezza, G.I. Miura, R.D. Palmiter, T. Sugiura, and G. Kunos. 2001. Leptin-regulated endocannabinoids are involved in maintaining food intake. Nature. 410:822–825.[CrossRef][Medline]
Hou, W., Y. Arita, and J. Morisset. 1997. Endogenous arachidonic acid release and pancreatic amylase secretion. Pancreas. 14:301–308.[Medline]
Kondo, S., H. Kondo, S. Nakane, T. Kodaka, A. Tokumura, K. Waku, and T. Sugiura. 1998. 2-Arachidonoylglycerol, an endogenous cannabinoid receptor agonist: identification as one of the major species of monoacylglycerols in various rat tissues, and evidence for its generation through Ca2+-dependent and -independent mechanisms. FEBS Lett. 429:152–156.[CrossRef][Medline]
Kreitzer, A.C., and W.G. Regehr. 2001. Retrograde inhibition of presynaptic calcium influx by endogenous cannabinoids at excitatory synapses onto Purkinje cells. Neuron. 29:717–727.[CrossRef][Medline]
Lee, M.W., F.B. Kraemer, and D.L. Severson. 1995. Characterization of a partially purified diacylglycerol lipase from bovine aorta. Biochim. Biophys. Acta. 1254:311–318.[Medline]
Marsicano, G., C.T. Wotjak, S.C. Azad, T. Bisogno, G. Rammes, M.G. Cascio, H. Hermann, J. Tang, C. Hofmann, W. Zieglgansberger, et al. 2002. The endogenous cannabinoid system controls extinction of aversive memories. Nature. 418:530–534.[CrossRef][Medline]
Mechoulam, R., S. Ben-Shabat, L. Hanus, M. Ligumsky, N.E. Kaminski, A.R. Schatz, A. Gopher, S. Almog, B.R. Martin, D.R. Compton, et al. 1995. Identification of an endogenous 2-monoglyceride, present in canine gut, that binds to cannabinoid receptors. Biochem. Pharmacol. 50:83–90.[CrossRef][Medline]
Panikashvili, D., C. Simeonidou, S. Ben-Shabat, L. Hanus, A. Breuer, R. Mechoulam, and E. Shohami. 2001. An endogenous cannabinoid (2-AG) is neuroprotective after brain injury. Nature. 413:527–531.[CrossRef][Medline]
Pertwee, R.G. 1997. Pharmacology of cannabinoid CB1 and CB2 receptors. Pharmacol. Ther. 74:129–180.[CrossRef][Medline]
Stella, N., P. Schweitzer, and D. Piomelli. 1997. A second endogenous cannabinoid that modulates long-term potentiation. Nature. 388:773–778.[CrossRef][Medline]
Sugiura, T., S. Kondo, A. Sukagawa, S. Nakane, A. Shinoda, K. Itoh, A. Yamashita, and K. Waku. 1995. 2-Arachidonoylglycerol: a possible endogenous cannabinoid receptor ligand in brain. Biochem. Biophys. Res. Commun. 215:89–97.[CrossRef][Medline]
Williams, E.J., F.S. Walsh, and P. Doherty. 2003. The FGF receptor uses the endocannabinoid signaling system to couple to an axonal growth response. J. Cell Biol. 160:481–486.
Wilson, R.I., and R.A. Nicoll. 2002. Endocannabinoid signaling in the brain. Science. 296:678–682.
Yamaguchi, S., T. Mase, and K. Takeuchi. 1991. Cloning and structure of the mono- and diacylglycerol lipase-encoding gene from Penicillium camembertii U-150. Gene. 103:61–67.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
