|
|
|
|
|
|
|
||
Article |
Correspondence to Brian M. Cooke: brian.cooke{at}med.monash.edu.au
 Top Abstract IntroductionResultsDiscussionMaterials and methodsReferences |
|---|
 |
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
For most parasite proteins that are destined for the RBC membrane skeleton and the surface, trafficking seems to involve Maurer's clefts (Przyborski et al., 2003; Marti et al., 2004; Knuepfer et al., 2005). Clefts appear at the early trophozoite stage of parasite development and persist throughout the remainder of the intra-erythrocytic cycle. The final destination of Maurer's clefts in IRBCs does appear to be in juxtaposition with the RBC membrane skeleton, and there is some evidence to suggest that they may interact with actin, ankyrin, or other proteins associated with the RBC membrane skeleton such as LANCL1 (Blisnick et al., 2000, 2005). It is possible that Maurer's clefts dock with the RBC membrane skeleton and provide the exit site for proteins, such as PfEMP1, that are exposed on the surface of the IRBC; however, such a mechanism has not yet been demonstrated.
Several proteins have been described that are resident within Maurer's clefts, but there is no information about their functional roles and whether they may be involved in protein trafficking (Hawthorne et al., 2004; Vincensini et al., 2005). One of the first Maurer's cleft proteins to be described was P. falciparum SBP1 (skeleton-binding protein 1), a 48-kD integral membrane protein that spans the Maurer's cleft membrane (Blisnick et al., 2000). The NH2-terminal domain is found within the cleft, whereas the COOH-terminal domain is exposed within the IRBC cytoplasm and interacts with a RBC membrane skeleton protein, possibly participating in anchoring the clefts to the RBC membrane skeleton (Blisnick et al., 2000). To determine the function of SBP1 in IRBCs, we have generated clonal transgenic parasite lines in which SBP1 is not expressed and have extensively examined the biological properties of these mutant IRBCs. Analysis of the SBP1-deleted parasite line revealed that the major virulence factor PfEMP1 is not expressed on the surface of the IRBC and that the wild-type phenotype can be restored when the gene deletion is complemented. Importantly, the SBP1-deleted parasite line (SBP1 knockout [KO]) represents the first P. falciparum parasite line showing a knock-down in PfEMP1 surface expression.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
|
|
|
|
Transport of PfEMP1 is arrested at Maurer's clefts in SBP1-deleted parasite lines
To examine the fate of PfEMP1 in detail, we performed various immunochemical and proteolytic assays on surface-exposed PfEMP1 in both parental and mutant parasite lines. It has previously been shown that PfEMP1 changes its solubility during transport to the IRBC surface. Specifically, the protein is soluble in Triton X-100 during transport in the IRBC but becomes detergent insoluble/SDS soluble when incorporated into the knob structure on the IRBC surface (Kriek et al., 2003). In addition, the large NH2-terminal PfEMP1 exodomain is sensitive to trypsin when the protein is surface exposed (Waterkeyn et al., 2000). We analyzed the distribution of PfEMP1 in both wild-type and SBP1 KO parasites by Western blot analysis of the Triton X-100–insoluble/SDS-soluble fraction of membrane proteins with and without trypsin treatment of intact IRBCs (Fig. 5). Thus, in the parental 3D7 line, PfEMP1 was present in the Triton X-100–insoluble/SDS-soluble fraction and was cleaved after exposure to trypsin. In contrast, PfEMP1 was not present in the Triton X-100–insoluble/SDS-soluble fraction in the SBP1 KO line, and the protein was not sensitive to trypsin treatment (Fig. 5 A). To control for trypsin digestion, we examined the fate of an integral membrane and surface-exposed protein of human RBCs, glycophorin C, in both parental and mutant parasite lines. In both cases, glycophorin C was cleaved by the exogenous trypsin, demonstrating that PfEMP1 in the SBP1 KO line was not present on the IRBC surface but remained internal within the Maurer's clefts as shown by immunofluorescence assay (IFA; Fig. 3 C). The relative differences in the amount of PfEMP1 in this Triton X-100–insoluble fraction can be more readily visualized after the extensive preabsorption of anti-PfEMP1 antiserum against inside-out RBCs to reduce cross-reactivity of the antiserum with RBC spectrin (Fig. 5 B). There is almost no detectable product in the KO parasite line, suggesting that there is no intermediate compartment between residence in the Maurer's cleft and exposure on the surface. It also suggests that PfEMP1 has not exited the cleft but becomes trapped in association with the membrane skeleton en route to the IRBC surface. Together with our IFA experiments (Fig. 3), these data are consistent with a block in the surface expression of PfEMP1 at the level of the Maurer's clefts in the SBP1 KO parasite line.
|
|
80 d after transfection revealed that the resulting parasites, 1G8/sbp1, were clearly producing SBP1, although at a somewhat lower level than seen in wild-type parasites (Fig. 2 C). When live IRBCs were viewed under 513-nm blue light, Maurer's clefts were visualized as fluorescing structures throughout the cytoplasm of the IRBC, with a proportion of clefts in close association with the RBC membrane skeleton (Fig. 7). Analysis of these 1G8/sbp1 parasites by immunofluorescence and confocal microscopy revealed that the SBP1-EYFP chimeric protein was trafficked correctly to Maurer's clefts that were located at the RBC membrane skeleton (Figs. 3 and 7). The SBP1-EYFP protein also colocalized with REX (Fig. 3) and other Maurer's cleft markers (Pf332 and KAHRP; not depicted), demonstrating that the SBP1-EYFP chimeric protein was being trafficked to its native cellular location.
|
Reintroduction of the full-length sbp1 gene into 1G8 parasites also dramatically restored the ability of both complemented lines to adhere to CD36 under both static and flow conditions. For example, in static assays, the reintroduction of sbp1 into 1G8 parasites restored adhesion such that 1G8/sbp1 IRBCs bound at levels 60-fold higher than 1G8 IRBCs (76.1 ± 16.5% vs. 1.3 ± 1.3%; mean ± SEM for 1G8/sbp1 and 1G8 parasite clones, respectively). Similarly, when tested under flow, adhesion of 1G8/sbp1 IRBCs showed a level of binding similar to that measured for 3D7 IRBCs (Fig. 6). Interestingly, the 1G8/sbp1.1 complemented line showed a consistently higher level of adhesion in both static and flow assays when compared with the wild-type 3D7 (not depicted). The amount of surface-exposed PfEMP1 that exerts this adhesive effect would appear to be quite small, as there is no detectable difference in appearance by IFA of either 1G8 or the complemented parasite lines (Fig. 3).
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
SBP1 has previously been shown to be a membrane protein resident in Maurer's clefts that is oriented so that its COOH-terminal domain is present in the RBC cytoplasm (Blisnick et al., 2000). Its function was previously unknown, although it has been suggested that it might be involved in binding the cleft to the RBC membrane skeleton through a specific interaction with proteins of the RBC membrane skeleton such as actin (Blisnick et al., 2000) or RBC membrane–associated proteins such as LANCL1 (Blisnick et al., 2005). SBP1 is clearly not an essential structural protein of the cleft, as its absence does not affect cleft morphology or number markedly. The subtle changes in cleft morphology related to the deletion of SBP1 noted in our studies here may merely represent the loss of SBP1 itself or the loss of a group of associated proteins that are anchored to the cleft by interaction with SBP1. We also conclude that it is not a required part of the general trafficking mechanism for parasite proteins exported to the RBC as Maurer's cleft–associated proteins because PfEMP3, Pf332, KAHRP, REX, and MAHRP are trafficked normally to the membrane skeleton of RBCs infected with sbp1-deleted parasites. Furthermore, the cytoadherence-related knob complexes on the surface of the IRBC form normally in sbp1-deleted parasite clones.
In fact, SBP1 appears to have a precise function, which is to mediate the final step in the translocation of PfEMP1 on to the surface of the IRBC. We conclude this from our observations that PfEMP1 is present in Maurer's clefts in an sbp1-deleted parasite line but does not appear on the surface of RBCs infected with mature stage parasites. The failure of PfEMP1 to reach the RBC surface leads to a loss of binding of IRBCs to CD36 both in static and flow-based adhesion assays. Reintroduction of the SBP1 protein leads to the reappearance of PfEMP1 on the IRBC surface and restoration of the capacity of IRBCs to adhere to CD36. What is the mechanism by which SBP1 has this effect on PfEMP1 trafficking? Our evidence would suggest that this is not caused by a direct physical interaction between PfEMP1 and SBP1. First, analysis of the SBP1 protein sequence does not reveal any domains with homology to known protein chaperones or to proteins known to be involved in protein trafficking or vesicular transport of proteins. Second, immunoprecipitation of SBP1 from IRBC lysates does not lead to the coprecipitation of PfEMP1 (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200509122/DC1). Third, acceptor photobleaching fluorescent resonance energy transfer (FRET) experiments in which PfEMP1 and SBP1 were labeled with FRET-compatible fluorophores did not lead to the detectable transfer of energy from one molecule to the other (Fig. S1). This suggests that they are not found in close contact as would be expected in directly interacting proteins. Finally, a recent study devoted to the P. falciparum interactome reported the interactions of PfEMP1 and SBP1 with other proteins in the parasite but did not find a direct interaction between the two (LaCount et al., 2005). Collectively, these data suggest that the effect of SBP1 on PfEMP1 transport is indirect. At present, the data are most compatible with the hypothesis that the alterations in Maurer's cleft morphology and distance to the IRBC surface leads to changes that make the final translocation step of PfEMP1 markedly inefficient. These changes are subtle, and this is likely to be the reason why trafficking of only one protein, PfEMP1, is interfered with and not others such as KAHRP, which presumably have more margin for error in the relatively straightforward process of binding to nearby spectrin. In contrast, PfEMP1 must successfully perform translocation across another membrane to reach its final destination, presumably using the transmembrane and COOH-terminal domains of PfEMP1, as these have been demonstrated to be sufficient for translocation of the protein across the RBC membrane (Knuepfer et al., 2005). Whatever the ultimate mechanism, it is clear that SBP1 has a general role in PfEMP1 trafficking as surface localization of PfEMP1 is restored in complemented lines expressing variant forms of the protein.
The specific function of SBP1 in PfEMP1 translocation is consistent with its phylogenetic distribution within malaria species. We have examined several Plasmodium spp. genomes and are unable to identify a homologue of sbp1 either by direct homology searching using the Basic Local Alignment Search Tool (BLAST) or Position-Specific Iterated BLAST. The sbp1 gene is located between the genes for the exported parasite proteins mesa and fira at the subtelomeric end of chromosome 5 in P. falciparum. Orthology searches in the Plasmodium genome database (www.PlasmoDB.org) revealed that synteny between P. falciparum chromosome 5 and a contig from both Plasmodium vivax and Plasmodium yoelii breaks down at the rap2 locus. This suggests that the more subtelomeric part of chromosome 5, including fira, sbp1, and mesa, is specific only to P. falciparum (Fig. 1). Other species of Plasmodium lack a PfEMP1-like molecule, so it is reasonable that a protein specific for translocation should also be absent from the same species. In this context, it is interesting to note that deletion of the subtelomeric end of chromosome 2 of P. falciparum (which frequently occurs within the kahrp locus) results in the loss of knobs and cytoadherence of IRBCs, although PfEMP1 is still expressed on the IRBC surface (Cooke et al., 2002c). In addition, the kahrp locus is also the breakpoint of synteny between P. falciparum chromosome 2 and a large P. vivax contig (Sargeant et al., 2006). This supports the idea of a few P. falciparum–specific subtelomeric loci that are critical for the transport and function of PfEMP1 and, consequently, in cytoadherence of IRBC to host vascular endothelium. The absence of sbp1 in other malaria species that express proteins on the surface of the IRBC and that are involved in antigenic variation such as the yir, vir, and kir gene families (collectively termed the Plasmodium interspersed repeat superfamily [pir]; Janssen et al., 2004) also suggests that these molecules reach the surface of the IRBC by some other mechanism. As RIFINs are the P. falciparum representatives of the pir family in that species, it seems very likely that their trafficking to the IRBC surface in P. falciparum occurs by an SBP1-independent mechanism. We cannot examine this directly in our sbp1 KO line because it is generated on a 3D7 parasite background, a line that does not express detectable RIFINs on the RBC surface (Kyes et al., 1999).
In conclusion, we show here, for the first time, that the Maurer's cleft–associated protein SBP1 plays a major role in translocation of the cytoadherence ligand PfEMP1 onto the surface of P. falciparum–infected RBCs. We have demonstrated this via complementation of a gene KO parasite line, which is the first study to our knowledge of the complementation of a blood stage gene in Plasmodium spp. Future studies will be aimed at identifying the precise mechanisms and interactions involved in this process and whether other molecular players are involved. Such knowledge might be used to interfere with the translocation process, which in vivo would be likely to be associated with a marked decrease in parasite virulence and may constitute a new therapeutic approach to the control of malaria infection in humans in the future. The availability of specific PfEMP1-null lines also makes possible new studies examining such questions as the importance of PfEMP1 in the pathogenesis of malaria by, for example, the disruption of SBP1 in monkey-adapted parasite lines and subsequent infection of primate hosts. If such parasite lines are avirulent in the vertebrate host, they could become the basis of a genetically defined attenuated vaccine for use in humans.
|
Materials and methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
Plasmid constructs
To disrupt the sbp1 gene in 3D7 parasites, 5' and 3' sequences of 1 kb flanking the sbp1 gene were cloned into the P. falciparum transfection plasmid pHHT-TK (gift from A. Cowman and B. Crabb, The Walter and Eliza Hall Institute, Melbourne, Australia; Duraisingh et al., 2002) to derive pHTK
sbp1 (Fig. 2 A). Specifically, the 5' segment of sbp1 (including 458 bp of the 5' untranslated sequence) was amplified from genomic DNA from 3D7 parasites using forward and reverse primers 5'TCCCCGCGGcgatacaaccctccttttatg3' (SacII site underlined) and 5'GGACTAGTgacatagattcggctgga3' (SpeI site underlined), respectively, and was subcloned into the SacII and SpeI sites of pHHT-TK upstream of the hdhfr resistance cassette. The 3' segment of sbp1 (including 437 bp of the 3' untranslated sequence) was amplified using the forward and reverse primers 5'CGGAATTCgcagattttgcaaaacaagc3' (EcoRI site underlined) and 5'CATGCCATGGcatatacataaacgatcaaaag3' (NcoI site underlined), respectively, and was introduced into the EcoRI and NcoI sites downstream of the hdhfr cassette. Plasmid DNA was amplified in Escherichia coli and purified using MegaPrep (QIAGEN).
For complementation, the full-length sbp1 gene (excluding the stop codon) was PCR amplified from 3D7 cDNA using the forward and reverse primers 5'CACCTATATACAatgtgtagcgcagctcgagca3' and ggtttctctagcaactgtttttg, respectively, and was cloned using topoisomerase into the multisite Gateway entry vector pENTR/D-TOPO (Invitrogen). This was recombined together with pDONR P4-P1R vector containing the P. falciparum Hsp86 promoter and pDONR P2R-P3 vector containing the EYFP reporter gene into a destination vector, pHrB1-1/2, that had been previously modified for use in P. falciparum (van Dooren et al., 2005) to produce the expression plasmid pHrB1-1/2-sbp1.
Parasite transfection
Ring-stage parasites were transfected by electroporation with 150 µg of purified supercoiled plasmid DNA (pHTksbp1) diluted in cytomix according to standard procedures (Wu et al., 1996) but using modified electroporation conditions to enhance DNA delivery (Fidock and Wellems, 1997). Transfected parasites were cultured in the presence of 2.5 nM of the antifolate drug WR99210 (Fidock and Wellems, 1997) for 30 d until viable parasites were observed in Giemsa-stained smears. 4 µM ganciclovir (Roche Diagnostics) was then added to select for parasites having only double crossover homologous recombination (Duraisingh et al., 2002). For complementation, positive selection for parasites transformed with pHrB1-1/2-sbp1 was performed using 8 µM blasticidin S hydrochloride (Calbiochem) as previously described (Mamoun et al., 1999).
DNA extraction and Southern blotting
Genomic DNA was extracted from parasite culture using the Nucleon BACC2 kit (GE Healthcare), digested with ClaI and EcoRI, separated on 1% agarose gels, and transferred to nylon membranes. Southern blot hybridization was performed using standard procedures.
Western blotting
Cultured IRBCs were harvested on Percoll and solubilized in 2x reducing SDS sample buffer containing protease inhibitor cocktail (Roche Diagnostics). These total parasite extracts were separated on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were probed with rabbit polyclonal anti-HSP70 (1:10,000), mouse polyclonal anti-SBP1 (1:400), or mouse monoclonal antiglycophorin C (1:500; Sigma-Aldrich) antibodies. Detection by enhanced chemiluminescence (Lumi-light Western blotting substrate; Roche Diagnostics) was performed after secondary detection with either sheep anti–rabbit or sheep anti–mouse Ig-HRP conjugate (1:2,000; Silenus).
Analysis of PfEMP1 expression on the surface of IRBCs by trypsin cleavage assay
The trypsin cleavage assay was performed as previously described (Waterkeyn et al., 2000) to visualize PfEMP1 expressed on the IRBC surface. In brief, mature IRBCs were enriched on Percoll as previously described (Dluzewski et al., 1984) and were incubated with 100 µg/ml TPCK-treated trypsin (Sigma-Aldrich) in the presence or absence of 1 mg/ml soybean trypsin inhibitor (STI; Sigma-Aldrich) for 15 min at 37°C. Reactions were stopped by the addition of STI to a final concentration of 1 mg/ml followed by a further incubation of 15 min at room temperature. Membrane proteins (including PfEMP1) were extracted using Triton X-100 and SDS solubilization as described previously (Van Schravendijk et al., 1993) and diluted in reducing Laemmli sample buffer. Samples were separated on 6% SDS-PAGE gels and transferred for 4 h at 4°C onto PVDF membranes. The cytoplasmic tail of PfEMP1 (VARC) was detected using the mouse monoclonal antibody 1B/98-6H1-1 (1:100; gift from The Walter and Eliza Hall Institute).
Fluorescence and confocal microscopy
For indirect immunofluorescence, cultured RBCs were fixed in suspension with 4% PFA containing 0.0075% glutaraldehyde in PBS, permeabilized with 0.1% Triton X-100, and blocked with 3% BSA in PBS as previously described (Tonkin et al., 2004). Cells were then incubated for 1 h with either mouse polyclonal anti-SBP1 (1:500), rabbit polyclonal anti-KAHRP (1:500), rabbit polyclonal anti-Pf332 (1:200), rabbit polyclonal anti–REX-1 (1:2,000; gift from D. Gardiner, Queensland Institute of Medical Research, Brisbane, Australia), mouse polyclonal anti–MAHRP-1 (1:200; gift from C. Spycher and H.-P. Beck, Swiss Tropical Institute, Basel, Switzerland), or rabbit polyclonal anti-GFP (1:1.000; Invitrogen). For PfEMP1 localization using rabbit polyclonal anti-VARC (1:100), detection was performed using thin culture smears that had been air dried and fixed with cold acetone/methanol (9:1) because this antibody showed poor reactivity when used on RBCs that had been fixed with PFA/glutaraldehyde in suspension using the method of Tonkin et al. (2004). Primary antibodies were then detected using either anti–mouse or anti–rabbit IgG conjugated to AlexaFluor488 or -568 (Invitrogen) and visualized using a laser-scanning confocal microscope (model TCS NT; Leica) equipped with a krypton/argon laser (488/568 nm). The confocal scan head was mounted on an inverted microscope (model DM RBE; Leica) equipped with a 100x NA 1.4 oil plan-Apo objective. All images of individual RBCs shown in figures are representative of numerous similar RBCs in multiple fields of view. Green fluorescence of EYFP-expressing transformants was observed using live unfixed RBCs directly from culture under 513-nm light using a fluorescence microscope (BX51; Olympus).
Morphometric analysis of knobs and Maurer's clefts by electron microscopy
RBCs from synchronous cultures containing predominantly mature stage parasites (late trophozoites/young schizonts) were fixed by the dilution of packed RBCs into isotonic PBS containing 2.5% (vol/vol) electron microscopy grade glutaraldehyde (Sigma-Aldrich). After routine preparative procedures (Bannister et al., 2003), ultrathin sections were prepared for transmission electron microscopy and pelleted for SEM. Random images of IRBCs were captured digitally at a magnification of 20,000x in an electron microscope (H7600; Hitachi) and analyzed using Scion Image software (v4.0.2). Electron-dense knobs and Maurer's clefts were counted manually for each IRBC. A total of 32 IRBCs were examined for each of the parasite lines 3D7 and 1G8. Parameters measured were (1) the perimeter of each IRBC, (2) the total sectional area of each IRBC, and (3) the sectional area of the parasite (if more than one parasitewas present, their areas were added together). From the second and third parameters, the area of IRBC external to the parasite was obtained by subtraction. Knobs and Maurer's clefts were counted manually to determine their frequencies.
IRBC adhesion assays
The adhesive properties of IRBCs were quantified using both static and flow-based assays. Parasite cultures were tested when the majority of parasites were pigmented trophozoites as assessed by Giemsa-stained smears. Cultured RBCs were resuspended in adhesion buffer (Hepes-buffered RPMI 1640 supplemented with 1% BSA and pH adjusted to 7.0) to a concentration of 3 x 108 RBCs/ml for static adhesion assays or 1.5 x 108 RBCs/ml for flow-based assays. For all adhesion assays, the parasitemia averaged 4.4% trophozoites (range of 2.2–7.8%). Static assays were performed in 36-mm petri dishes as previously described (Beeson et al., 1998) except that purified recombinant CD36 (R&D Systems) was immobilized as the target receptor (100 µg/ml). Adhesion to CD36 under flow conditions that mimic those in postcapillary venules was visualized and quantified in vitro by direct microscopic observation on a microscope (IMT-2; Olympus) with a 40x water immersion objective (Olympus) using flat, rectangular glass microcapillary tubes (Microslides; VitroCom, Inc.) connected to a flow-control system as previously described (Cooke et al., 2002a,b).
Online supplemental material
Fig. S1 shows the results from immunoprecipitation and FRET experiments to demonstrate that there is no direct molecular interaction between SBP1 and PfEMP1 in IRBCs infected with 3D7 parasites. Supplemental text provides details of these FRET and immunoprecipitation experiments. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200509122/DC1.
|
Acknowledgments |
|---|
We acknowledge financial support from the National Health and Medical Research Council (NHMRC) of Australia, the National Institutes of Health (grants DK32094 and AI44008), and the Wellcome Trust (grant 069515). B.M. Cooke is an NHMRC Senior Research Fellow.
Submitted: 20 September 2005
Accepted: 6 February 2006
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and methodsReferences |
|---|
Bannister, L.H., J.M. Hopkins, A.R. Dluzewski, G. Margos, I.T. Williams, M.J. Blackman, C.H. Kocken, A.W. Thomas, and G.H. Mitchell. 2003. Plasmodium falciparum apical membrane antigen 1 (PfAMA-1) is translocated within micronemes along subpellicular microtubules during merozoite development. J. Cell Sci. 116:3825–3834.
Baruch, D.I., S.J. Rogerson, and B.M. Cooke. 2002. Asexual blood stages of malaria antigens: cytoadherence. Chem. Immunol. 80:144–162.[Medline]
Beeson, J.G., W. Chai, S.J. Rogerson, A.M. Lawson, and G.V. Brown. 1998. Inhibition of binding of malaria-infected erythrocytes by a tetradecasaccharide fraction from chondroitin sulfate A. Infect. Immun. 66:3397–3402.
Blisnick, T., M.E. Morales Betoulle, J.C. Barale, P. Uzureau, L. Berry, S. Desroses, H. Fujioka, D. Mattei, and C. Braun Breton. 2000. Pfsbp1, a Maurer's cleft Plasmodium falciparum protein, is associated with the erythrocyte skeleton. Mol. Biochem. Parasitol. 111:107–121.[CrossRef][Medline]
Blisnick, T., L. Vincensini, J.C. Barale, A. Namane, and C. Braun Breton. 2005. LANCL1, an erythrocyte protein recruited to the Maurer's clefts during Plasmodium falciparum development. Mol. Biochem. Parasitol. 141:39–47.[CrossRef][Medline]
Cooke, B.M., N. Mohandas, and R.L. Coppel. 2001. The malaria-infected red blood cell: structural and functional changes. Adv. Parasitol. 50:1–86.[CrossRef][Medline]
Cooke, B.M., R.L. Coppel, and G.B. Nash. 2002a. Analysis of the adhesive properties of Plasmodium falciparum-infected red blood cells under conditions of flow. Methods Mol. Med. 72:561–569.[Medline]
Cooke, B.M., R.L. Coppel, and G.B. Nash. 2002b. Preparation of adhesive targets for flow-based cytoadhesion assays. Methods Mol. Med. 72:571–579.[Medline]
Cooke, B.M., F.K. Glenister, N. Mohandas, and R.L. Coppel. 2002c. Assignment of functional roles to parasite proteins in malaria-infected red blood cells by competitive flow-based adhesion assay. Br. J. Haematol. 117:203–211.[CrossRef][Medline]
Cooke, B.M., N. Mohandas, and R.L. Coppel. 2004. Malaria and the red blood cell membrane. Semin. Hematol. 41:173–188.[Medline]
Cranmer, S.L., C. Magowan, J. Liang, R.L. Coppel, and B.M. Cooke. 1997. An alternative to serum for cultivation of Plasmodium falciparum in vitro. Trans. R. Soc. Trop. Med. Hyg. 91:363–365.[CrossRef][Medline]
Dluzewski, A.R., I.T. Ling, K. Rangachari, P.A. Bates, and R.J.M. Wilson. 1984. A simple method for isolating viable mature parasites of Plasmodium falciparum from cultures. Trans. R. Soc. Trop. Med. Hyg. 78:622–624.[CrossRef][Medline]
Duraisingh, M.T., T. Triglia, and A.F. Cowman. 2002. Negative selection of Plasmodium falciparum reveals targeted gene deletion by double crossover recombination. Int. J. Parasitol. 32:81–89.[CrossRef][Medline]
Fidock, D.A., and T.E. Wellems. 1997. Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil. Proc. Natl. Acad. Sci. USA. 94:10931–10936.
Hawthorne, P.L., K.R. Trenholme, T.S. Skinner-Adams, T. Spielmann, K. Fischer, M.W. Dixon, M.R. Ortega, K.L. Anderson, D.J. Kemp, and D.L. Gardiner. 2004. A novel Plasmodium falciparum ring stage protein, REX, is located in Maurer's clefts. Mol. Biochem. Parasitol. 136:181–189.[CrossRef][Medline]
Hiller, N.L., S. Bhattacharjee, C. van Ooij, K. Liolios, T. Harrison, C. Lopez-Estrano, and K. Haldar. 2004. A host-targeting signal in virulence proteins reveals a secretome in malarial infection. Science. 306:1934–1937.
Janssen, C.S., R.S. Phillips, C.M. Turner, and M.P. Barrett. 2004. Plasmodium interspersed repeats: the major multigene superfamily of malaria parasites. Nucleic Acids Res. 32:5712–5720.
Kemp, D.J., L.M. Corcoran, R.L. Coppel, H.D. Stahl, A.E. Bianco, G.V. Brown, and R.F. Anders. 1985. Size variation in chromosomes from independent cultured isolates of Plasmodium falciparum. Nature. 315:347–350.[CrossRef][Medline]
Kenworthy, A.K. 2001. Imaging protein-protein interactions using fluorescence resonance energy transfer microscopy. Methods. 24:289–296.[CrossRef][Medline]
Knuepfer, E., M. Rug, N. Klonis, L. Tilley, and A.F. Cowman. 2005. Trafficking of the major virulence factor to the surface of transfected P. falciparum-infected erythrocytes. Blood. 105:4078–4087.
Kriek, N., L. Tilley, P. Horrocks, R. Pinches, B.C. Elford, D.J. Ferguson, K. Lingelbach, and C.I. Newbold. 2003. Characterization of the pathway for transport of the cytoadherence-mediating protein, PfEMP1, to the host cell surface in malaria parasite-infected erythrocytes. Mol. Microbiol. 50:1215–1227.[CrossRef][Medline]
Kyes, S.A., J.A. Rowe, N. Kriek, and C.I. Newbold. 1999. Rifins: a second family of clonally variant proteins expressed on the surface of red cells infected with Plasmodium falciparum. Proc. Natl. Acad. Sci. USA. 96:9333–9338.
LaCount, D.J., M. Vignali, R. Chettier, A. Phansalkar, R. Bell, J.R. Hesselberth, L.W. Schoenfeld, I. Ota, S. Sahasrabudhe, C. Kurschner, et al. 2005. A protein interaction network of the malaria parasite Plasmodium falciparum. Nature. 438:103–107.[CrossRef][Medline]
MacPherson, G.G., M.J. Warrell, N.J. White, S. Looareesuwan, and D.A. Warrell. 1985. Human cerebral malaria. A quantitative ultrastructural analysis of parasitized erythrocyte sequestration. Am. J. Pathol. 119:385–401.[Abstract]
Mamoun, C.B., I.Y. Gluzman, S. Goyard, S.M. Beverley, and D.E. Goldberg. 1999. A set of independent selectable markers for transfection of the human malaria parasite Plasmodium falciparum. Proc. Natl. Acad. Sci. USA. 96:8716–8720.
Marti, M., R.T. Good, M. Rug, E. Knuepfer, and A.F. Cowman. 2004. Targeting malaria virulence and remodeling proteins to the host erythrocyte. Science. 306:1930–1933.
Papakrivos, J., C.I. Newbold, and K. Lingelbach. 2005. A potential novel mechanism for the insertion of a membrane protein revealed by a biochemical analysis of the Plasmodium falciparum cytoadherence molecule PfEMP-1. Mol. Microbiol. 55:1272–1284.[CrossRef][Medline]
Pongponratn, E., M. Riganti, B. Punpoowong, and M. Aikawa. 1991. Microvascular sequestration of parasitized erythrocytes in human falciparum malaria: a pathological study. Am. J. Trop. Med. Hyg. 44:168–175.
Przyborski, J.M., H. Wickert, G. Krohne, and M. Lanzer. 2003. Maurer's clefts—a novel secretory organelle? Mol. Biochem. Parasitol. 132:17–26.[CrossRef][Medline]
Sargeant, T.J., M. Marti, K. Simpson, E. Caler, J.M. Carlton, T. Speed, and A.F. Cowman. 2006. Lineage-specific expansion of proteins exported from malaria parasites to host erythrocytes. Genome Biol. In press.
Spycher, C., N. Klonis, T. Spielmann, E. Kump, S. Steiger, L. Tilley, and H.P. Beck. 2003. MAHRP-1, a novel Plasmodium falciparum histidine-rich protein, binds ferriprotoporphyrin IX and localizes to the Maurer's clefts. J. Biol. Chem. 278:35373–35383.
Tonkin, C.J., G.G. van Dooren, T.P. Spurck, N.S. Struck, R.T. Good, E. Handman, A.F. Cowman, and G.I. McFadden. 2004. Localization of organellar proteins in Plasmodium falciparum using a novel set of transfection vectors and a new immunofluorescence fixation method. Mol. Biochem. Parasitol. 137:13–21.[CrossRef][Medline]
Topolska, A.E., A. Lidgett, D. Truman, H. Fujioka, and R.L. Coppel. 2004. Characterization of a membrane-associated rhoptry protein of Plasmodium falciparum. J. Biol. Chem. 279:4648–4656.
van Dooren, G.G., M. Marti, C.J. Tonkin, L.M. Stimmler, A.F. Cowman, and G.I. McFadden. 2005. Development of the endoplasmic reticulum, mitochondrion and apicoplast during the asexual life cycle of Plasmodium falciparum. Mol. Microbiol. 57:405–419.[CrossRef][Medline]
Van Schravendijk, M.R., B.L. Pasloske, D.I. Baruch, S.M. Handunnetti, and R.J. Howard. 1993. Immunochemical characterization and differentiation of two approximately 300-kD erythrocyte membrane-associated proteins of Plasmodium falciparum, PfEMP1 and PfEMP3. Am. J. Trop. Med. Hyg. 49:552–565.
Vincensini, L., S. Richert, T. Blisnick, A. Van Dorsselaer, E. Leize-Wagner, T. Rabilloud, and C. Braun Breton. 2005. Proteomic analysis identifies novel proteins of the Maurer's clefts, a secretory compartment delivering Plasmodium falciparum proteins to the surface of its host cell. Mol. Cell. Proteomics. 4:582–593.
Waterkeyn, J.G., M.E. Wickham, K.M. Davern, B.M. Cooke, R.L. Coppel, J.C. Reeder, J.G. Culvenor, R.F. Waller, and A.F. Cowman. 2000. Targeted mutagenesis of Plasmodium falciparum erythrocyte membrane protein 3 (PfEMP3) disrupts cytoadherence of malaria-infected red blood cells. EMBO J. 19:2813–2823.[CrossRef][Medline]
Waterkeyn, J.G., A.F. Cowman, and B.M. Cooke. 2001. Plasmodium falciparum: gelatin enrichment selects for parasites with full-length chromosome 2. Implications for cytoadhesion assays. Exp. Parasitol. 97:115–118.[CrossRef][Medline]
Wickert, H., F. Wissing, K.T. Andrews, A. Stich, G. Krohne, and M. Lanzer. 2003. Evidence for trafficking of PfEMP1 to the surface of P. falciparum-infected erythrocytes via a complex membrane network. Eur. J. Cell Biol. 82:271–284.[CrossRef][Medline]
Wickham, M.E., M. Rug, S.A. Ralph, N. Klonis, G.I. McFadden, L. Tilley, and A.F. Cowman. 2001. Trafficking and assembly of the cytoadherence complex in Plasmodium falciparum-infected human erythrocytes. EMBO J. 20:5636–5649.[CrossRef][Medline]
Wu, Y., L.A. Kirkman, and T.E. Wellems. 1996. Transformation of Plasmodium falciparum malaria parasites by homologous integration of plasmids that confer resistance to pyrimethamine. Proc. Natl. Acad. Sci. USA. 93:1130–1134.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
Related Article
This article has been cited by other articles:
| ||||||||||||||||||||||||
and ß spectrin. An identical blot was probed with mouse antiglycophorin C antibody (GpC) as a control for trypsin activity. An 80-kD band was detected in 3D7 parasites (VARC) representing the cytoplasmic domain of surface-exposed PfEMP1 in these IRBCs. Note the absence of this band in the sbp1-deleted parasite clone (1G8), confirming a lack of surface-exposed PfEMP1 in these IRBCs. The complemented 1G8/sbp1 parasite clone shows the reappearance of a trypsin-cleavable PfEMP1, although its cytoplasmic domain appears to be larger (
