|
||
Article |
9 subunit cytoplasmic domain and enhances cell migration
Correspondence to Dean Sheppard: deans{at}itsa.ucsf.edu
| Abstract |
|---|
|
|
|---|
9ß1 is expressed on migrating cells, such as leukocytes, and binds to multiple ligands that are present at sites of tissue injury and inflammation.
9ß1, like the structurally related integrin
4ß1, mediates accelerated cell migration, an effect that depends on the
9 cytoplasmic domain.
4ß1 enhances migration through reversible binding to the adapter protein, paxillin, but
9ß1-dependent migration is paxillin independent. Using yeast two-hybrid screening, we identified the polyamine catabolizing enzyme spermidine/spermine N1-acetyltransferase (SSAT) as a specific binding partner of the
9 cytoplasmic domain. Overexpression of SSAT increased
9ß1-mediated migration, and small interfering RNA knockdown of SSAT inhibited this migration without affecting cell adhesion or migration that was mediated by other integrin cytoplasmic domains. The enzyme activity of SSAT is critical for this effect, because a catalytically inactive version did not enhance migration. We conclude that SSAT directly binds to the
9 cytoplasmic domain and mediates
9-dependent enhancement of cell migration, presumably by localized effects on acetylation of polyamines or of unidentified substrates.
| Introduction |
|---|
|
|
|---|
Although several members of the integrin family can mediate cell migration, two structurally related integrin
subunits,
4 and
9, appear to play specialized roles in accelerated migration. Several studies using chimeric integrin
subunits have demonstrated that this enhancement of migration depends on distinct sequences within the cytoplasmic domains of
4 (Chan et al., 1992; Kassner and Hemler, 1993; Kassner et al., 1995) and
9 (Young et al., 2001). Integrin
4mediated cell migration depends on the specific interaction of the
4 cytoplasmic domain with the adapter protein paxillin (Liu et al., 1999), and it requires the dissociation of paxillin from integrin at the leading edge of migrating cells upon phosphorylation of a specific serine at position 988 in the
4 cytoplasmic domain (Han et al., 2001; Goldfinger et al., 2003). The
9 cytoplasmic domain is 47% identical to the
4 cytoplasmic domain, and also binds paxillin (Young et al., 2001). However,
9 does not contain a homologous phosphorylation site; although the interaction between paxillin and
9 is critical for the effects of the integrin
9ß1 on cell spreading, this interaction is completely dispensable for
9-dependent enhancement of cell migration (Young et al., 2001). Therefore, we used yeast two-hybrid screening to identify proteins that interact with the
9 cytoplasmic domain to mediate enhanced cell migration.
| Results |
|---|
|
|
|---|
9 subunit cytoplasmic domain
9 cytoplasmic domain were identified by yeast two-hybrid screening of a human leukocyte cDNA library, using the entire cytoplasmic domain of human
9 (residues 9741006) as bait. Several candidate cDNAs were isolated and sequenced. These candidates were rescreened by cotransformation with bait vectors containing the
9,
5,
4,
2, or ß1 cytoplasmic domains. Only a single candidate, human spermidine/spermine N1-acetyltransferase (SSAT), was found to specifically interact with
9 and not with
5,
4,
2, or ß1 (Fig. 1 a).
|
9 cytoplasmic domain, we evaluated the binding of GST fusion proteins containing the
9,
5,
4, and
2 cytoplasmic domains (GST-
9, GST-
5, GST-
4, and GST-
2) to [35S]Met-labeled SSAT generated by in vitro transcription and translation. SSAT specifically bound to GST-
9, but not to
2,
4,
5, or GST alone (Fig. 1 b). To map the binding site in SSAT, we generated a series of NH2-terminal and COOH-terminal truncation mutants and found that the COOH-terminal 30 residues (142aa171aa), including the catalytic site (Coleman et al., 1996), were not required for binding, but the 20 amino acids at the NH2 terminus were critical (Fig. 1 c). A double mutant that had previously been shown to be catalytically inactive (R101A/E152K; Coleman et al., 1996) could also bind the
9 cytoplasmic domain (Fig. 1 c).
SSAT binds to cell surface
9
To determine whether SSAT associates with
9 in cells, CHO cells stably expressing either wild-type
9 or chimeric
subunits containing the
9 extracellular and transmembrane domains, fused to the cytoplasmic domains of either
4 or
5 (Young et al., 2001), were transfected to stably express SSAT-Myc. Flow cytometry demonstrated that similar levels of
9,
9
4, and
9
5 were expressed on the cell surface (Fig. 2 a). Lysates from these cell lines were immunoprecipitated with the anti-
9ß1 antibody Y9A2 (Wang et al., 1996) and immunoblotted with an anti-Myc antibody. Because endogenously and heterologously expressed SSAT have been shown to be rapidly degraded in CHO cells (McCloskey et al., 1999), the concentration of Myc-tagged SSAT was increased by treatment with the spermine analogue N1,N11-bis(ethyl)norspermine tetrahydrochloride (BE-3-3-3), which prevents proteosome-mediated SSAT degradation (Coleman and Pegg, 2001). Western blotting of immunoprecipitates with antiserum against the cytoplasmic domain of the integrin ß1 subunit confirmed that similar amounts of
9ß1 were precipitated from each lysate. SSAT was coimmunoprecipitated with full-length
9ß1 in cells treated with BE-3-3-3, but no association with the
9
5 or
9
4 chimeras could be detected (Fig. 2 b).
|
9 at the cell surface, we labeled cell surface proteins with a thiol-cleavable amine-reactive biotinylation reagent, Sulfo-NHS-SS-Biotin. Biotin-labeled cells were lysed, and labeled proteins were captured by streptavidin agarose. Cell surface proteins were eluted from agarose by reduction and used for coimmunoprecipitation. SSAT was coimmunoprecipitated with full-length cell surface
9ß1 from cells treated with BE-3-3-3, but no association with the
9
5 or
9
4 chimeras could be detected (Fig. 2 c). Thus, SSAT associates with
9ß1 at the cell surface.
Increasing SSAT protein concentration specifically enhances cell migration mediated by the
9 subunit cytoplasmic domain
To determine whether the interaction between SSAT and the
9 cytoplasmic domain is critical for the enhancement of cell migration, we used CHO cells stably expressing wild-type or chimeric
9 subunits (Young et al., 2001) for cell adhesion and migration assays on an
9ß1-specific substrate in the presence of a range of concentrations of BE-3-3-3 to increase endogenous levels of SSAT, and in the presence or absence of the
9ß1-blocking antibody Y9A2. The
9ß1-specific substrate we used (TNfn3RAA) was a recombinant form of the third fibronectin type III repeat in chicken tenascin C, in which the normal arginine-glycine-aspartic acid sequence (RGD) had been mutated to arginine-alanine-alanine (RAA) to prevent interaction with other integrins (Prieto et al., 1993; Yokosaki et al., 1994, 1998). The expression of SSAT was induced by BE-3-3-3 in a dose-dependent manner (Fig. 3 a). In the absence of BE-3-3-3, both the
9 and the
4 cytoplasmic domains caused similar enhancement of cell migration compared with the cytoplasmic domain of
5. However, BE-3-3-3 caused concentration-dependent enhancement of migration only in cells expressing wild-type
9 (Fig. 3 b). As we have previously reported (Young et al., 2001), all three versions of the
9 subunit supported equivalent adhesion to TNfn3RAA, and adhesion was unaffected by BE-3-3-3 treatment in all three cell lines (Fig. 3 c). As expected, adhesion and migration of all
9-expressing cells were inhibited by the anti-
9ß1 antibody Y9A2. Migration on the irrelevant substrate, plasma fibronectin, was similar among all three cell lines and was unaffected by treatment with BE-3-3-3 (Fig. 3 d). Adhesion to fibronectin was also similar among all three cell lines and was unaffected by BE-3-3-3 (unpublished data). These results indicate that the effects of BE-3-3-3 are specific for
9ß1-mediated cell migration and are dependent on the presence of the
9 cytoplasmic domain.
|
9 or the
9
5 chimera were plated on TNfn3RAA and scratch wounded. Closure of the wound was quantified by phase-contrast microscopy as a measure of directed cell migration. Cells expressing the
9
5 chimera showed markedly slower migration and wound closure than cells expressing wild-type
9. Wound closure was accelerated by BE-3-3-3 in cells expressing wild-type
9, but not in cells expressing the
9
5 chimera (Fig. 4 a). Photomicrographs of the wound edge did not reveal any systematic differences in cell morphology for cells expressing
9 in the presence or absence of treatment with BE-3-3-3 (Fig. 4 b).
|
9-dependent cell migration requires the catalytic activity of SSAT
9ß1-dependent cell migration, and to determine whether the effects of SSAT depend on catalytic activity, we also performed adhesion and migration assays in CHO cells stably transfected to express either wild-type or catalytically inactive (R101A/E152K mutant) c-Myctagged SSAT. In the absence of BE-3-3-3, cells coexpressing wild-type
9 and exogenous wild-type SSAT demonstrated enhancement of cell migration on TNfn3RAA, compared with cells expressing wild-type
9 alone (Fig. 5 a); cell migration was further enhanced by treatment with BE-3-3-3. In contrast, neither treatment with BE-3-3-3 nor overexpression of wild-type SSAT had any effect on migration in cells expressing the chimeric subunits composed of the extracellular and transmembrane domains of
9 fused to the cytoplasmic domains of
4 (
9
4) or
5 (
9
5). The relative SSAT protein concentrations in mock- and SSAT-transfected cells in the presence and absence of treatment with BE-3-3-3treated cells are shown in Fig. 5 d. Expression of catalytically inactive SSAT (Coleman et al., 1996) did not affect the baseline enhancement of cell migration in cells expressing wild-type
9, perhaps because the level of expression was not adequate to effectively compete with that of endogenous SSAT. However, catalytically inactive SSAT did not enhance cell migration, and it prevented even the increase in migration caused by BE-3-3-3 in cells expressing wild-type
9 alone, a result consistent with previous reports that this construct can function as a dominant negative inhibitor of wild-type SSAT (Coleman et al., 1996). Similar to the previous experimental results, overexpression of either form of SSAT had no effect on cell adhesion on TNfn3RAA or on migration on plasma fibronectin in the presence or absence of BE-3-3-3 (Fig. 5, b and c). These results confirm the specificity of SSAT for enhancement of
9-dependent cell migration and suggest that this effect depends on the catalytic activity of SSAT.
|
9 subunit cytoplasmic domain
9ß1-dependent enhancement of cell migration, we used RNA interference to suppress the expression of SSAT in
9-expressing mouse embryonic fibroblasts (MEFs). MEFs were chosen because the availability of complete genomic sequence data in the mouse allows improved design of specific small interfering RNA (siRNA), and because mouse and human SSAT are virtually identical. Four 21-nucleotide siRNA segments directed against the middle (siRNA-1 and siRNA-3) or the 3' end (siRNA-2 and siRNA-4) of the SSAT transcript were transfected into MEFs that had been stably transfected to express either wild-type
9,
9
4, or
9
5, and the cells were examined 24 h later (Young et al., 2001). Real-time PCR showed that SSAT mRNA was reduced by >75% by siRNA-2, siRNA-3, and siRNA-4, compared with untransfected cells or cells transfected with siRNA-1 (Fig. 6 a). Because endogenous SSAT cannot be detected by a polyclonal antibody against SSAT, BE-3-3-3 was used to induce the expression of SSAT 24 h after siRNA transfection. The SSAT protein level was decreased by siRNA-2, siRNA-3, and siRNA-4, compared with untransfected cells or cells transfected with siRNA-1 (Fig. 6 b). Transfection with siRNA-2, siRNA-3, and siRNA-4 decreased the cell migration on TNfn3RAA of cells expressing wild-type
9 to the level seen for cells transfected with the
9
5 chimera, but had no effect on the migration of cells expressing
9
4 or
9
5 (Fig. 6 c). The enhancement of
9-dependent cell migration by BE-3-3-3 was also decreased by siRNA transfection (Fig. 6 d). None of these treatments had any effect on cell adhesion on TNfn3RAA or on cell migration on fibronectin in any cell type (unpublished data). These results further support the concept that endogenous levels of SSAT play an important role in
9-dependent enhancement of cell migration.
|
9-dependent cell migration by BE-3-3-3 was decreased by siRNA transfection (Fig. 7 d). However,
9-dependent enhancement of cell migration was not inhibited by siRNA-targeting mouse (and hamster) SSAT in CHO cells overexpressing human SSAT (Fig. 7 d). This reconstitution of
9-dependent enhancement of cell migration in siRNA-treated CHO cells with human SSAT that is resistant to these siRNAs suggests that the effects of the siRNAs tested are likely specifically due to the knockdown of SSAT.
|
9-mediated cell migration in HMVEC that express endogenous
9ß1
9ß1-dependent enhancement of cell migration in untransfected cells, we tested the expression of integrin
9ß1 on the cell surface of human microvascular endothelial cells (HMVEC) by flow cytometry (Fig. 8 a). The expression of SSAT in these cells was induced by BE-3-3-3 and inhibited by siRNA directed against human SSAT. Two siRNAs were evaluated, and only one (siRNA-A) consistently inhibited SSAT mRNA concentrations in untreated cells (Fig. 8 b) and dramatically reduced SSAT protein levels in BE-3-3-3treated cells (Fig. 8 c). Induction of SSAT increased HMVEC migration on the
9ß1-specific ligand, TNfn3RAA. Inhibition of SSAT by functional siRNA specifically decreased cell migration on TNfn3RAA (Fig. 8 d). Neither BE-3-3-3 nor siRNA against human SSAT had any effect on cell migration on the
9ß1-irrelevant ligand, plasma fibronectin (Fig. 8 e). These results demonstrate that the expression level of SSAT specifically affects
9ß1-dependent cell migration in cells that endogenously express
9ß1.
|
| Discussion |
|---|
|
|
|---|
9ß1 mediates enhancement of cell migration (Taooka et al., 1999; Young et al., 2001). As with the closely related integrin
4ß1, this mediation depends on sequences within the
subunit cytoplasmic domain. However, in contrast with the mechanism used by
4,
9-dependent enhancement of migration does not require the adapter protein paxillin (Young et al., 2001). We now show that the acetyltransferase SSAT specifically and directly binds to the
9 cytoplasmic domain, that increased levels of SSAT further accelerate cell migration only in cells expressing wild-type
9 and only on
9ß1-specific substrate, and that decreased levels of SSAT only decrease cell migration under the same circumstances. Furthermore, these effects of SSAT appear to require catalytic activity. Together, these results strongly suggest that catalytically active SSAT is a critical component of the pathway by which the integrin
9ß1 enhances cell migration, and that this pathway is highly specific for this integrin.
As we have previously reported (Young et al., 2001),
9ß1 (containing the complete
9 cytoplasmic domain) is diffusely expressed on the cell surface and does not localize to focal adhesion structures, even in cells plated on specific ligands (e.g., TNfn3RAA). Although we are unable to detect endogenous SSAT with available reagents, heterologously expressed Myc- or RFP-tagged SSAT is diffusely expressed throughout the cytoplasm and nucleus (unpublished data). Thus, although both proteins can be seen along the cell membrane, we have not been able to infer "colocalization" from immunostaining experiments. Nonetheless, the broad expression pattern of each protein at least suggests that it is feasible for them to make contact in intact cells. In vivo, SSAT is ubiquitously expressed, whereas
9ß1 expression is restricted to subsets of epithelial cells, muscle cells (Palmer et al., 1993), leukocytes (Taooka et al., 1999), and endothelial cells. Thus, SSAT is clearly expressed in cells that do not express
9ß1, but all
9ß1-expressing cells are likely to express SSAT.
Over the past several years, much has been learned about the common pathways by which ligated integrins activate cytoplasmic signals (outside-in signaling) and by which cytoplasmic signals affect the affinity and avidity of integrins (inside-out signaling). However, the divergent phenotypes of mice expressing null mutations of individual integrin subunits, and the divergent effects of specific integrins on cell behavior, make it clear that the signaling pathways used by integrins can be highly specific. In this paper, we describe a novel example of integrin specificity that appears to be critical for the best-characterized cellular function of the
9ß1 integrin, acceleration of cell migration.
The oxidative catabolism of the higher order polyamines, spermidine and spermine, is accomplished by the concerted action of two different enzymes, SSAT and polyamine oxidase (PAO). Cytosolic SSAT N1 acetylates both spermidine and spermine, which then serve as substrates for peroxisomal PAO (Holtta, 1977). Because PAO strongly prefers acetylated polyamines to unmodified polyamines as its substrates, SSAT is generally considered the rate-controlling enzyme in the back conversion of the higher order polyamines, spermidine and spermine, to the lower order polyamine, putrescine (Casero and Pegg, 1993). Thus far, spermine and spermidine are the only physiological substrates that have been identified for SSAT. Therefore, it is tempting to speculate that SSAT enhances
9ß1-dependent cell migration by local effects on polyamines. Indeed, previous studies have implicated polyamines in the regulation of cell migration, although polyamines' precise mechanisms of action in this process have been obscured (Johnson et al., 2002; Ray et al., 2003). Depletion of polyamines by treatment with DFMO, a drug that blocks the enzyme ornithine decarboxylase responsible for conversion of ornithine to putrescine, has been shown to globally inhibit cell migration and reduce cellular activity of the small GTPase rac1, a well-established mediator of cell migration (Johnson et al., 2002; Ray et al., 2003). Thus, it is conceivable that SSAT-mediated modulation of local polyamine concentrations enhances local rac1 activity to enhance cell migration. However, an equally plausible hypothesis is that SSAT is involved in acetylating other unknown substrates whose acetylation affects their role in enhancing cell migration.
The
9ß1 integrin is expressed on several cells for which migration is critical for function. For example, this integrin is expressed on neutrophils and monocytes and has been shown to play an important role in neutrophil emigration across activated endothelial cells (Taooka et al., 1999). Transendothelial migration appears to depend on binding of
9ß1 to VCAM-1, an inducible ligand expressed on endothelial cells at sites of infection, tissue injury, and inflammation. Several other
9ß1 ligands have been identified; many of them, including tenascin C (Yokosaki et al., 1994), osteopontin (Smith et al., 1996; Yokosaki et al., 1999), tissue fibronectin (Liao et al., 2002), and the coagulation proteins von Willebrand factor and factor XIII (Takahashi et al., 2000), are highly enriched in injured and inflamed tissues. Thus,
9ß1 is likely to play an important role in both leukocyte emigration from the vasculature and leukocyte migration through the extravascular space at sites of injury, infection, or chronic inflammation. Furthermore, mice expressing a null mutation of the
9 subunit demonstrate defects in development of lymphatic vessels (Huang et al., 2000), suggesting a possible role for
9ß1 in the migration of lymphatic endothelial cells required for normal lymphatic development. Thus, our identification of SSAT as a critical effector molecule in
9ß1-dependent cell migration provides a new target for intervention in disorders that are characterized by excessive leukocyte emigration as well as for modulation of the migration of other
9ß1-expressing cells.
| Materials and methods |
|---|
|
|
|---|
9ß1 (Wang et al., 1996) was prepared as described previously. mAb 9B11 against the Myc tag was purchased from Cell Signaling Technology. BE-3-3-3 was purchased from Tocris Cookson Inc. Polyclonal antibody against integrin ß1 was purchased from CHEMICON International. Anti-Crk was purchased from Upstate Biotechnology. Polyclonal anti-SSAT antibody was prepared as described previously (Casero et al., 1991).
Yeast two-hybrid screening
The yeast MATCHMAKER two-hybrid system (CLONTECH Laboratories, Inc.) was used for a library screen. In brief,
9,
2,
4,
5, and ß1 cytoplasmic domains (aa 28833053 for
9) were amplified by PCR and cloned into the Gal4-DNAbinding domain (Gal4-DB) vector (pAS2-1) to screen a library of human leukocyte cDNAs fused to the Gal4-DNA activation domain (Gal4-DA) vector (pACT2). AH109 were used as the host strain. Yeast two-hybrid library screening was performed according to the MATCHMAKER manual on plates lacking adenine, histidine, leucine, and tryptophan. Positive interactions were confirmed by ß-galactosidase expression on
-X-Gal.
Expression and purification of GST fusion proteins
GST fusion proteins containing the
9,
2,
4, and
5 cytoplasmic domains were generated by cloning the PCR-amplified sequences into the bacterial expression plasmid pGEX-4T-1 (Amersham Biosciences) and transforming BL21-Gold bacteria (Stratagene). Transformed cells were cultured in 300 ml of YT medium in the presence of 0.1 mM isopropyl-ß-D-1-thiogalactopyranoside (Sigma-Aldrich), and GST fusion proteins were purified on glutathione-Sepharose by B-PER GST Fusion Protein Purification Kit (Pierce Chemical Co.).
In vitro transcription and translation and protein binding assays
In vitro transcription and translation experiments were done with the T7 RNA polymerase transcription/translation systems, using rabbit reticulocyte lysate (Promega) and L-[35S]methionine (AG1094; Amersham Biosciences) to produce 35S-labeled proteins according to the manufacturer's recommendations. Plasmids containing full-length, truncated, or mutant forms of SSAT in pBluescript SK were used as templates. 0.8 nmol of the appropriate GST fusion protein was mixed with 40 µl of the in vitro translation reaction above and 50 µl of glutathione-Sepharose beads, and then incubated in binding buffer (PBS with 1% Triton X-100) at 4°C for 2 h. The beads were washed five times in 1 ml of binding buffer and resuspended in 25 µl Laemmli sample buffer and heated at 95°C for 5 min. Bound proteins were separated by SDS-PAGE (15%) under reducing conditions. Gels were fixed in 50% methanol and 10% acetic acid for 30 min, soaked in a fluorographic reagent (Amplify; Amersham Biosciences), dried, and developed by autoradiography.
Generation of stable cell lines
Integrin
9-,
9
4-, and
9
5-expressing CHO cells and MEFs were generated in our lab previously (Young et al., 2001). Transfected cells were analyzed for expression of
9,
9
4, and
9
5 integrins by flow cytometry with Y9A2. Fluorescence-activated cell sorting was performed to isolate heterogeneous populations of cells expressing high levels of
9ß1 integrin on their cell surface (Yokosaki et al., 1998). All cell lines continuously expressed high surface levels of
9ß1 as determined by flow cytometry with Y9A2.
Full-length SSAT cDNAs were amplified by forward primer (GCAGCGGATCCCCGCCATGGCTAAATTCGTGATCCGCCCAGCCACTGCGCCGACT) and reverse primer (CGTACCTCGAGTCAATTCAGATCCTCTTCTGAGATGAGTTTTTGTTCCTCCTCTGTTGCCATTTTTA) to add a c-Myc tag to the COOH terminus using either wild-type SSAT or the double mutant (R101A/E152K) in pBluescript SK as template (Coleman et al., 1995). The PCR products were digested by EcoRI and XhoI and cloned into pcDNA3.1/Hygro(+) (Invitrogen). Expression constructs were confirmed by restriction digestion and sequencing. Integrin
9-,
9
4-, and
9
5-expressing CHO cells were used for transfection. Stable clones were obtained by dilution subcloning and characterized by Western blotting. These double transfectants were maintained in medium containing 250 µg/ml G418 and 50 µg/ml hygromycin.
Coimmunoprecipitation and Western blot analysis
CHO cell lines expressing different chimeric
9ß1 integrins were lysed on ice for 30 min in an immunoprecipitation buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM EDTA, 10 mM benzamidine-HCI, 0.02% sodium azide, 1% Triton X-100, 0.05% Tween 20, 2 mM PMSF, 5 µg/ml aprotinin, and 5 µg/ml leupeptin). Lysates were clarified by centrifuging at 16,000 g for 20 min at 4°C, and then were incubated with protein GSepharose coated with Y9A2 at 4°C overnight. The beads were washed with the same buffer five times, and precipitated polypeptides were extracted in Laemmli sample buffer, separated by SDS-PAGE under reducing conditions, probed with anti-Myc mAb, and detected by ECL (Amersham Biosciences).
Cell surface protein biotinylation and coimmunoprecipitation
To determine whether there is interaction between SSAT and cell surface
9ß1, labeling of surface proteins was performed using the lysine-directed, membrane-impermeant biotinylating reagent sulfo-NHS-SS-biotin (Pierce Chemical Co.). Cells were washed four times with PBS at 4°C and incubated with 1.5 mg/ml sulfo-NHS-SS-biotin in PBS for 30 min at 4°C. After the sulfo-NHS-SS-biotin incubation, cells were washed twice with 100 mM glycine in PBS at 4°C and incubated for 20 min at 4°C in glycine/PBS. The glycine buffer was removed, lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 10 mM EDTA, 1% Triton X-100, 0.05% Tween 20, 1x protease inhibitor cocktail) was applied, and the mixture was shaken for 30 min at 4°C. The supernatants were cleared of insoluble material by pelleting at 15,000 rpm for 20 min at 4°C. ImmunoPure-immobilized streptavidin beads (Pierce Chemical Co.) were washed three times with 100 mM glycine/PBS and four times with lysis buffer, and finally were resuspended in lysis buffer. 210 µl of bead/lysis buffer slurry was added to 750 µl of supernatant, and the mixture was gently mixed for 1 h at room temperature. After incubation, the streptavidin beads were washed four times with lysis buffer and the biotinylated proteins were eluted from the beads with lysis buffer containing 50 mM DTT. Eluted samples were used for coimmunoprecipitation as described in the previous paragraph.
siRNA construction and transfection
siRNAs to mouse SSAT were designed with 3'-overhanging thymidine dimers as described previously (Elbashir et al., 2001). Target sequences were aligned to the mouse genome database in a BLAST search (www.ncbi.nlm.nih.gov/blast) to eliminate those with significant similarity to other genes. Web-based siRNA design software from Ambion (www.ambion.com/techlib/misc/siRNA_finder.html) was used for selecting siRNA sequences. Four siRNAs (siRNA-1, UCUAAGCCAGGUUGCCAUGTT; siRNA-2, AAGAAGAGGUGCUUCGGAUTT; siRNA-3, CACCCCUUCUACCACUGCCTT; and siRNA-4, AAAUGGCAGCAGAGG-AGUGTT) for mouse SSAT and two siRNAs (siRNA-A, UGGCUAAAUUCGUGAUCCGTT; and siRNA-B, GAUGGUUUUGGAGAGCACCTT) for human SSAT were synthesized (Proligo) and used for transfection with the siPORT Amine Transfection Agent (Ambion). In brief, MEF cells or HMVEC were grown to 5070% confluence in complete medium without antibiotics in 6-well plates. Cells were washed with serum-free medium. 10 µl SiPORT Amine was added to Opti-MEM I (Invitrogen) medium for a final complexing volume of 200 µl, and the mixture was vortexed and then incubated at room temperature for 1030 min. 1.25 µl of 20 µM siRNA was added, mixed gently, and incubated for 15 min. This mixture was added dropwise to cells in a volume of 800 µl Opti-MEM I.
Flow cytometry
Cultured cells were harvested by trypsinization and rinsed with PBS. Nonspecific binding was blocked with normal goat serum at 4°C for 10 min. Cells were then incubated with a primary antibody (Y9A2) for 20 min at 4°C, followed by a secondary goat antimouse antibody conjugated with phycoerythrin (CHEMICON International). Between incubations, cells were washed twice with PBS. The stained cells were resuspended in 100 µl PBS, and fluorescence was quantified on 5,000 cells with a FACScan flow cytometer (Becton Dickinson).
Cell adhesion assays
The wells of nontissue culturetreated 96-well microliter plates (Nunc) were coated by incubation with 100 µl TNfn3RAA for 1 h at 37°C. After incubation, wells were washed with PBS and then blocked with 1% BSA in DME at 37°C for 30 min. Control wells were filled with 1% BSA in DME. The cells were detached with 2.5 ml of trypsin solution (Sigma-Aldrich) followed by 2.5 ml of trypsin-neutralizing solution (Sigma-Aldrich), washed once in DME, and resuspended in DME at 5 x 105 cells/ml in the presence or absence of 50 µg/ml Y9A2 for 20 min at 4°C before plating. Plates were centrifuged (top side up) at 10 g for 5 min before incubation for 1 h at 37°C in humidified 5% CO2. Nonadherent cells were then removed by centrifugation (top side down) at 48 g for 5 min. Attached cells were fixed and stained in 40 µl of a 1% formaldehyde, 0.5% crystal violet, and 20% methanol solution for 30 min; then, the wells were washed three times with PBS. The relative number of cells in each well was evaluated after solubilization in 40 µl of 2% Triton X-100 by measuring the absorbance at 595 nm in a microplate reader (Bio-Rad Laboratories). All determinations were performed in triplicate, and the data represent the means ± SEM for a minimum of three experiments.
Cell migration assays
For chemotactic migration assays, 24-well Transwell plates (Costar) were used. The lower sides of the Transwell filters (6.5-mm diam, pore size 8.0 µm) were coated with TNfn3RAA dissolved in 250 µl DME for 60 min at 37°C. After incubation with TNfn3RAA, the filters were washed by adding 100 µl PBS to the top well and 500 µl PBS to the bottom well. After being washed twice, the filters were blocked with 1% BSA in DME for 30 min and washed again in PBS. Cells were detached as described in the previous paragraph and resuspended in DME at 5 x 105 cells/ml. Migration and adhesion assays were performed simultaneously, and the cells from the same dishes were used for both assays. Cells were incubated for 20 min on ice with or without 50 µg/ml of Y9A2, and then 100 µl (50,000 cells) were loaded in each chamber. Each chamber was inserted in a well containing 600 µl DME supplemented with 1% FCS to serve as a chemoattractant and incubated at 37°C in humidified 5% CO2 for 2 h (CHO cells) or 3 h (MEF cells). The medium was then aspirated and the filters were washed once with PBS. Cells on the bottom of the filters were fixed for 20 min in 500 µl of DifQuik fixative (Fisher Scientific), and the nonmigrated cells on the top of the filter were gently removed. Filters were allowed to completely dry, stained with DifQuik, washed in running distilled H2O, and allowed to destain in distilled H2O for 1 h. Filters were air dried (for
3 h), removed from the chamber with a scalpel, and mounted on glass slides with a Permamount/xylene solution (Fisher Scientific). Migrated cells were counted under a 25x objective with the use of a gridded eyepiece (reticule). 10 high-powered fields (HPF) per slide were counted, the average was taken, and the number of migrated cells was expressed as migrated cells per 10 HPF. The data represent the means ± SEM for a minimum of three experiments.
Scratch wound assay
Tissue culture dishes were coated with 5 µg/ml GST-TNfn3RAA overnight at 4°C. Cells were suspended with trypsin/EDTA and plated onto coated dishes at a density of 106 cells/35-mm dish. After 2 h, cell cultures were scratched with a single pass of a pipette tip and incubated at 37°C for 8 h. In some cases, culture media were supplemented with 50 µM BE-3-3-3. Cultures were washed twice with PBS, fixed in 3.7% formaldehyde for 10 min, and photographed. Cells were viewed on an inverted microscope (model PE300; Nikon) using Nikon objective lenses (10x/0.30; 20x/0.45). Images were processed by Openlab 2.2.5 software (Improvision) and an ICCD digital camera (model C4742-95; Hamamatsu Photonics) at room temperature, and were arranged and labeled using Adobe Photoshop.
| Acknowledgments |
|---|
This work was supported by grants HL56385, HL64353, HL53949, and HL66600 from the National Heart, Lung, and Blood Institute (to D. Sheppard) and by grant GM26290 from the National Institute of General Medical Sciences (to A.E. Pegg).
Submitted: 23 December 2003
Accepted: 13 August 2004
| References |
|---|
|
|
|---|
Casero, R.A., Jr., and A.E. Pegg. 1993. Spermidine/spermine N1-acetyltransferasethe turning point in polyamine metabolism. FASEB J. 7:653661.[Abstract]
Casero, R.A., Jr., P. Celano, S.J. Ervin, N.B. Applegren, L. Wiest, and A.E. Pegg. 1991. Isolation and characterization of a cDNA clone that codes for human spermidine/spermine N1-acetyltransferase. J. Biol. Chem. 266:810814.
Chan, B.M., P.D. Kassner, J.A. Schiro, H.R. Byers, T.S. Kupper, and M.E. Hemler. 1992. Distinct cellular functions mediated by different VLA integrin
subunit cytoplasmic domains. Cell. 68:10511060.[CrossRef][Medline]
Coleman, C.S., and A.E. Pegg. 2001. Polyamine analogues inhibit the ubiquitination of spermidine/spermine N1-acetyltransferase and prevent its targeting to the proteasome for degradation. Biochem. J. 358:137145.[CrossRef][Medline]
Coleman, C.S., H. Huang, and A.E. Pegg. 1995. Role of the carboxyl terminal MATEE sequence of spermidine/spermine N1-acetyltransferase in the activity and stabilization by the polyamine analog N1,N12-bis(ethyl)spermine. Biochemistry. 34:1342313430.[CrossRef][Medline]
Coleman, C.S., H. Huang, and A.E. Pegg. 1996. Structure and critical residues at the active site of spermidine/spermine-N1-acetyltransferase. Biochem. J. 316:697701.
Elbashir, S.M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411:494498.[CrossRef][Medline]
Goldfinger, L.E., J. Han, W.B. Kiosses, A.K. Howe, and M.H. Ginsberg. 2003. Spatial restriction of
4 integrin phosphorylation regulates lamellipodial stability and
4ß1-dependent cell migration. J. Cell Biol. 162:731741.
Han, J., S. Liu, D.M. Rose, D.D. Schlaepfer, H. McDonald, and M.H. Ginsberg. 2001. Phosphorylation of the integrin
4 cytoplasmic domain regulates paxillin binding. J. Biol. Chem. 276:4090340909.
Holtta, E. 1977. Oxidation of spermidine and spermine in rat liver: purification and properties of polyamine oxidase. Biochemistry. 16:91100.[CrossRef][Medline]
Huang, X.Z., J.F. Wu, R. Ferrando, J.H. Lee, Y.L. Wang, R.V. Farese Jr., and D. Sheppard. 2000. Fatal bilateral chylothorax in mice lacking the integrin
9ß1. Mol. Cell. Biol. 20:52085215.
Johnson, D.A., C. Fields, A. Fallon, M.E. Fitzgerald, M.J. Viar, and L.R. Johnson. 2002. Polyamine-dependent migration of retinal pigment epithelial cells. Invest. Ophthalmol. Vis. Sci. 43:12281233.
Kassner, P.D., and M.E. Hemler. 1993. Interchangeable
chain cytoplasmic domains play a positive role in control of cell adhesion mediated by VLA-4, a ß1 integrin. J. Exp. Med. 178:649660.
Kassner, P.D., R. Alon, T.A. Springer, and M.E. Hemler. 1995. Specialized functional properties of the integrin
4 cytoplasmic domain. Mol. Biol. Cell. 6:661674.[Abstract]
Lauffenburger, D.A., and A.F. Horwitz. 1996. Cell migration: a physically integrated molecular process. Cell. 84:359369.[CrossRef][Medline]
Liao, Y.F., P.J. Gotwals, V.E. Koteliansky, D. Sheppard, and L. Van De Water. 2002. The EIIIA segment of fibronectin is a ligand for integrins
9ß1 and
4ß1 providing a novel mechanism for regulating cell adhesion by alternative splicing. J. Biol. Chem. 277:1446714474.
Liu, S., S.M. Thomas, D.G. Woodside, D.M. Rose, W.B. Kiosses, M. Pfaff, and M.H. Ginsberg. 1999. Binding of paxillin to
4 integrins modifies integrin-dependent biological responses. Nature. 402:676681.[CrossRef][Medline]
McCloskey, D.E., C.S. Coleman, and A.E. Pegg. 1999. Properties and regulation of human spermidine/spermine N1-acetyltransferase stably expressed in Chinese hamster ovary cells. J. Biol. Chem. 274:61756182.
Palmer, E.L., C. Ruegg, R. Ferrando, R. Pytela, and D. Sheppard. 1993. Sequence and tissue distribution of the integrin
9 subunit, a novel partner of ß1 that is widely distributed in epithelia and muscle. J. Cell Biol. 123:12891297.
Prieto, A.L., G.M. Edelman, and K.L. Crossin. 1993. Multiple integrins mediate cell attachment to cytotactin/tenascin. Proc. Natl. Acad. Sci. USA. 90:1015410158.
Ray, R.M., S.A. McCormack, C. Covington, M.J. Viar, Y. Zheng, and L.R. Johnson. 2003. The requirement for polyamines for intestinal epithelial cell migration is mediated through Rac1. J. Biol. Chem. 278:1303913046.
Smith, L.L., H.-K. Cheung, L.E. Ling, J. Chen, D. Sheppard, R. Pytela, and C.M. Giachelli. 1996. Osteopontin N-terminal domain contains a cryptic adhesive sequence recognized by
9ß1 integrin. J. Biol. Chem. 271:2848528491.
Takahashi, H., T. Isobe, S. Horibe, J. Takagi, Y. Yokosaki, D. Sheppard, and Y. Saito. 2000. Tissue transglutaminase, coagulation factor XIII, and the pro-polypeptide of von Willebrand factor are all ligands for the integrins
9ß1 and
4ß1. J. Biol. Chem. 275:2358923595.
Taooka, Y., J. Chen, T. Yednock, and D. Sheppard. 1999. The integrin
9ß1 mediates adhesion to activated endothelial cells and transendothelial neutrophil migration through interaction with vascular cell adhesion molecule-1. J. Cell Biol. 145:413420.
Wang, A., Y. Yokosaki, R. Ferrando, J. Balmes, and D. Sheppard. 1996. Differential regulation of airway epithelial integrins by growth factors. Am. J. Respir. Cell Mol. Biol. 15:664672.[Abstract]
Yokosaki, Y., E.L. Palmer, A.L. Prieto, K.L. Crossin, M.A. Bourdon, R. Pytela, and D. Sheppard. 1994. The integrin
9ß1 mediates cell attachment to a non-RGD site in the third fibronectin type III repeat of tenascin. J. Biol. Chem. 269:2669126696.
Yokosaki, Y., N. Matsuura, S. Higashiyama, I. Murakami, M. Obara, M. Yamakido, N. Shigeto, J. Chen, and D. Sheppard. 1998. Identification of the ligand binding site for the integrin alpha9 beta1 in the third fibronectin type III repeat of tenascin-C. J. Biol. Chem. 273:1142311428.
Yokosaki, Y., N. Matsuura, T. Sasaki, I. Murakami, H. Schneider, S. Higashiyama, Y. Saitoh, M. Yamakido, Y. Taooka, and D. Sheppard. 1999. The integrin
9ß1 binds to a novel recognition sequence (SVVYGLR) in the thrombin-cleaved amino-terminal fragment of osteopontin. J. Biol. Chem. 274:3632836334.
Young, B.A., Y. Taooka, S. Liu, K.J. Askins, Y. Yokosaki, S.M. Thomas, and D. Sheppard. 2001. The cytoplasmic domain of the integrin
9 subunit requires the adaptor protein paxillin to inhibit cell spreading but promotes cell migration in a paxillin-independent manner. Mol. Biol. Cell. 12:32143225.
This article has been cited by other articles:
| ||||||||