|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Article |
Correspondence to Kenneth Yamada: kenneth.yamada{at}nih.gov
|
|
|---|
R. Pankov's present address is Department of Cytology, Histology, and Embryology, Faculty of Biology, Sofia University, Sofia, 1421, Bulgaria.
M. Araki's present address is Moji Rosai Hospital, Moji-ku, Kitakyushu, Fukuoka, 801-8502, Japan.
K. Clark's present address is Department of Biochemistry, University of Leicester, University Road, Leicester LE1 7RH, UK.
Abbreviations used in this paper: 2D, two-dimensional; 3D, three-dimensional; PI3K, phosphatidylinositol 3'-kinase; si, small interfering.
| Introduction |
|---|
|
|
|---|
Directional migration (i.e., cell motility in one direction) can involve either externally directed migration during chemotaxis or the intrinsic propensity of cells to continue migrating in the same direction without turning (i.e., intrinsic persistence of migration). Directional migration appears to be regulated by multiple mechanisms, including microtubules (Vasiliev et al., 1970; Goldman, 1971; Dujardin et al., 2003), Cdc42 (Nobes and Hall, 1999; Etienne-Manneville and Hall, 2003), integrins (Danen et al., 2005), and chemotactic stimuli (Haugh et al., 2000; Franz et al., 2002; Weiner, 2002). Chemotaxis imposes faster "directed migration" on cells through local activation of Rac or Ras by an external chemical or protein signal, activation of phosphatidylinositol 3'-kinase (PI3K), and establishment of a phosphoinositide gradient (Srinivasan et al., 2003; Sasaki et al., 2004; Van Haastert and Devreotes, 2004).
However, many migratory processes in development and tissue remodeling occur with no evidence of extrinsic chemotactic signaling, but instead by using intrinsic cell migration properties (Trinkaus, 1969). Rac and Rho are well-known modulators of various types of cell migration including chemotaxis, but their role in regulating intrinsic persistence and directionality of migration is not clear (Evers et al., 2000; Chung et al., 2000; Etienne-Manneville and Hall, 2002; Fukata et al., 2003; Ridley et al., 2003; Burridge and Wennerberg, 2004; Raftopoulou and Hall, 2004; Weiss-Haljiti et al., 2004).
In this study, we examined the following fundamental question: Is there a basic, intrinsic cellular mechanism that regulates whether a cell will migrate relatively straight ahead or in randomly changing directions? That is, what intracellular signaling mechanism determines whether a cell has an intrinsic pattern of directionally persistent migration or random, exploratory migration? We find that a relatively small change in total Rac activity can serve as a switch between these two patterns of cell migration in multiple cell types. Moreover, culturing fibroblasts in a three-dimensional (3D) compared with a two-dimensional (2D) environment was found to modulate Rac activity and change intrinsic directionality of cell migration.
| Results |
|---|
|
|
|---|
|
Stable transfection with constitutively activated Akt compensated for the defect in Akt signaling and corrected most of the deficiency in active Rac (Fig. 1 D). Restoring levels of active Rac substantially decreased directionality and promoted random motility (Fig. 1 E). Transfection of mutant cells with low levels of constitutively activated Rac1 also restored random motility (Fig. S1, B and C), although higher levels proved inhibitory and cytotoxic (not depicted).
Small changes in Rac activity alter pattern of cell migration
To directly test the role of total Rac activation levels in regulating the directionality of cell migration in a range of different cell types, levels of Rac1 were knocked down using RNA interference with small interfering (si) RNA. Reductions in Rac protein levels resulted in proportional changes in Rac activity (Fig. S2 [available at http://jcb.org/cgi/content/full/jcb.200503152.DC1] and not depicted). No effects of Rac1 knockdown on Cdc42 were detected, and Rho activity levels were generally unchanged (Fig. 2 A). Random cell migration was suppressed by such Rac1 knockdown in primary human fibroblasts, which is consistent with our findings in mouse ES cellderived GD25 cells. The cells displayed increased directionality of migration, and suppression of overall velocity occurred only with a greater extent of Rac knockdown (Fig. 2, compare C with E; compare Video 1 with 2, available at http://jcb.org/cgi/content/full/jcb.200503152.DC1). Similar results were obtained using either a pool of four Rac1 siRNA duplexes or individual Rac1 siRNA duplexes to reduce Rac1 activity (compare Fig. 2 with Fig. S3 A). Based on 11 independent experiments with primary human fibroblasts, a modest reduction in total Rac activity to 70% of original levels substantially enhanced directional persistence of migration, and 60% or lower levels produced maximal directionally persistent migration (Fig. 2 F). Conversely, overexpression of wild-type Rac1 or constitutively activated Rac1 in primary human fibroblasts promoted random cell migration with only minimal effects on overall velocity (Fig. S3, C and D). Using an independent approach to altering Rac activity, the Rac GEF inhibitor NSC 23766 reduced concentrations of active Rac in human fibroblasts and produced a loss of random motility with movements restricted to the long axis of the cells, followed by immobilization at high doses (unpublished data).
|
|
|
|
|
|
|
A highly oriented 3D matrix, such as from tumor-derived stromal cells, can affect the orientation and potentially the migration of cells (Amatangelo et al., 2005). Although local parallel alignment and migration of closely adjacent cells was sometimes present in our 3D matrix cultures, there was no general pattern of parallel migration. Persistence of migration occurred in all directions in the 3D matrix (Fig. S5, A and B, available at http://jcb.org/cgi/content/full/jcb.200503152.DC1). Finally, directly increasing Rac activation levels by transfection with constitutively activated Rac produced an increase in random motility in the 3D matrix with a 30% decrease in the D/T ratio (Fig. 7 E; P < 0.001)) and increased lamellae (not depicted), confirming that Rac confers random motility in a 3D as well as in a 2D environment.
| Discussion |
|---|
|
|
|---|
30% instead support directionally persistent migration using axial lamellae. This role of Rac in regulating the capacity for random versus directionally persistent motility was found for a variety of cell types, including fibroblasts and epithelial cells, suggesting that it is a common phenomenon. Moderate changes in Rac activity did not necessarily affect the velocity of cell migration, and in a 3D environment, suppression of Rac activity occurred together with increased velocity, indicating the independence of directionality from velocity. Primary human fibroblasts express Rac1 and traces of Rac2 and Rac3 (unpublished data); it is possible that reductions in Rac1 were able to produce such large effects on the mode of migration without changes in overall migration velocity because other Rac isoforms or other regulators of migration speed were still present. Unlike velocity, directionality strongly depended on cellular levels of Rac-GTP and not Cdc42 or Rho.
In terms of a cell biological mechanism, slightly lowering Rac1 activity resulted in suppression of peripheral lamellae, which promoted persistent migration of a cell in one direction because of the absence of new peripheral lamellae that could produce a change in the direction of cell migration. This regulation of intrinsic directionality differs markedly from chemotactic-directed migration, which depends on PI3K and localized PIP3 with Rac or Ras localization to active lamellae (Srinivasan et al., 2003; Sasaki et al., 2004; Van Haastert and Devreotes, 2004). It also differs from mechanisms involving local changes in Rac activity during chemotaxis and
4 integrinregulated migration (Arrieumerlou and Meyer, 2005; Nishiya et al., 2005).
In contrast to this novel role of small changes in total Rac activity in regulating the overall pattern of cell migration, substantial increases in Rac activity are well-known stimulators of the velocity of cell migration (Etienne-Manneville and Hall, 2002; Raftopoulou and Hall, 2004). Conversely, cells with major deficiencies in Rac as a result of gene ablation or RNA interference are reported to show marked defects in overall cell migration and chemotaxis (Roberts et al., 1999; Glogauer et al., 2003; Sun et al., 2004; Weiss-Haljiti et al., 2004). Rac activation is accompanied by its translocation to the plasma membrane (del Pozo et al., 2002, 2004), with the highest concentrations of active Rac located at the leading edge of motile cells (Kraynov et al., 2000; Itoh et al., 2002; Schlunck et al., 2004). Active Rac in lamellipodia at the leading edge is thought to function by interacting with WAVE to stimulate Arp2/3-mediated actin polymerization, producing lamellar extension and forward cell movement (Miki et al., 2000; Pollard et al., 2000). However, cell migration can still proceed effectively in the absence of lamellipodia (Gupton et al., 2005), suggesting that the target of Rac may be the lamella rather than lamellipodia. We emphasize again that our studies have focused on the role of total or global levels of cellular Rac1 activity as a central regulator, rather than on localized Rac.
Our findings indicate that Rac1 levels regulate persistence of migration by controlling the number of peripheral lamellae and associated total amount of membrane protrusions that can mediate cell turning (35-fold difference), whereas the number of axial lamellae and associated protrusive membrane located along the long axis of the cell did not change (11.1-fold dfference). The original concept of the dominance of, first, one, and then another lamella during cell migration, which explains the capacity of fibroblasts and other cells to turn and migrate in a new direction, has been known for decades (Trinkaus, 1969). Our study describes a signaling process that limits the number of peripheral lamellae used for turning.
Studies of Rac and other Rho GTPases have traditionally depended heavily on overexpression of constitutively activated and dominant-negative constructs. Although useful for manipulating levels of activity, they could theoretically be accompanied by artifacts because the GTPase does not cycle or the construct might affect an unknown range of regulatory molecules. In fact, we found that strong overexpression of both types of constructs to produce a large suppression or enhancement of Rac activity disrupted cell migration with a substantial decrease in velocity, which is consistent with previous studies (Nobes and Hall, 1995; Allen et al., 1998; Banyard et al., 2000; Glogauer et al., 2003; Pradip et al., 2003). As alternative approaches, our use of an integrin mutant, RNA interference to produce stepwise reductions in total Rac activity, comparisons with other Rho GTPases, testing the effects of physiological changes in the type of substrate on Rac and migration pattern, and the use of a Rac small-molecule inhibitor were designed to provide independent tests of the role of Rac activity in the pattern of cell migration. All of these independent approaches support the central role of the total Rac activity in regulating random versus directionally persistent migration.
As depicted in Fig. 8, we suggest that there may be at least four distinct levels of Rac activity differentially regulating the speed and pattern of intrinsic cell migration. As described by others (e.g., Glogauer et al., 2003), very low levels of active Rac result in immobilization of the cells (Fig. 8, state I). Naturally occurring levels of active Rac higher than this extreme state, but still
3050% lower than in cells cultured on a 2D fibronectin substrate, were found in fibroblasts grown in 3D (Fig. 8, state II). Under these conditions, cells retained a spindle-shaped morphology, but developed a stable, single lamella in the direction of migration containing membrane-localized Rac1. These state II cells demonstrated both the highest directionality and highest velocity of migration. We suggest that this condition would be ideal for cell migration in vivo; e.g., during neural crest and myoblast cell migration in embryonic development. Elevation of Rac levels by extrinsic or intrinsic factors could disrupt these processes. In addition, our finding that chemotaxis can be stimulated by a moderate reduction in Rac suggests that the specific level of overall Rac activation may also influence chemotactic efficiency in vivo.
|
| Materials and methods |
|---|
|
|
|---|
A 3D matrix on a coverslip was mechanically compressed by applying a weight of 940 g to a central area of 625 mm2 (1.5 g/mm2) for 5 min to generate a 2D matrix (Cukierman, 2002). Alternatively, 3D matrices were solubilized in 5 M guanidine containing 10 mM DTT and 5 mM PMSF. The dissolved matrix components were coated on tissue culture dishes at a protein concentration of 50 µg/ml.
Antibodies and reagents
Antibodies to total-, phospho (Ser 473)-, and phospho (Thr 308)-Akt as well as total, phospho (Thr 202), and (Tyr 204) p44/42 MAP kinase (ERK1/2) were purchased from Cell Signaling; anti-Cdc42 antibody was purchased from BD Biosciences; phalloidin conjugated with Alexa 488 or Alexa 594 was obtained from Molecular Probes; total, phospho (Thr 183), and phospho (Tyr 185) JNK antibodies, Cdc42 siRNA sc29256, and RhoA siRNA sc29471 were obtained from Santa Cruz Biotechnology, Inc.; anti-RhoA antibodies were purchased from Santa Cruz Biotechnology, Inc. or Cytoskeleton, Inc.; anti-VSV epitope and antiactin clone AC-40 were purchased from Sigma-Aldrich; anti-Rac antibody and Rhotekin-Rho binding domain were purchased from Upstate Biotechnology or Cytoskeleton, Inc.; anti-ß1 antibody 4080 was raised against a 50-mer cytoplasmic domain peptide in a rabbit; and anti-ß3 integrin hybridoma AP3 was purchased from American Type Culture Collection. PAK1 PBD agarose was purchased from Upstate Biotechnology or Cytoskeleton, Inc. Rac1 siRNA and the nonspecific control siRNA pool were obtained from Dharmacon. The individual sequences (sense) for each Rac1 siRNA duplex were as follows: 5, AGACGGAGCUGUAGGUAAAUU; 7, UAAGGAGAUUGGUGCUGUAUU; 8, UAAAGACACGAUCGAGAAAUU; and 9 (with ON TARGETTM modification for enhanced specificity), CGGCACCACUGUCCCAACAUU. These siRNAs were used either as a pool of all four or as individual siRNA duplexes.
The Rac inhibitor NSC23766was recently reported (Gao et al., 2004) to be a Rac-specific small-molecule inhibitor that targets Rac activation by GEF. The compound was designed, synthesized, and provided by the Drug Synthesis and Chemistry Branch (National Cancer Institute, Bethesda, MD). LY 294002 was purchased from Calbiochem.
Plasmids
An expression plasmid containing cDNA encoding the small GTPase Rac1 was provided by J. Silvio Gutkind (NIDCR). The constitutively activated Rac1 construct pRK VSV RacQ61L (Rac QL) with a VSV epitope tag was described previously (Koivisto et al., 2004). A cDNA clone encoding Akt was purchased from Upstate Biotechnology. For constitutive activation, the myristoylated vector pRKmyr was constructed by inserting the Kozak consensus sequence and the 13 NH2-terminal amino acids of c-Src into the pRK5-based expression system. BamHI and XbaI sites were introduced into Akt using PCR, and Akt was subcloned into pRKmyr to obtain pRKmyrAkt. HindIII and SalI sites were introduced by PCR to flank the Akt PH domain (aa 1148), and the PH domain was subcloned into pEGFP-C1 to generate the pEGFP-C1Akt-PH probe (Kontos et al., 1998; Servant et al., 2000).
siRNA transfection, pull-down assays, and immunoblotting
Primary human fibroblasts were transfected with 0.01200 nM siRNA using Lipofectamine 2000 (Invitrogen) and OptiMEM medium (GIBCO BRL) in the absence of antibiotics according to the manufacturer's recommendations. Transfected cells were passaged at 5660 h and used after 72 h. Transfection efficiency as determined by fluorescence detection of Dharmacon siGLO RISC-free siRNA at transfection concentrations ranging from 0.01 to 100 nM was 100% at all of these concentrations tested. Pull-down assays for Rho-GTPases were performed as described previously (Sander et al., 1998) with minor modifications. In brief, cells were scraped into ice-cold lysis buffer (25 mM Hepes, pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 1% Igepal, 10% glycerol, and CompleteTM protease cocktail without EDTA [Roche]), and centrifuged for 5 min at 14,000 g. Cleared lysates were incubated with 10 or 20 µg PAK-1 PBD agarose or 20 µg GST-tagged Rhotekin Rho-binding domain bound to glutathione agarose for 45 or 60 min at 4°C with rotation. The beads were washed three times with lysis buffer and heated for 35 min at 95100°C in reducing SDS-PAGE sample buffer, and the released proteins were resolved on 816% gradient gels (Novex). After electrotransfer to nitrocellulose membranes (Novex), the filters were blocked (5% nonfat dry milk in 150 mM NaCl, 50 mM Tris-HCl, pH 7.4, and 0.1% Tween 20) and probed with the indicated antibodies, followed by the appropriate secondary horseradish peroxidase-conjugated antibodies (Amersham). Immunoblots were visualized using the ECL system and Hyperfilm X-ray film (Amersham Biosciences). For experiments quantifying the effects of different levels of active Rac on the D/T ratio, immunoblots were analyzed by using a chemiluminescent imager (LAS-1000 Pro V3.12; Fuji) after development with the Super Signal West Femto Maximum Sensitivity Substrate (Pierce Chemical Co.); results were quantified using Image Gauge V4.22 software (Fuji). All pairs or sets of gel images used samples that were analyzed on the same polyacrylamide gel.
Microscopy
Cells were plated on tissue culture dishes with or without precoating with 1 or 5 µg/ml human plasma fibronectin or onto 3D fibronectin-containing matrices at a density of 500 cells/cm2. After overnight incubation, the medium was changed, and cell movements were monitored with microscopes (Axiovert 25; Carl Zeiss MicroImaging, Inc.) using 5x NA 0.12 or 10x NA 0.25 A-Plan objectives. Images were collected with CCD video cameras (model XC-ST50; Sony) at 10- or 15-min intervals, digitized, and stored as image stacks using MetaMorph 6.16 software (Universal Imaging Corp.). Velocity and persistence of migratory directionality (D/T) were determined by tracking the positions of cell nuclei using the Track Point function of MetaMorph. Control experiments indicated that the D/T ratio was the same for the first and second halves of the analysis period (Fig. S5 C, and that the 1015-min rate of acquisition of images was sufficient to minimize the asymptotic approach to a constant D/T ratio that can occur if sampling was conducted at 1-h intervals (Fig. S5 D). The mean square displacement values were obtained using the Track Object function, which determined the intensity centroids of the defined target regions (i.e., the cells) and tracked their displacement automatically through the planes of each image stack.
Cells for immunofluorescence analysis were plated on uncoated or fibronectin (5 µg/ml) or 3D matrix precoated glass coverslips (12 mm; Carolina Biological Supply Company) and cultured overnight. Samples were fixed with 4% PFA in PBS containing 5% sucrose for 20 min and permeabilized with 0.5% Triton X-100 in PBS for 3 min. Samples were stained with phalloidin that was conjugated with Alexa 488 or Alexa 594 as recommended by the manufacturer. Stained samples were mounted in GEL/MOUNT (Biomeda Corp.) containing 1 mg/ml 1,4-phenylendiamine (Fluka) to reduce photobleaching. Immunofluorescence images were obtained using 40x NA 1.0 or 63x NA 1.5 oil immersion objectives of a microscope (Axiophot; Carl Zeiss MicroImaging, Inc.) equipped with a CCD camera (CoolSNAP ES; Photometrics). Digital images were obtained using MetaMorph 6.16 software. Each figure shown is representative of a minimum of two to three independent experiments analyzing 3045 cells each.
Chemotaxis assay
Primary human fibroblasts were detached with trypsin-EDTA, rinsed, and preincubated with 50 µM LY 294002 (Calbiochem) or vehicle (0.2% ethanol) in complete medium for 15 min in suspension before plating. Cells (8 x 104) were plated onto a Transwell system insert (8-µm pore size; BD Falcon) in a 6-well plate and placed in 3 ml of complete medium with or without 300 nM fMLP (Sigma-Aldrich), LY 294002, or vehicle. Cells were incubated at 37°C for 2 h, and then the inserts were washed with PBS and fixed with 2% PFA in PBS. Cells were removed from the top part of the membrane, and the cells that had migrated to the bottom of the membrane were counted using a phase-contrast microscope. The mean number of cells per field ± SEM of five randomly chosen fields was calculated for each condition.
Online supplemental material
Fig. S1 shows directionally persistent migration of mutant integrin cells and suppression by expression of active Rac. Fig. S2 provides examples of loss of both Rac protein and active Rac (Rac-GTP) after treatment with Rac siRNA without effects on activation-associated phosphorylation of Akt, ERK, or JNK; it also confirms activity of the PI 3'-kinase inhibitor LY 294002. Fig. S3 shows the effects on cell migration of Rac1 knockdown by Rac1 siRNA duplexes or Rac1 overexpression. Fig. S4 shows the lack of effects of Rac1 knockdown on integrins and morphology of cells with an integrin mutation or Rac1 knockdown. Fig. S5 shows analysis of cell migrations in 2D and 3D environments by time-lapse recording.
All videos show time-lapse video recordings at 10-min intervals for 12 h and were recorded using a 5x objective except for video 3, which uses a 10x objective to show cell interactions with the pliable, randomly oriented 3D matrix. Video 1 shows human fibroblasts migrating after transfection with control siRNA. Video 2 shows human fibroblasts migrating after transfection with 0.1 nM Rac1 siRNA. Video 3 shows human fibroblasts migrating within a 3D matrix. Video 4 shows MCF-10A human epithelial cells migrating after transfection with control siRNA. Video 5 shows MCF-10A cells migrating after transfection with 50 nM Rac1 siRNA. Video 6 shows U87-MG human glioblastoma cells migrating after transfection with control siRNA. Video 7 shows U87-MG migrating after transfection with 50 nM Rac1 siRNA. Online supplemental material is available at http://jcb.org/cgi/content/full/jcb.200503152.DC1.
| Acknowledgments |
|---|
Y. Endo is a Japan Society for the Promotion of Science Research Fellow in Biomedical and Behavioral Research at the National Institutes of Health.
Submitted: 28 March 2005
Accepted: 27 July 2005
| References |
|---|
|
|
|---|
Allen, W.E., D. Zicha, A.J. Ridley, and G.E. Jones. 1998. A role for Cdc42 in macrophage chemotaxis. J. Cell Biol. 141:11471157.
Amatangelo, M.D., D.E. Bassi, J.P. Klein-Szanto, and E. Cukierman. 2005. Stroma-derived three-dimensional matrices are necessary and sufficient to promote desmoplastic differentiation of normal fibroblasts. Am. J. Pathol. 167:475488.
Arrieumerlou, C., and T. Meyer. 2005. A local coupling model and compass parameter for eukaryotic chemotaxis. Dev. Cell. 8:215227.[CrossRef][Medline]
Banyard, J., B. Anand-Apte, M. Symons, and B.R. Zetter. 2000. Motility and invasion are differentially modulated by Rho family GTPases. Oncogene. 19:580591.[CrossRef][Medline]
Burridge, K., and K. Wennerberg. 2004. Rho and Rac take center stage. Cell. 116:167179.[CrossRef][Medline]
Chung, C.Y., S. Lee, C. Briscoe, C. Ellsworth, and R.A. Firtel. 2000. Role of Rac in controlling the actin cytoskeleton and chemotaxis in motile cells. Proc. Natl. Acad. Sci. USA. 97:52255230.
Cukierman, E. 2002. Preparation of extracellular matrices produced by cultured fibroblasts. Current Protocols in Cell Biology. Vol. 2. J.S. Bonifacino, M. Dasso, J. Lippincott-Schwartz, and K.M. Yamada, editors. John Wiley & Sons, Inc., New York. 10.9.110.9.14.
Cukierman, E., R. Pankov, D.R. Stevens, and K.M. Yamada. 2001. Taking cell-matrix adhesions to the third dimension. Science. 294:17081712.
Danen, E.H., J. van Rheenen, W. Franken, S. Huveneers, P. Sonneveld, K. Jalink, and A. Sonnenberg. 2005. Integrins control motile strategy through a Rho-cofilin pathway. J. Cell Biol. 169:515526.
del Pozo, M.A., W.B. Kiosses, N.B. Alderson, N. Meller, K.M. Hahn, and M.A. Schwartz. 2002. Integrins regulate GTP-Rac localized effector interactions through dissociation of Rho-GDI. Nat. Cell Biol. 4:232239.[CrossRef][Medline]
del Pozo, M.A., N.B. Alderson, W.B. Kiosses, H.-H. Chiang, R.G.W. Anderson, and M.A. Schwartz. 2004. Integrins regulate Rac targeting by internalization of membrane domains. Science. 303:839842.
Dujardin, D.L., L.E. Barnhart, S.A. Stehman, E.R. Gomes, G.G. Gundersen, and R.B. Vallee. 2003. A role for cytoplasmic dynein and LIS1 in directed cell movement. J. Cell Biol. 163:12051211.
Etienne-Manneville, S., and A. Hall. 2001. Integrin-mediated activation of Cdc42 controls cell polarity in migrating astrocytes through PKC
. Cell. 106:489498.[CrossRef][Medline]
Etienne-Manneville, S., and A. Hall. 2002. Rho GTPases in cell biology. Nature. 420:629635.[CrossRef][Medline]
Etienne-Manneville, S., and A. Hall. 2003. Cdc42 regulates GSK-3ß and adenomatous polyposis coli to control cell polarity. Nature. 421:753756.[CrossRef][Medline]
Evers, E.E., G.C.M. Zondag, A. Malliri, L.S. Price, J.-P. ten Klooster, R.A. van der Kammen, and J.G. Collard. 2000. Rho family proteins in cell adhesion and cell migration. Eur. J. Cancer. 36:12691274.
Franz, C.M., G.E. Jones, and A.J. Ridley. 2002. Cell migration in development and disease. Dev. Cell. 2:153158.[CrossRef][Medline]
Fukata, M., M. Nakagawa, and K. Kaibuchi. 2003. Roles of Rho-family GTPases in cell polarisation and directional migration. Curr. Opin. Cell Biol. 15:590597.[CrossRef][Medline]
Gail, M.H., and C.W. Boone. 1970. The locomotion of mouse fibroblasts in tissue culture. Biophys. J. 10:980993.
Gao, Y., J.B. Dickerson, F. Guo, J. Zheng, and Y. Zheng. 2004. Rational design and characterization of a Rac GTPase-specific small molecule inhibitor. Proc. Natl. Acad. Sci. USA. 101:76187623.
Glogauer, M., C.C. Marchal, F. Zhu, A. Worku, B.E. Clausen, I. Foerster, P. Marks, G.P. Downey, M. Dinauer, and D.J. Kwiatkowski. 2003. Rac1 deletion in mouse neutrophils has selective effects on neutrophil functions. J. Immunol. 170:56525657.
Goldman, R.D. 1971. The role of three cytoplasmic fibers in BHK-21 cell motility. I. Microtubules and the effects of colchicine. J. Cell Biol. 51:752762.
Gupton, S.L., K.L. Anderson, T.P. Kole, R.S. Fischer, A. Ponti, S.E. Hitchcock-DeGregori, G. Danuser, V.M. Fowler, D. Wirtz, D. Hanein, and C.M. Waterman-Storer. 2005. Cell migration without a lamellipodium: translation of actin dynamics into cell movement mediated by tropomyosin. J. Cell Biol. 168:619631.
Haugh, J.M., F. Codazzi, M. Teruel, and T. Meyer. 2000. Spatial sensing in fibroblasts mediated by 3' phosphoinositides. J. Cell Biol. 151:12691280.
Itoh, R.E., K. Kurokawa, Y. Ohba, H. Yoshizaki, N. Mochizuki, and M. Matsuda. 2002. Activation of rac and cdc42 video imaged by fluorescent resonance energy transfer-based single-molecule probes in the membrane of living cells. Mol. Cell. Biol. 22:65826591.
Koivisto, L., L. Hakkinen, K. Matsumoto, C.A. McCulloch, K.M. Yamada, and H. Larjava. 2004. Glycogen synthase kinase-3 regulates cytoskeleton and translocation of Rac1 in long cellular extensions of human keratinocytes. Exp. Cell Res. 293:6880.[CrossRef][Medline]
Kontos, C.D., T.P. Stauffer, W.P. Yang, J.D. York, L. Huang, M.A. Blanar, T. Meyer, and K.G. Peters. 1998. Tyrosine 1101 of Tie2 is the major site of association of p85 and is required for activation of phosphatidylinositol 3-kinase and Akt. Mol. Cell. Biol. 18:41314140.
Kraynov, V.S., C. Chamberlain, G.M. Bokoch, M.A. Schwartz, S. Slabaugh, and K.M. Hahn. 2000. Localized Rac activation dynamics visualized in living cells. Science. 290:333337.
Lauffenburger, D.A., and A.F. Horwitz. 1996. Cell migration: a physically integrated molecular process. Cell. 84:359369.[CrossRef][Medline]
Miki, H., H. Yamaguchi, S. Suetsugu, and T. Takenawa. 2000. IRSp53 is an essential intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature. 408:732735.[CrossRef][Medline]
Nishiya, N., W.B. Kiosses, J. Han, and M.H. Ginsberg. 2005. An alpha4 integrin-paxillin-Arf-GAP complex restricts Rac activation to the leading edge of migrating cells. Nat. Cell Biol. 7:343352.[CrossRef][Medline]
Nobes, C.D., and A. Hall. 1995. Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell. 81:5362.[CrossRef][Medline]
Nobes, C.D., and A. Hall. 1999. Rho GTPases control polarity, protrusion, and adhesion during cell movement. J. Cell Biol. 144:12351244.
Palazzo, A.F., H.L. Joseph, Y.J. Chen, D.L. Dujardin, A.S. Alberts, K.K. Pfister, R.B. Vallee, and G.G. Gundersen. 2001. Cdc42, dynein, and dynactin regulate MTOC reorientation independent of Rho-regulated microtubule stabilization. Curr. Biol. 11:15361541.[CrossRef][Medline]
Pankov, R., E. Cukierman, K. Clark, K. Matsumoto, C. Hahn, B. Poulin, and K.M. Yamada. 2003. Specific ß1 integrin site selectively regulates Akt/protein kinase B signaling via local activation of protein phosphatase 2A. J. Biol. Chem. 278:1867118681.
Pollard, T.D., and G.G. Borisy. 2003. Cellular motility driven by assembly and disassembly of actin filaments. Cell. 112:453465.[CrossRef][Medline]
Pollard, T.D., L. Blanchoin, and R.D. Mullins. 2000. Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu. Rev. Biophys. Biomol. Struct. 29:545576.[CrossRef][Medline]
Pradip, D., X. Peng, and D.L. Durden. 2003. Rac2 specificity in macrophage integrin signaling: potential role for Syk kinase. J. Biol. Chem. 278:4166141669.
Price, L.S., J. Leng, M.A. Schwartz, and G.M. Bokoch. 1998. Activation of Rac and Cdc42 by integrins mediates cell spreading. Mol. Biol. Cell. 9:18631871.
Raftopoulou, M., and A. Hall. 2004. Cell migration: Rho GTPases lead the way. Dev. Biol. 265:2332.[CrossRef][Medline]
Ridley, A.J., M.A. Schwartz, K. Burridge, R.A. Firtel, M.H. Ginsberg, G. Borisy, J.T. Parsons, and A.R. Horwitz. 2003. Cell migration: integrating signals from front to back. Science. 302:17041709.
Roberts, A.W., C. Kim, L. Zhen, J.B. Lowe, R. Kapur, B. Petryniak, A. Spaetti, J.D. Pollock, J.B. Borneo, G.B. Bradford, et al. 1999. Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense. Immunity. 10:183196.[CrossRef][Medline]
Sander, E.E., S. van Delft, J.P. ten Klooster, T. Reid, R.A. van der Kammen, F. Michiels, and J.G. Collard. 1998. Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either cell-cell adhesion or cell migration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol. 143:13851398.
Sasaki, A.T., C. Chun, K. Takeda, and R.A. Firtel. 2004. Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J. Cell Biol. 167:505518.
Schlunck, G., H. Damke, W.B. Kiosses, N. Rusk, M.H. Symons, C.M. Waterman-Storer, S.L. Schmid, and M.A. Schwartz. 2004. Modulation of Rac localization and function by dynamin. Mol. Biol. Cell. 15:256267.
Servant, G., O.D. Weiner, P. Herzmark, T. Balla, J.W. Sedat, and H.R. Bourne. 2000. Polarization of chemoattractant receptor signaling during neutrophil chemotaxis. Science. 287:10371040.
Sheetz, M.P., D. Felsenfeld, C.G. Galbraith, and D. Choquet. 1999. Cell migration as a five-step cycle. Biochem. Soc. Symp. 65:233243.[Medline]
Srinivasan, S., F. Wang, S. Glavas, A. Ott, F. Hofmann, K. Aktories, D. Kalman, and H.R. Bourne. 2003. Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J. Cell Biol. 160:375385.
Sun, C.X., G.P. Downey, F. Zhu, A.L. Koh, H. Thang, and M. Glogauer. 2004. Rac1 is the small GTPase responsible for regulating the neutrophil chemotaxis compass. Blood. 104:37583765.
Trinkaus, J.P. 1969. Cells into Organs: The Forces that Shape the Embryo. Prentice-Hall, Englewood Cliffs, NJ. 237 pp.
Van Haastert, P.J., and P.N. Devreotes. 2004. Chemotaxis: signalling the way forward. Nat. Rev. Mol. Cell Biol. 5:626634.[CrossRef][Medline]
Vasiliev, J.M., I.M. Gelfand, L.V. Domnina, O.Y. Ivanova, S.G. Komm, and L.V. Olshevskaja. 1970. Effect of colcemid on the locomotory behaviour of fibroblasts. J. Embryol. Exp. Morphol. 24:625640.[Medline]
Walpita, D., and E. Hay. 2002. Studying actin-dependent processes in tissue culture. Nat. Rev. Mol. Cell Biol. 3:137141.[CrossRef][Medline]
Weiner, O.D. 2002. Regulation of cell polarity during eukaryotic chemotaxis: the chemotactic compass. Curr. Opin. Cell Biol. 14:196202.[CrossRef][Medline]
Weiss-Haljiti, C., C. Pasquali, H. Ji, C. Gillieron, C. Chabert, M.L. Curchod, E. Hirsch, A.J. Ridley, R.H. van Huijsduijnen, M. Camps, and C. Rommel. 2004. Involvement of phosphoinositide 3-kinase gamma, Rac, and PAK signaling in chemokine-induced macrophage migration. J. Biol. Chem. 279:4327343284.
Wu, R.F., Y. Gu, Y.C. Xu, F.E. Nwariaku, and L.S. Terada. 2003. Vascular endothelial growth factor causes translocation of p47phox to membrane ruffles through WAVE1. J. Biol. Chem. 278:3683036840.