|
||
Article |
Address correspondence to Francis Barr, Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, Martinsried, 82152 Germany. Tel.: 49-89-8578-3135. Fax: 49-89-8578-3102. email: barr{at}biochem.mpg.de
| Abstract |
|---|
|
|
|---|
as a specific substrate for YSK1 that localizes to the Golgi apparatus, and potentially links YSK1 signaling at the Golgi apparatus with protein transport events, cell adhesion, and polarity complexes important for cell migration.
Key Words: Ste20 kinases; cell migration; polarity; collagen invasion; scaffold
The online version of this article contains supplemental material.
Abbreviations used in this paper: MBP, myelin basic protein; MST, mammalian Ste20; siRNA, small interfering RNA; YSK1, yeast Sps1/Ste20-related kinase 1.
| Introduction |
|---|
|
|
|---|
The Ste20 family of serine/threonine protein kinases is implicated in a variety of signaling pathways including those involved in the control of cell migration and polarity (Dan et al., 2001). In mammals, over 30 Ste20 kinases exist classified into two subgroups. These are the p21-activated kinases and the germinal center kinases (Dan et al., 2001), and it is this latter group that is of interest here. Germinal center kinases possess an NH2-terminal kinase domain and a COOH-terminal regulatory domain and can be further subdivided into eight groups based on sequence homologies (Dan et al., 2001). Subgroups II and III contain the mammalian Ste20 (MST) kinases, MST1 (Creasy et al., 1996), MST2 (Creasy and Chernoff, 1995), MST3 (Schinkmann and Blenis, 1997), MST4 (Lin et al., 2001; Qian et al., 2001), and yeast Sps1/Ste20-related kinase 1 (YSK1; Pombo et al., 1996; Osada et al., 1997). MST1 and MST2 are cleaved during apoptosis by caspase-3 and translocate into the nucleus (Lee et al., 2001; Ura et al., 2001) where they function in proapoptotic signaling (De Souza et al., 2002; Lin et al., 2002). Less is known about the other MST kinases. YSK1, also known as Ste20/oxidant stress response kinase 1, is weakly activated by reactive oxygen intermediates but not by any other environmental stresses, or by growth factors (Pombo et al., 1996). However, this kinase does not participate in any of the known MAPK pathways (Pombo et al., 1996; Osada et al., 1997) and a physiological function for YSK1 remains unknown. Like YSK1, MST4 overexpression fails to activate the JNK and p38 MAPK pathways, although it promotes anchorage-independent growth and tumor formation, and has been implicated in prostate cancer progression (Qian et al., 2001; Sung et al., 2003). Here, we investigate the MST family kinases YSK1 and MST4 and uncover a signaling function linked with the Golgi matrix protein GM130 that may play a role in the control of cell migration and polarization.
| Results |
|---|
|
|
|---|
|
|
|
|
|
Dominant-negative YSK1T174A perturbs Golgi apparatus localization
In addition to its function as part of the Golgi apparatus localized tethering complex required for vesicle docking and stacking of Golgi cisternae, GM130 has been proposed to form a structural landmark important for establishment of a polarized Golgi structure (Pfeffer, 2001). One aspect of polarized Golgi structure is the cis- to trans-polarity of the stacked cisternae, and the other is its asymmetric distribution within the cell. Association of the Ste20 family kinases YSK1 and MST4 with GM130 suggest this complex might act as a landmark in a transduction event important for signaling Golgi apparatus integrity and position within the cell, and controlling Golgi apparatus function. The effects of expressing wild-type YSK1, and YSK1T174A, which should behave as a dominant-negative mutant form of YSK1 unable to be activated by GM130, were then compared (Fig. 6, A and B). At high expression levels, YSK1 saturated the available binding sites at the Golgi apparatus and accumulated in the cytoplasm without causing any obvious change in the two Golgi markers GM130 and p115 (Fig. 6 A). Expression of YSK1T174A resulted in the dispersal of the perinuclear ribbon-like Golgi apparatus pattern of GM130 and p115 typical of HeLa cells (Fig. 6 B). This effect was specific to the Golgi apparatus because the perinuclear late-endosomal and lysosomal compartments defined by LAMP1 showed no obvious differences in YSK1 and YSK1T174A expressing cells (Fig. 6 C). Golgi apparatus dispersal was observed in >75% of cells expressing YSKT174 but not with the dominant-negative MST4T178A or other YSK1 and MST4 constructs (Fig. 6 D). Preliminary investigation revealed that transport of the transmembrane glycoprotein of vesicular stomatitis virus was not compromised in YSK1T174A expressing cells, indicating they do not have a general defect in secretion (unpublished data). To obtain supporting evidence for a function of endogenous MST kinases at the Golgi apparatus in HeLa cells, depletion of YSK1 and MST4 was performed using siRNA and the cells stained for the Golgi marker GM130. In cells depleted of YSK1 and MST4 the Golgi apparatus was dispersed into the cell periphery, whereas in control cells depleted for lamin A the typical perinuclear Golgi apparatus morphology was preserved (Fig. 6 E). Interfering with YSK1 and MST4 function, therefore, disturbs the ordered localization of the Golgi apparatus in the perinuclear region.
|

phosphorylated at Serine 58 (Fig. 7 A; unpublished data). Confirming these observations, recombinant 14-3-3
was phosphorylated by YSK1 but not MST4 (Fig. 7 C). Furthermore, an mAb against 14-3-3
(Leffers et al., 1993) stained the Golgi apparatus and showed considerable overlap with the YSK1 activator GM130 (Fig. 7 D). Therefore, 14-3-3
fulfills the criteria of a specific target for YSK1 at the Golgi apparatus.
|
is the key YSK1 substrate mediating these effects, then expressing 14-3-3
S58A should give the same result as dominant-negative YSK1T174A, whereas 14-3-3
S58D should oppose YSK1T174A, and this was indeed the case (Fig. 8 B). Gelsolin-induced invasion was abrogated by 14-3-3
S58A, but not by other forms of 14-3-3
, whereas 14-3-3
S58A triggered collagen invasion in the absence of gelsolin, and this was not overcome by the expression of YSK1T174A (Fig. 8 B). Therefore, 14-3-3
may act downstream of both gelsolin and YSK1 in collagen invasion, and be the key substrate mediating the effects of YSK1.
|
|
| Discussion |
|---|
|
|
|---|
Functions for Golgi apparatusassociated signaling pathways
Directed cell motility is a highly complex process involving many discrete events such as polarization of the cytoskeleton, signal transduction events, and regulation of cell adhesion complexes (Ridley et al., 2003). In particular, cytoskeletal rearrangements and the secretion of proteins and lipids to specific subdomains of the plasma membrane accompany changes in cell polarity, and Golgi apparatuslocalized kinases such as YSK1 and MST4 are in an ideal location to regulate these processes by modulating Golgi apparatus function. The association with GM130, and high degree of similarity between, YSK1 and MST4 might indicate that they have similar functions and downstream effectors. However, this appears not to be the case. Dominant-negative YSK1 but not MST4 causes dispersal of the Golgi apparatus and blocks cell migration, whereas wild-type MST4 but not YSK1 blocks cell migration without having any visible effects on the Golgi apparatus. One possibility is that competition for GM130 controls the relative levels of YSK1 and MST4 activity, although how this would be achieved is unclear at present. Together with their differential effects on cell migration they would therefore be predicted to act on different downstream pathways. The identification of 14-3-3
as a specific Golgi apparatus localized substrate for YSK1 but not MST4 supports this idea, and gives some clues as to how YSK1 signaling may control Golgi apparatus function and cell migration. The 14-3-3 proteins are dimeric adaptors typically binding to phosphorylated acceptor sites on their targets, thereby regulating a wide variety of cellular processes (Tzivion et al., 2001). Furthermore, 14-3-3 proteins are themselves regulated by phosphorylation and dimerization (Tzivion et al., 2001). In the context of this work, three particular functions reported for these proteins may be of relevance (depicted schematically in Fig. 10). First, 14-3-3
binds to phosphorylated Raf in the Ras-signaling pathway and stimulates its activity (Fantl et al., 1994; Freed et al., 1994). Because a pool of activated Ras is generated at the Golgi apparatus in response to growth factor receptor activation, it is possible that YSK1 via 14-3-3
can modulate this pathway. Second, 14-3-3 proteins have been found associated with the cytoplasmic domains of specific integrin complexes (Han et al., 2001; Bialkowska et al., 2003; Santoro et al., 2003), and with Par3/Baz, one of a number of proteins important for control of cell polarity and cell asymmetry during development (Benton et al., 2002; Hurd et al., 2003). Overexpression of 14-3-3 proteins blocks cell migration, and this could be exerted via integrins and their function in cell adhesion (Han et al., 2001; Santoro et al., 2003). An obvious way for YSK1 to control cell migration would therefore be via the 14-3-3
dependent modulation of cell adhesion. Finally, 14-3-3 proteins have been reported to act in the quality control pathway regulating assembly and transport of multimeric membrane protein complexes from the ER to the Golgi apparatus (O'Kelly et al., 2002; Yuan et al., 2003). This provides another point of control for YSK1 that may be relevant for regulation of Golgi apparatus function. Exactly which if any of these potential mechanisms is relevant for YSK1 will require further characterization of 14-3-3
binding partners.
|
| Materials and methods |
|---|
|
|
|---|
-[32P]ATP (3,000 Ci/mmol and 10 mCi/ml) were obtained from Amersham Biosciences. Antisera specific to YSK1 was raised in rabbits 4256 and 4257 immunized with recombinant human YSK1 by Biogenes, and then affinity purified over a column of YSK1 coupled to Affigel-15 (Bio-Rad Laboratories). Peptide antibodies to YSK1 (SC-6865, N19) and MST4 (3822) were purchased from Santa Cruz Biotechnology, Inc. and New England Biolabs, Inc., respectively. Mouse monoclonal anti-LAMP1/CD107a was purchased from Becton Dickinson. Antibodies specific to the phosphorylated YSK1/MST4 activation loop peptide CIKRNpTFVGT were produced by Abcam Ltd., and then isolated from a protein-A purified IgG fraction of the serum over the same peptide immobilized on Sulfolink resin according to the manufacturer's instructions (Pierce Chemical Co.). E. Nigg (Max-Planck-Institute of Biochemistry) and J. Celis (Institute of Cancer Biology, Copenhagen, Denmark) provided antibodies to the centrosome marker c-Nap1 and 14-3-3
, respectively. Other antibodies used in this experiment have been described and characterized previously (Barr et al., 1997; Shorter et al., 1999; Short et al., 2001).
Molecular biology and two-hybrid screening
Full-length human YSK1, MST3, MST4, and 14-3-3
were amplified from human testis cDNA (Becton Dickinson) using the pfu polymerase (Stratagene) and cloned in pCRII-TOPO (Invitrogen). Point mutants were constructed using the Quickchange mutagenesis protocol (Stratagene). DNA oligonucleotides were purchased from Thermo-Hybaid and QIAGEN. All constructs were confirmed by DNA sequencing (Medigenomix). Mammalian expression constructs were made in pcDNA3.1+ (Invitrogen) and pEGFP-C2 (CLONTECH Laboratories, Inc.). For baculovirus expression, pVL1393 or the pAcSG2 vector (Becton Dickinson) modified to include the hexahistidine-tag from pQE32 (QIAGEN) was used. Baculoviruses were produced and proteins expressed in Sf9 cells according the manufacturer's protocols (Becton Dickinson). Bacterial expression was performed using the His-GST expression vector pGAT2 and the His-tag expression vector pQE32 (QIAGEN). Inserts encoding GM13075-271, golgin451-122, and 14-3-3
were inserted into pGAT2 or pQE32 and proteins expressed in BL21(DE3) or JM109 cells, respectively. Proteins were purified over nickel-NTA agarose (QIAGEN). Insect cell expressed kinases were desalted in MEB (50 mM Tris-HCl, pH 7.3, 50 mM KCl, 10 mM MgCl2, 20 mM ß-glycerophosphate, 15 mM EGTA), and other proteins were dialysed into PBS and aliquots snap frozen in liquid nitrogen for storage at -80°C. For two-hybrid screening, a system described previously was used (James et al., 1996). The entire coding region of the human YSK1 cDNA was inserted into the two-hybrid bait vector pFBT9 (a version of pGBT9 [CLONTECH Laboratories, Inc.] modified to encode kanamycin resistance), and this plasmid transformed into the reporter strain PJ69-4A. A human testis cDNA library (CLONTECH Laboratories, Inc.) was transformed into this bait strain and plated on synthetic media lacking leucine, tryptophan, histidine, and adenine with 2% (wt/vol) glucose as the carbon source (QDO). Library plasmids were rescued using the ampicillin resistance marker and retransformed into PJ69-4A together with either pFBT9 or the YSK1 bait plasmid on synthetic medium lacking leucine and tryptophan (-LW), and five independent colonies streaked onto QDO. Those showing strong growth on QDO after 2 d at 30°C were taken as positive clones and the inserts were sequenced. Light colony color is indicative of a strong signal, whereas dark colony color indicates a weaker signal.
GM130 binding assays
1 µg of recombinant His-tagged YSK1 or MST4 expressed in baculovirus-infected Sf9 cells was incubated with 5 µg of either GST-tagged GM13075-271, golgin451-122, or GST alone for 1 h at 4°C in HNTM buffer (50 mM Hepes-KOH, pH 7.2, 200 mM NaCl, 0.5% [vol/vol] Triton X-100, 5 mM MgCl2) in the presence of 15 µl of glutathione-sepharose and 100 µM ATP in a total volume of 300 µl. Beads were washed in 3x 1 ml HNTM and bound protein was eluted directly in SDS-PAGE sample buffer. Samples were Western blotted and probed with either goat anti-YSK1 N19 (Santa Cruz Biotechnology, Inc.) or affinity-purified rabbit anti-YSK1/MST4. Loading controls were analyzed by SDS-PAGE and Coomassie brilliant blue staining.
Kinase assays and substrate identification
For activation experiments with YSK1 or MST4, and comparisons of different wild-type and mutant kinases, 0.8 pmoles of kinase in 7 µl MEB+ (MEB containing 1 mM DTT and 2 mM ATP) were mixed with 5 µl PBS containing the amount of His-tagged GM13075-271 or golgin451-122 indicated in the figures and incubated for 30 min at 37°C. To this was added 8 µl MEB containing 1.5 µg of MBP and 0.1 µl
-[32P]ATP. After incubation for 60 min at 37°C, reactions were analyzed by SDS-PAGE and autoradiography. For mass spectrometry, 40 pmoles of kinase in 20 µl MEB+ were either mock activated or activated for 2 h at 37°C, 10 µl of reducing sample buffer was added and the reaction mixtures were heated for 5 min at 95°C followed by SDS-PAGE. The corresponding bands were excised and processed for mass spectrometry as described previously (Shevchenko et al., 1996).
Potential substrates for YSK1 and MST4 were screened for using a modified KESTREL protocol (Knebel et al., 2001). HeLa S3 cells were grown in suspension using 1 liter of spinner flask at 37°C and 5% CO2 in DME containing 10% FCS (Invitrogen). Cell pellets were lysed on ice for 30 min in an equal volume of lysis buffer (40 mM Tris-HCl, pH 7.0, 1% [vol/vol] Triton X-100, 2.5 mM EDTA, 15 mM DTT) containing a protease inhibitor cocktail (Roche Diagnostics). The lysate was centrifuged at 112,000 g for 30 min at 4°C. The clarified extract (typically 20 mg/ml) was aliquoted, snap frozen in liquid nitrogen, and stored at -80°C. Before further use extracts were thawed, desalted on Biogel P6-DG (Bio-Rad Laboratories) into KESTREL buffer (40 mM Tris-HCl, pH 7.0, 0.1% [vol/vol] ß-mercaptoethanol, 0.1 mM EGTA, 0.1% [vol/vol] Triton X-100), and incubated at 30°C for 20 min to allow dephosphorylation. For the fractionation shown, 10 mg of dephosphorylated cell extract was separated on a Superose-6 HR10/30 column equilibrated in KESTREL buffer containing 140 mM KCl. 1-ml fractions were collected throughout and each one subjected to a kinase assay. For kinase assays to identify substrate proteins, 10 µl of the dephosphorylated extract or column fractions were adjusted to 10 mM MgCl2, 100 µM ATP, 5 µCi
-[32P]ATP, 2 µg YSK1 or MST4, and incubated at 37°C for 10 min. Assays were analyzed by SDS-PAGE and autoradiography. To identify phosphorylated proteins the autoradiograph was overlaid on to a Coomassie blue stained gel and the corresponding region excised and processed for mass spectrometry (Shevchenko et al., 1996).
Cell culture, RNA interference, and microscopy
HeLa cells were cultured at 37°C and 5% CO2 in DME containing 10% FCS. Cells plated on glass coverslips were transfected 2436 h after plating using Fugene-6 (Roche), and left to grow for 1824 h before fixation and processing for immunofluorescence microscopy at RT. RNA interference was performed on HeLa cells transfected using oligofectamine (Invitrogen) with duplex RNA (Dharmacon Research Inc.) for 24 h, coverslips were placed in fresh growth medium for a further 24112 h, and then the cells were processed for fluorescence microscopy (Elbashir et al., 2001). YSK1 and MST4 were targeted with the sequences AACACATTCGTGGGCACCCCC and AATGGAATACCTGGGCGGTGG, GM130 with the sequence AACCCTGAGACAACCACTTCT, and the lamin-A control was described previously (Elbashir et al., 2001). Cells were fixed for 20 min in 3% (wt/vol) PFA, quenched for 10 min with 50 mM ammonium chloride, and permeabilized with 0.1% (vol/vol) Triton X-100 for 5 min. All solutions were made in PBS, and antibody staining was performed for 60 min using a 1,000-fold dilution of antiserum or purified antibody at a final concentration of 1 µg/ml. Coverslips were mounted in 10% (wt/vol) Moviol 4-88, 1 µg/ml DAPI, 25% (wt/vol) glycerol in PBS. Images were collected using an Axioskop-2 with a 63x Plan Apochromat oil immersion objective of NA 1.4, except for wounding assays, which were imaged with a 40x Plan Neofluar objective of NA 0.75, standard filter sets (Carl Zeiss MicroImaging, Inc.), a 1,300 by 1,030 pixel-cooled CCD camera (model CCD-1300-Y; Princeton Instruments, Inc.) and Metavue software (Visitron Systems). Images were cropped in Adobe Photoshop 7.0, sized, and placed in figures using Adobe Illustrator 10.0 (Adobe Systems Inc.).
Collagen invasion assays
HEK293T cells were grown in DME supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg streptomycin (Invitrogen), and transfected with calcium phosphate. Invasion into collagen type I was performed as described previously (Braecke et al., 2001). Six-well plates were filled with 1.25 ml of neutralized type I collagen (0.09% [wt/vol]; Upstate Biotechnology Inc.) and incubated for at least 1 h at 37°C to allow gelification. The cells were harvested using Moscona buffer and Trypsin/EDTA and seeded on top of the collagen gel. The cultures were incubated for 24 h at 37°C. The depth of migration inside the gel was measured using a phase-contrast microscope controlled by a computer program. Invasive and superficial cells were counted in 12 fields of 0.157 mm2. The invasive index is the percentage of cells invading the gel over the total number of cells.
Wounding assays
HS68 cells were grown at 37°C and 5% CO2 in DME containing 10% FCS on glass coverslips until a confluent monolayer was obtained, typically 3 4 d after seeding. Wounds in the monolayers were created by scraping a 200 µl tip across the coverslips. Cells along the front of the wound edge were injected (300 hPa injection pressure, 0.2 s, 60 hPa holding pressure) with 200 ng/µl of plasmid DNA using a Femtojet microinjection system (Eppendorf AG) mounted on an Axiovert 25 with 20x LD A-Plan objective of NA 0.30 (Carl Zeiss MicroImaging, Inc.). After injection, the cells were grown for 16 h under normal growth conditions and stained with the appropriate antibodies. The orientations of the centrosome and Golgi apparatus were assessed according to a published method (Etienne-Manneville and Hall, 2001).
Online supplemental material
Fig. S1 illustrates how YSK1/MST4 localize to the Golgi apparatus in HS68 cells. Fig. S2 shows a sequence comparison of YSK1 with MST3 and MST4; conserved features and mutations are also marked. In Fig. S3, a two-hybrid analysis reveals that YSK1 forms homodimers via the COOH terminus but cannot heterodimerize with MST4. In Fig. S4, mass spectrometry of activated and nonactivated YSK1 identifies the T-loop as one site of autophosphorylation. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200310061/DC1.
| Acknowledgments |
|---|
The Max-Planck Society generously supports research in the group of F.A. Barr. V. De Corte is a Postdoctoral Fellow of the Fund for Scientific Research-Flanders (Belgium). J. Gettemans and V. De Corte greatly appreciate support from Marc Mareel and Joël Vandekerckhove, and acknowledge the support of the Belgian Federation against Cancer and Fortis Bank Verzekeringen.
Submitted: 14 October 2003
Accepted: 19 February 2004
| References |
|---|
|
|
|---|
Barr, F.A., and B. Short. 2003. Golgins in the structure and dynamics of the Golgi apparatus. Curr. Opin. Cell Biol. 15:405413.[CrossRef][Medline]
Barr, F.A., M. Puype, J. Vandekerckhove, and G. Warren. 1997. GRASP65, a protein involved in the stacking of Golgi cisternae. Cell. 91:253262.[CrossRef][Medline]
Barr, F.A., N. Nakamura, and G. Warren. 1998. Mapping the interaction between GRASP65 and GM130, components of a protein complex involved in the stacking of Golgi cisternae. EMBO J. 17:32583268.[CrossRef][Medline]
Benton, R., I.M. Palacios, and D. St Johnston. 2002. Drosophila 14-3-3/PAR-5 is an essential mediator of PAR-1 function in axis formation. Dev. Cell. 3:659671.[CrossRef][Medline]
Bialkowska, K., Y. Zaffran, S.C. Meyer, and J.E. Fox. 2003. 14-3-3 zeta mediates integrin-induced activation of Cdc42 and Rac. Platelet glycoprotein Ib-IX regulates integrin-induced signaling by sequestering 14-3-3 zeta. J. Biol. Chem. 278:3334233350.
Bivona, T.G., and M.R. Philips. 2003. Ras pathway signaling on endomembranes. Curr. Opin. Cell Biol. 15:136142.[CrossRef][Medline]
Bivona, T.G., I. Perez De Castro, I.M. Ahearn, T.M. Grana, V.K. Chiu, P.J. Lockyer, P.J. Cullen, A. Pellicer, A.D. Cox, and M.R. Philips. 2003. Phospholipase Cgamma activates Ras on the Golgi apparatus by means of RasGRP1. Nature. 424:694698.[CrossRef][Medline]
Braecke, M.E., T. Boterberg, E.A. Bruyneel, and M.M. Mareel. 2001. Collagen invasion assay. Metastasis Research Protocols. Vol. 58. S.A. Brooks and U. Schumacher, editors. Humana Press, Totowa, NJ. 8189.
Chiu, V.K., T. Bivona, A. Hach, J.B. Sajous, J. Silletti, H. Wiener, R.L. Johnson, II, A.D. Cox, and M.R. Philips. 2002. Ras signalling on the endoplasmic reticulum and the Golgi. Nat. Cell Biol. 4:343350.[Medline]
Creasy, C.L., and J. Chernoff. 1995. Cloning and characterization of a member of the MST subfamily of Ste20-like kinases. Gene. 167:303306.[CrossRef][Medline]
Creasy, C.L., D.M. Ambrose, and J. Chernoff. 1996. The Ste20-like protein kinase, Mst1, dimerizes and contains an inhibitory domain. J. Biol. Chem. 271:2104921053.
Dan, I., N.M. Watanabe, and A. Kusumi. 2001. The Ste20 group kinases as regulators of MAP kinase cascades. Trends Cell Biol. 11:220230.[CrossRef][Medline]
De Corte, V., E. Bruyneel, C. Boucherie, M. Mareel, J. Vandekerckhove, and J. Gettemans. 2002. Gelsolin-induced epithelial cell invasion is dependent on Ras-Rac signaling. EMBO J. 21:67816790.[CrossRef][Medline]
De Souza, P.M., H. Kankaanranta, A. Michael, P.J. Barnes, M.A. Giembycz, and M.A. Lindsay. 2002. Caspase-catalyzed cleavage and activation of Mst1 correlates with eosinophil but not neutrophil apoptosis. Blood. 99:34323438.
Elbashir, S.M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411:494498.[CrossRef][Medline]
Etienne-Manneville, S., and A. Hall. 2001. Integrin-mediated activation of Cdc42 controls cell polarity in migrating astrocytes through PKCzeta. Cell. 106:489498.[CrossRef][Medline]
Fantl, W.J., A.J. Muslin, A. Kikuchi, J.A. Martin, A.M. MacNicol, R.W. Gross, and L.T. Williams. 1994. Activation of Raf-1 by 14-3-3 proteins. Nature. 371:612614.[CrossRef][Medline]
Ferri, K.F., and G. Kroemer. 2001. Organelle-specific initiation of cell death pathways. Nat. Cell Biol. 3:E255E263.[CrossRef][Medline]
Freed, E., M. Symons, S.G. Macdonald, F. McCormick, and R. Ruggieri. 1994. Binding of 14-3-3 proteins to the protein kinase Raf and effects on its activation. Science. 265:17131716.
Gillingham, A.K., and S. Munro. 2003. Long coiled-coil proteins and membrane traffic. Biochim. Biophys. Acta. 1641:7185.[Medline]
Glantschnig, H., G.A. Rodan, and A.A. Reszka. 2002. Mapping of MST1 kinase sites of phosphorylation. Activation and autophosphorylation. J. Biol. Chem. 277:4298742996.
Graves, J.D., Y. Gotoh, K.E. Draves, D. Ambrose, D.K. Han, M. Wright, J. Chernoff, E.A. Clark, and E.G. Krebs. 1998. Caspase-mediated activation and induction of apoptosis by the mammalian Ste20-like kinase Mst1. EMBO J. 17:22242234.[CrossRef][Medline]
Han, D.C., L.G. Rodriguez, and J.L. Guan. 2001. Identification of a novel interaction between integrin beta1 and 14-3-3beta. Oncogene. 20:346357.[CrossRef][Medline]
Hurd, T.W., S. Fan, C.J. Liu, H.K. Kweon, K. Hakansson, and B. Margolis. 2003. Phosphorylation-dependent binding of 14-3-3 to the polarity protein Par3 regulates cell polarity in mammalian epithelia. Curr. Biol. 13:20822090.[CrossRef][Medline]
James, P., J. Halladay, and E.A. Craig. 1996. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics. 144:14251436.[Abstract]
Knebel, A., N. Morrice, and P. Cohen. 2001. A novel method to identify protein kinase substrates: eEF2 kinase is phosphorylated and inhibited by SAPK4/p38delta. EMBO J. 20:43604369.[CrossRef][Medline]
Kupfer, A., and G. Dennert. 1984. Reorientation of the microtubule-organizing center and the Golgi apparatus in cloned cytotoxic lymphocytes triggered by binding to lysable target cells. J. Immunol. 133:27622766.[Abstract]
Kupfer, A., D. Louvard, and S.J. Singer. 1982. Polarization of the Golgi apparatus and the microtubule-organizing center in cultured fibroblasts at the edge of an experimental wound. Proc. Natl. Acad. Sci. USA. 79:26032607.
Lane, J.D., J. Lucocq, J. Pryde, F.A. Barr, P.G. Woodman, V.J. Allan, and M. Lowe. 2002. Caspase-mediated cleavage of the stacking protein GRASP65 is required for Golgi fragmentation during apoptosis. J. Cell Biol. 156:495509.
Lee, K.K., T. Ohyama, N. Yajima, S. Tsubuki, and S. Yonehara. 2001. MST, a physiological caspase substrate, highly sensitizes apoptosis both upstream and downstream of caspase activation. J. Biol. Chem. 276:1927619285.
Leffers, H., P. Madsen, H.H. Rasmussen, B. Honore, A.H. Andersen, E. Walbum, J. Vandekerckhove, and J.E. Celis. 1993. Molecular cloning and expression of the transformation sensitive epithelial marker stratifin. A member of a protein family that has been involved in the protein kinase C signalling pathway. J. Mol. Biol. 231:982998.[CrossRef][Medline]
Lin, J.L., H.C. Chen, H.I. Fang, D. Robinson, H.J. Kung, and H.M. Shih. 2001. MST4, a new Ste20-related kinase that mediates cell growth and transformation via modulating ERK pathway. Oncogene. 20:65596569.[CrossRef][Medline]
Lin, Y., A. Khokhlatchev, D. Figeys, and J. Avruch. 2002. Death-associated protein 4 binds MST1 and augments MST1-induced apoptosis. J. Biol. Chem. 277:4799148001.
O'Kelly, I., M.H. Butler, N. Zilberberg, and S.A. Goldstein. 2002. Forward transport. 14-3-3 binding overcomes retention in endoplasmic reticulum by dibasic signals. Cell. 111:577588.[CrossRef][Medline]
Osada, S., M. Izawa, R. Saito, K. Mizuno, A. Suzuki, S. Hirai, and S. Ohno. 1997. YSK1, a novel mammalian protein kinase structurally related to Ste20 and SPS1, but is not involved in the known MAPK pathways. Oncogene. 14:20472057.[CrossRef][Medline]
Pfeffer, S.R. 2001. Constructing a Golgi complex. J. Cell Biol. 155:873875.
Pombo, C.M., J.V. Bonventre, A. Molnar, J. Kyriakis, and T. Force. 1996. Activation of a human Ste20-like kinase by oxidant stress defines a novel stress response pathway. EMBO J. 15:45374546.[Medline]
Qian, Z., C. Lin, R. Espinosa, M. LeBeau, and M.R. Rosner. 2001. Cloning and characterization of MST4, a novel Ste20-like kinase. J. Biol. Chem. 276:2243922445.
Ridley, A.J., M.A. Schwartz, K. Burridge, R.A. Firtel, M.H. Ginsberg, G. Borisy, J.T. Parsons, and A.R. Horwitz. 2003. Cell migration: integrating signals from front to back. Science. 302:17041709.
Rios, R.M., and M. Bornens. 2003. The Golgi apparatus at the cell centre. Curr. Opin. Cell Biol. 15:6066.[CrossRef][Medline]
Russo, A.A., P.D. Jeffrey, and N.P. Pavletich. 1996. Structural basis of cyclin-dependent kinase activation by phosphorylation. Nat. Struct. Biol. 3:696700.[CrossRef][Medline]
Santoro, M.M., G. Gaudino, and P.C. Marchisio. 2003. The MSP receptor regulates alpha6beta4 and alpha3beta1 integrins via 14-3-3 proteins in keratinocyte migration. Dev. Cell. 5:257271.[CrossRef][Medline]
Schinkmann, K., and J. Blenis. 1997. Cloning and characterization of a human STE20-like protein kinase with unusual cofactor requirements. J. Biol. Chem. 272:2869528703.
Shevchenko, A., M. Wilm, O. Vorm, and M. Mann. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:850858.[Medline]
Short, B., C. Preisinger, R. Korner, R. Kopajtich, O. Byron, and F.A. Barr. 2001. A GRASP55-rab2 effector complex linking Golgi structure to membrane traffic. J. Cell Biol. 155:877883.
Shorter, J., R. Watson, M.E. Giannakou, M. Clarke, G. Warren, and F.A. Barr. 1999. GRASP55, a second mammalian GRASP protein involved in the stacking of Golgi cisternae in a cell-free system. EMBO J. 18:49494960.[CrossRef][Medline]
Sung, V., W. Luo, D. Qian, I. Lee, B. Jallal, and M. Gishizky. 2003. The Ste20 kinase MST4 plays a role in prostate cancer progression. Cancer Res. 63:33563363.
Sutterlin, C., P. Hsu, A. Mallabiabarrena, and V. Malhotra. 2002. Fragmentation and dispersal of the pericentriolar Golgi complex is required for entry into mitosis in mammalian cells. Cell. 109:359369.[CrossRef][Medline]
Teis, D., W. Wunderlich, and L.A. Huber. 2002. Localization of the MP1-MAPK scaffold complex to endosomes is mediated by p14 and required for signal transduction. Dev. Cell. 3:803814.[CrossRef][Medline]
Tzivion, G., Y.H. Shen, and J. Zhu. 2001. 14-3-3 proteins; bringing new definitions to scaffolding. Oncogene. 20:63316338.[CrossRef][Medline]
Ura, S., N. Masuyama, J.D. Graves, and Y. Gotoh. 2001. Caspase cleavage of MST1 promotes nuclear translocation and chromatin condensation. Proc. Natl. Acad. Sci. USA. 98:1014810153.
Wunderlich, W., I. Fialka, D. Teis, A. Alpi, A. Pfeifer, R.G. Parton, F. Lottspeich, and L.A. Huber. 2001. A novel 14-kilodalton protein interacts with the mitogen-activated protein kinase scaffold mp1 on a late endosomal/lysosomal compartment. J. Cell Biol. 152:765776.
Yuan, H., K. Michelsen, and B. Schwappach. 2003. 14-3-3 dimers probe the assembly status of multimeric membrane proteins. Curr. Biol. 13:638646.[CrossRef][Medline]